Search Results

Search found 77950 results on 3118 pages for 'large file upload'.

Page 131/3118 | < Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >

  • awk + sorting file according to values in the file and write two diffrent files

    - by yael
    hi I have in file file_test values of right eye and left eye How to separate the file_test to file1 and file2 by awk in order to write the equal values on file1 and different values on file2 as the following example down THX file_test: NAME: jim LAST NAME: bakker right eye: |5|< left eye VALUE: |5|< NAME: Jorg LAST NAME: mitchel right eye: |3|< left eye VALUE: |5|< NAME: jimmy LAST NAME: kartter right eye: |6|< left eye VALUE: |5|< NAME: david LAST NAME: kann right eye: |9|< left eye VALUE: |9|< file1: NAME: jim LAST NAME: bakker right eye: |5|< left eye VALUE: |5|< NAME: david LAST NAME: kann right eye: |9|< left eye VALUE: |9|< file2: NAME: Jorg LAST NAME: mitchel right eye: |3|< left eye VALUE: |5|< NAME: jimmy LAST NAME: kartter right eye: |6|< left eye VALUE: |5|<

    Read the article

  • how to access a type defined in one .ml file in another .ml file

    - by user339261
    Hi, I m very new to ocaml and i m facing the problem below, In a.ml a record type t is defined and is also defined transparently in a.mli, i.e. in d interface so that the type definition is available to all other files. a.ml also has a function, func, which returns a list of t. Now in another file, b.ml i m calling func, now obviously ocaml compiler wud nt be able to infer d type of objects stored in d list, for compiler its just a list. so in b.ml, i hav something like dis, let tlist = A.func in let vart = List.hd tlist in printf "%s\n" vart.name (name is a field in record t) Now here i get a compiler error sayin "Unbound record field label name" which makes sense as compiler can't infer d type of vart. my first question: how do I explicitly provide d type of vart as t here? i tried doing "let vart:A.t = " but got the same error. I also tried creating another function to fetch the first element of d list and mentioning return type as A.t, but then i got the "Unbound value A.t". I did this: let firstt = function [] - 0 | x :: _ - A.t x ;; The problem is compiler is unable to recognize A.t (a type) in b.ml but is able to recognize function A.func. If I remove A.t from the b.ml, i don'get any compiler errors. Please help, its urgent work. Thanks in advance! ~Tarun

    Read the article

  • how to run XSL file using JavaScript / HTML file

    - by B. Kumar
    i want to run xsl file using javascript function. I wrote a javascrpt function which is working well with Firefox and Crom but it is not working on Internet Explorer function loadXMLDoc(dname) { if (window.XMLHttpRequest) { xhttp=new XMLHttpRequest(); } else { xhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xhttp.open("GET",dname,false); xhttp.send(""); return xhttp.responseXML; } function displayResult() { xml=loadXMLDoc("NewXml.xml"); xsl=loadXMLDoc("NewFile.xsl"); // code for IE if (window.ActiveXObject) { ex=xml.transformNode(xsl); document.getElementById("example").innerHTML=ex; } // code for Mozilla, Firefox, Opera, etc. else if (document.implementation && document.implementation.createDocument) { xsltProcessor=new XSLTProcessor(); xsltProcessor.importStylesheet(xsl); resultDocument = xsltProcessor.transformToFragment(xml,document); document.getElementById("example").appendChild(resultDocument); } } Please help my by modifying this code or by another code so that i can work with Internet Explorer. Thanks

    Read the article

  • Accessing objects on one nib file from another nib file

    - by ASN
    I have two nib files Main.nib and Preferernces.nib I have a class CalendarView.m that inherits from NSView .It has a method for drawing calendar - (void)drawCalendar; In Main.nib window I have NSWindow(My Main window) which has an NSView item on it for displaying calendar.Main window has an NSPopUp button that shows a menu when application runs. Menu has a 'Preferences' menu item which on clicking show a preferences panel(NSPanel) that panel is in Preferences.nib file.Panel has a colorwell item .When application is executed clcking on colorwell show a color panel to choose color .But I am unable to apply that color to my calendar. I have another class PreferencesWindowController.m that shows preferences panel . It has a method changeColor that takes selected color from colors panel and make changes to user defaults . I have IBOutlet CalendarView *calView as a member in PreferencesWindowController.h class. In changeColor mehod I am writing - calView = [[CalendarView alloc] init]; [calView drawCalendar]; On debugging call goes to drawCalendar method of CalendarView but skips some part of it and goes to end of function without redrawing. On restarting the application color is applied but I want it to happen while application is executing, so that there is no need to rerun the application to view changes.

    Read the article

  • When downloading a file using FileStream, why does page error message refers to aspx page name, not

    - by StuperUser
    After building a filepath (path, below) in a string (I am aware of Path in System.IO, but am using someone else's code and do not have the opportunity to refactor it to use Path). I am using a FileStream to deliver the file to the user (see below): FileStream myStream = new FileStream(path, FileMode.Open, FileAccess.Read); long fileSize = myStream.Length; byte[] Buffer = new byte[(int)fileSize + 1]; myStream.Read(Buffer, 0, (int)myStream.Length); myStream.Close(); Response.ContentType = "application/csv"; Response.AddHeader("content-disposition", "attachment; filename=" + filename); Response.BinaryWrite(Buffer); Response.Flush(); Response.End(); I have seen from: http://stackoverflow.com/questions/736301/asp-net-how-to-stream-file-to-user reasons to avoid use of Response.End() and Response.Close(). I have also seen several articles about different ways to transmit files and have diagnosed and found a solution to the problem (https and http headers) with a colleague. However, the error message that was being displayed was not about access to the file at path, but the aspx file. Edit: Error message is: Internet Explorer cannot download MyPage.aspx from server.domain.tld Internet Explorer was not able to open this Internet site. The requested site is either unavailable or cannot be found. Please try again later. (page name and address anonymised) Why is this? Is it due to the contents of the file coming from the HTTP response .Flush() method rather than a file being accessed at its address?

    Read the article

  • Tomcat does not pick up the class file - the JSP file is not displayed

    - by blueSky
    I have a Java code which is a controller for a jsp page, called: HomeController.java. Code is as follows: @Controller public class HomeController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/mypage") public String home() { System.out.println("HomeController: Passing through..."); return "home"; } } There is nothing especial in the jsp page: home.jsp. If I go to this url: http://localhost:8080/adcopyqueue/mypage I can view mypage and everything works fine. Also in the tomcat Dos page I can see the comment: HomeController: Passing through... As expected. Now under the same directory that I have HomeController.java, I've created another file called: LoginController.java. Following is the code: @Controller public class LoginController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/loginpage") public String login() { System.out.println("LoginController: Passing through..."); return "login"; } } And under the same place which I have home.jsp, I've created login.jsp. Also under tomcat folders, LoginController.class exists under the same folder that HomeController.class exists and login.jsp exists under the same folder which home.jsp exists. But when I go to this url: http://localhost:8080/adcopyqueue/loginpage Nothing is displayed! I think tomcat does not pick up LoginController.class b/c on the tomcat Dos window, I do NOT see this comment: LoginController: Passing through... Instead I see following which I do not know what do they mean? [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:34) got manifest [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:36) manifest entrie s 8 The structure and the code for HomeController.java and LoginController.java plus the jsp files match. I have no idea why tomcat sees one of the files and not the other? Clean build did not help. Does anybody have any idea? Any help is greatly appraciated.

    Read the article

  • How to create a progress bar while downloading a file using the windows API?

    - by Jorge Chayan
    i'm working on an application in MS Visual C++ using Windows API that must download a file and place it in a folder. I have already implemented the download using URLDownloadToFile function, but i want to create a PROGRESS_CLASS progress bar with marquee style while the file is being downloaded, but it doesn't seems to get animated in the process. This is the function I use for downloading: BOOL SOXDownload() { HRESULT hRez = URLDownloadToFile(NULL, "url","C:\\sox.zip", 0, NULL); if (hRez == E_OUTOFMEMORY ) { MessageBox(hWnd, "Out of memory Error","", MB_OK); return FALSE; } if (hRez != S_OK) { MessageBox(hWnd, "Error downloading sox.", "Error!", MB_ICONERROR | MB_SYSTEMMODAL); return FALSE; } if (hRez == S_OK) { BSTR file = SysAllocString(L"C:\\sox.zip"); BSTR folder = SysAllocString(L"C:\\"); Unzip2Folder(file, folder); ::MessageBoxA(hWnd, "Sox Binaries downloaded succesfully", "Success", MB_OK); } return TRUE; } Later I call inside WM_CREATE (in my main window's message processor): if (!fileExists("C:\\SOX\\SOX.exe")) { components[7] = CreateWindowEx(0, PROGRESS_CLASS, NULL, WS_VISIBLE | PBS_MARQUEE, GetSystemMetrics(SM_CXSCREEN) / 2 - 80, GetSystemMetrics(SM_CYSCREEN) / 2 + 25, 200, 50, hWnd, NULL, NULL, NULL); SetWindowText(components[7], "Downloading SoX"); SendMessage(components[7], PBM_SETRANGE, 0, (LPARAM) MAKELPARAM(0, 50)); SendMessage(components[7], PBM_SETMARQUEE, TRUE, MAKELPARAM( 0, 50)); SOXDownload(); SendMessage(components[7], WM_CLOSE, NULL, NULL); } And as I want, I get a tiny progress bar... But it's not animated, and when I place the cursor over the bar, the cursor indicates that the program is busy downloading the file. When the download is complete, the window closes as i requested: SendMessage(components[7], WM_CLOSE, NULL, NULL); So the question is how can I make the bar move while downloading the file? Considering that i want it done with marquee style for simplicity. Thanks in advance.

    Read the article

  • Emacs: Often switching between Emacs and my IDE's editor, how can I 'synch' the file?

    - by WizardOfOdds
    I very often need to do some Emacs magic on some files and I need to go back and forth my IDE (IntelliJ IDEA) and Emacs. When a change is made under Emacs (and after I've saved the file) and I go back to IntelliJ the change appears immediately (if I recall correctly I configured IntelliJ to "always reload file when a modification is detected on disk" or something like that). I don't even need to reload: as soon as IntelliJ IDEA gains focus, it instantly reloads the file (and I hence have immediately access to the modifications I made from Emacs). So far, so very good. However "the other way round", it doesn't work yet. Can I configure Emacs so that everytime a file is changed on disk it reloads it? Or make Emacs, everytime it "gains focus", verify if any file currently opened has been modified on disk? I know I can start modifying the buffer under Emacs and it shall instantly warn that it has been modified, but I'd rather have it do it immediately (for example if I used my IDE to do some big change, when I come back to Emacs what I see may not be at all anymore what the file contains and it's a bit weird).

    Read the article

  • Downloading Large JSON File to local file using Java

    - by user1279675
    I'm attempting to download a JSON from the following URL - http://api.crunchbase.com/v/1/companies.js - to a local file. I'm using Java 1.7 and the following JSON Libraries - http://www.json.org/java/ - to attempt to make it work. Here's my code: public static void download(String address, String localFileName) { OutputStream out = null; URLConnection conn = null; InputStream in = null; try { URL url = new URL(address); out = new BufferedOutputStream( new FileOutputStream(localFileName)); conn = url.openConnection(); in = conn.getInputStream(); byte[] buffer = new byte[1024]; int numRead; long numWritten = 0; while ((numRead = in.read(buffer)) != -1) { out.write(buffer, 0, numRead); numWritten += numRead; System.out.println(buffer.length); System.out.println(" " + buffer.hashCode()); } System.out.println(localFileName + "\t" + numWritten); } catch (Exception exception) { exception.printStackTrace(); } finally { try { if (in != null) { in.close(); } if (out != null) { out.close(); } } catch (IOException ioe) { } } } When I run the code everything seems to work until midway through the loop the program seems to stop and not continue reading the JSON Object. Does anyone know why this would stop reading? How could I fix the issue?

    Read the article

  • Set umask, set permissions, and set ACL, but SAMBA isn't using those?

    - by Kris Anderson
    I'm running on Ubuntu Server 12.04. I have a folder called Music and I want the default folder permissions to be 775 and the default file to then be 664. I set the default permissions on the Music folder to be 775. I configured ACL to use these default permissions as well: file: Music owner: kris group: kris flags: ss- user::rwx group::rwx other::r-x default:user::rwx default:group::rwx default:other::r-x I also changed the default umask for my user account, kris, to 002 in .profile. Shouldn't and new file/folder now use those permissions when writing to the Samba share? ACL should work with Samba from what I can gather. Currently, if I write to that folder using my mac, folders are getting 755 and files 644. I have another app on my mac called GoodSync which which is able to sync a local directory on my mac to a network samba share, but those permissions are even worse. files are being written as 700 using that program. So it looks like Samba is allowing the host/program to determine the folder/file permissions. What changes do I need to make to force the permissions I want regardless of what the host tries to write on the server?

    Read the article

  • Drag2Up Brings Multi-Source Drag and Drop Uploading to Firefox

    - by ETC
    Last fall we shared Drag2Up with you, a handy little Chrome extension that make it a snap to drag, drop, and upload files to a variety of file sharing sites. Now that same easy sharing is available for Firefox. Just like the Chrome version the Firefox version adds in super simple drag and drop file sharing to your web browsing experience. Drag images, text, and other file types onto any text box and Drag2Up uploads them to the file sharing service you’ve specified in the settings menu such as Imgur, Imageshack, Pastebin, Hotfile, Droplr, and more. Hit up the link below to read more and grab a copy for your Firefox install. Drag2Up [Mozilla Add-ons] Latest Features How-To Geek ETC How To Make Hundreds of Complex Photo Edits in Seconds With Photoshop Actions How to Enable User-Specific Wireless Networks in Windows 7 How to Use Google Chrome as Your Default PDF Reader (the Easy Way) How To Remove People and Objects From Photographs In Photoshop Ask How-To Geek: How Can I Monitor My Bandwidth Usage? Internet Explorer 9 RC Now Available: Here’s the Most Interesting New Stuff Never Call Me at Work [Humorous Star Wars Video] Add an Image Properties Listing to the Context Menu in Chrome and Iron Add an Easy to View Notification Badge to Tabs in Firefox SpellBook Parks Bookmarklets in Chrome’s Context Menu Drag2Up Brings Multi-Source Drag and Drop Uploading to Firefox Enchanted Swing in the Forest Wallpaper

    Read the article

  • Unleash AutoVue on Your Unmanaged Data

    - by [email protected]
    Over the years, I've spoken to hundreds of customers who use AutoVue to collaborate on their "managed" data stored in content management systems, product lifecycle management systems, etc. via our many integrations. Through these conversations I've also learned a harsh reality - we will never fully move away from unmanaged data (desktops, file servers, emails, etc). If you use AutoVue today you already know that even if your primary use is viewing content stored in a content management system, you can still open files stored locally on your computer. But did you know that AutoVue actually has - built-in - a great solution for viewing, printing and redlining your data stored on file servers? Using the 'Server protocol' you can point AutoVue directly to a top-level location on any networked file server and provide your users with a link or shortcut to access an interface similar to the sample page shown below. Many customers link to pages just like this one from their internal company intranets. Through this webpage, users can easily search and browse through file server data with a 'click-and-view' interface to find the specific image, document, drawing or model they're looking for. Any markups created on a document will be accessible to everyone else viewing that document and of course real-time collaboration is supported as well. Customers on maintenance can consult the AutoVue Admin guide or My Oracle Support Doc ID 753018.1 for an introduction to the server protocol. Contact your local AutoVue Solutions Consultant for help setting up the sample shown above.

    Read the article

  • Setting different default applications for different Desktop Environment

    - by Anwar
    I am using Ubuntu 12.04 with default Unity interface. I installed later the KDE desktop, XFCE, LXDE, gnome-shell and Cinnamon. The KDE comes with different default applications than Unity, such as kwrite for text editing, konsole as virtual terminal, kfontview for font viewing and installing, dolphin as File browser etc. Other DE come with some other default applications. The problem arises when you want to open a file such as a text file, with which can both be opened by gedit and kwrite, I want to use kwrite on KDE and gedit on Unity or Gnome. But, there is no way to set like this. I can set default application for text file by changing respective settings in both KDE and Unity, but It become default for both DE. For example, If I set kfontviewer as default font viewing application in KDE, it also opens fonts when I am in Unity or Gnome and vice versa. This is a problem because, loading other DE's program takes long time than the default one for the used DE. My question is: Can I use different default applications for different DE? How?

    Read the article

  • Web browser downloads only open target folders - cannot open files

    - by Pavlos G.
    After installing xubuntu packages in order to check xfce, I reverted back to gnome2. During the first login, I noticed that thunar was now selected as the default file manager. Preferred applications menu is also missing now, so I could not set nautilus as the default. I removed all the xubuntu packages (including thunar) and then when I tried to open a folder, I was asked to select the default file manager - that's how I got nautilus back. The next problem I'm now facing has to do with the downloaded files from web browsers: Open and Open containing folder options produce exactly the same result. If I double-click on a file, it'll just open the containing folder, instead of opening the file with it's associated application (e.g. libreoffice writer for .doc,.odt, smplayer for .avi,.wmv, etc). The problem happens both in Firefox and Chrome. Through nautilus, all files open correctly. Up until now I've tried the following: Delete/recreate mimeTypes.rdf in my FF profile Create a new profile in FF Delete/recreate ~/.local/share/applications/mimeapps.list Already checked this similar article None of them worked. Any ideas on the issue would be appreciated.

    Read the article

  • Any good reason open files in text mode?

    - by Tinctorius
    (Almost-)POSIX-compliant operating systems and Windows are known to distinguish between 'binary mode' and 'text mode' file I/O. While the former mode doesn't transform any data between the actual file or stream and the application, the latter 'translates' the contents to some standard format in a platform-specific manner: line endings are transparently translated to '\n' in C, and some platforms (CP/M, DOS and Windows) cut off a file when a byte with value 0x1A is found. These transformations seem a little useless to me. People share files between computers with different operating systems. Text mode would cause some data to be handled differently across some platforms, so when this matters, one would probably use binary mode instead. As an example: while Windows uses the sequence CR LF to end a line in text mode, UNIX text mode will not treat CR as part of the line ending sequence. Applications would have to filter that noise themselves. Older Mac versions only use CR in text mode as line endings, so neither UNIX nor Windows would understand its files. If this matters, a portable application would probably implement the parsing by itself instead of using text mode. Implementing newline interpretation in the parser might also remove some overhead of using text mode, as buffers would need to be rewritten (and possibly resized) before returning to the application, while this may be less efficient than when it would happen in the application instead. So, my question is: is there any good reason to still rely on the host OS to translate line endings and file truncation?

    Read the article

  • Packing up files on my machine, sending it to a server, and unpacking it

    - by MxyL
    I am implementing a feature in my application that sends all files in a specified folder to a server. I have the basic FTP transaction set up using Apache Commons FTPClient: it sets up a connection and transfers a file from one place to another. So I can simply loop over the directory and use this connection to transfer all the files. However, this could be better. Rather than transferring each file one by one, it makes more sense to pack it up in a compressed archive and then send the whole file at once. Saves time and bandwidth, since these are just text files so they compress nicely. So I would like to add automatic archive packing and unpacking. This is the workflow I have planned out, using zip compression: Zip all files in the folder Send the file over Unzip the files at its destination 1 and 2 are easy since the files are on the local machine, but I'm not sure how to accomplish the last step, when the files are now on a remote server. What are my options? I have control over what I can put and run on the server. Perhaps it is not necessary to do the packing/unpacking myself?

    Read the article

  • Any good reason to open files in text mode?

    - by Tinctorius
    (Almost-)POSIX-compliant operating systems and Windows are known to distinguish between 'binary mode' and 'text mode' file I/O. While the former mode doesn't transform any data between the actual file or stream and the application, the latter 'translates' the contents to some standard format in a platform-specific manner: line endings are transparently translated to '\n' in C, and some platforms (CP/M, DOS and Windows) cut off a file when a byte with value 0x1A is found. These transformations seem a little useless to me. People share files between computers with different operating systems. Text mode would cause some data to be handled differently across some platforms, so when this matters, one would probably use binary mode instead. As an example: while Windows uses the sequence CR LF to end a line in text mode, UNIX text mode will not treat CR as part of the line ending sequence. Applications would have to filter that noise themselves. Older Mac versions only use CR in text mode as line endings, so neither UNIX nor Windows would understand its files. If this matters, a portable application would probably implement the parsing by itself instead of using text mode. Implementing newline interpretation in the parser might also remove some overhead of using text mode, as buffers would need to be rewritten (and possibly resized) before returning to the application, while this may be less efficient than when it would happen in the application instead. So, my question is: is there any good reason to still rely on the host OS to translate line endings and file truncation?

    Read the article

  • Unable to rename file with c# ftp methods when current user directory is different from root

    - by Agata
    Hello everyone, Remark: due to spam prevention mechanizm I was forced to replace the beginning of the Uris from ftp:// to ftp. I've got following problem. I have to upload file with C# ftp method and afterwards rename it. Easy, right? :) Ok, let's say my ftp host is like this: ftp.contoso.com and after logging in, current directory is set to: users/name So, what I'm trying to achieve is to log in, upload file to current directory as file.ext.tmp and after upload is successful, rename the file to file.ext The whole difficulty is, as I guess, to properly set the request Uri for FtpWebRequest. MSDN states: The URI may be relative or absolute. If the URI is of the form "ftp://contoso.com/%2fpath" (%2f is an escaped '/'), then the URI is absolute, and the current directory is /path. If, however, the URI is of the form "ftp://contoso.com/path", first the .NET Framework logs into the FTP server (using the user name and password set by the Credentials property), then the current directory is set to UserLoginDirectory/path. Ok, so I upload file with the following URI: ftp.contoso.com/file.ext.tmp Great, the file lands where I wanted it to be: in directory "users/name" Now, I want to rename the file, so I create web request with following Uri: ftp.contoso.com/file.ext.tmp and specify rename to parameter as: file.ext and this gives me 550 error: file not found, no permissions, etc. I traced this in Microsoft Network Monitor and it gave me: Command: RNFR, Rename from CommandParameter: /file.ext.tmp Ftp: Response to Port 53724, '550 File /file.ext.tmp not found' as if it was looking for the file in the root directory - not in the current directory. I renamed the file manually using Total Commander and the only difference was that CommandParameter was without the first slash: CommandParameter: file.ext.tmp I'm able to successfully rename the file by supplying following absolute URI: ftp.contoso.com/%2fusers/%2fname/file.ext.tmp but I don't like this approach, since I would have to know the name of current user's directory. It can probably be done by using WebRequestMethods.Ftp.PrintWorkingDirectory, but it adds extra complexity (calling this method to retrieve directory name, then combining the paths to form proper URI). What I don't understand is why the URI ftp.contoso.com/file.ext.tmp is good for upload and not for rename? Am I missing something here? The project is set to .NET 4.0, coded in Visual Studio 2010.

    Read the article

  • Does writing data to server using Java URL class require response from server?

    - by gigadot
    I am trying to upload files using Java URL class and I have found a previous question on stack-overflow which explains very well about the details, so I try to follow it. And below is my code adopted from the sniplet given in the answer. My problem is that if I don't make a call to one of connection.getResponseCode() or connection.getInputStream() or connection.getResponseMessage() or anything which is related to reponse from the server, the request will never be sent to server. Why do I need to do this? Or is there any way to write the data without getting the response? P.S. I have developed a server-side uploading servlet which accepts multipart/form-data and save it to files using FileUpload. It is stable and definitely working without any problem so this is not where my problem is generated. import java.io.Closeable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.io.PrintWriter; import java.net.HttpURLConnection; import java.net.URL; import org.apache.commons.io.IOUtils; public class URLUploader { public static void closeQuietly(Closeable... objs) { for (Closeable closeable : objs) { IOUtils.closeQuietly(closeable); } } public static void main(String[] args) throws IOException { File textFile = new File("D:\\file.zip"); String boundary = Long.toHexString(System.currentTimeMillis()); // Just generate some unique random value. HttpURLConnection connection = (HttpURLConnection) new URL("http://localhost:8080/upslet/upload").openConnection(); connection.setDoOutput(true); connection.setRequestProperty("Content-Type", "multipart/form-data; boundary=" + boundary); OutputStream output = output = connection.getOutputStream(); PrintWriter writer = writer = new PrintWriter(output, true); // Send text file. writer.println("--" + boundary); writer.println("Content-Disposition: form-data; name=\"file1\"; filename=\"" + textFile.getName() + "\""); writer.println("Content-Type: application/octet-stream"); FileInputStream fin = new FileInputStream(textFile); writer.println(); IOUtils.copy(fin, output); writer.println(); // End of multipart/form-data. writer.println("--" + boundary + "--"); output.flush(); closeQuietly(fin, writer, output); // Above request will never be sent if .getInputStream() or .getResponseCode() or .getResponseMessage() does not get called. connection.getResponseCode(); } }

    Read the article

  • How to count differences between two files on linux?

    - by Zsolt Botykai
    Hi all, I need to work with large files and must find differences between two. And I don't need the different bits, but the number of differences. For the differ rows I come up with diff --suppress-common-lines --speed-large-files -y File1 File2 | wc -l And it works, but is there a better way to do it? And how to count the exact number of differences (with standard tools like bash, diff, awk, sed some old version of perl)? Thanks in advance

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • WiX 3 Tutorial: Generating file/directory fragments with Heat.exe

    - by Mladen Prajdic
    In previous posts I’ve shown you our SuperForm test application solution structure and how the main wxs and wxi include file look like. In this post I’ll show you how to automate inclusion of files to install into your build process. For our SuperForm application we have a single exe to install. But in the real world we have 10s or 100s of different files from dll’s to resource files like pictures. It all depends on what kind of application you’re building. Writing a directory structure for so many files by hand is out of the question. What we need is an automated way to create this structure. Enter Heat.exe. Heat is a command line utility to harvest a file, directory, Visual Studio project, IIS website or performance counters. You might ask what harvesting means? Harvesting is converting a source (file, directory, …) into a component structure saved in a WiX fragment (a wxs) file. There are 2 options you can use: Create a static wxs fragment with Heat and include it in your project. The pro of this is that you can add or remove components by hand. The con is that you have to do the pro part by hand. Automation always beats manual labor. Run heat command line utility in a pre-build event of your WiX project. I prefer this way. By always recreating the whole fragment you don’t have to worry about missing any new files you add. The con of this is that you’ll include files that you otherwise might not want to. There is no perfect solution so pick one and deal with it. I prefer using the second way. A neat way of overcoming the con of the second option is to have a post-build event on your main application project (SuperForm.MainApp in our case) to copy the files needed to be installed in a special location and have the Heat.exe read them from there. I haven’t set this up for this tutorial and I’m simply including all files from the default SuperForm.MainApp \bin directory. Remember how we created a System Environment variable called SuperFormFilesDir? This is where we’ll use it for the first time. The command line text that you have to put into the pre-build event of your WiX project looks like this: "$(WIX)bin\heat.exe" dir "$(SuperFormFilesDir)" -cg SuperFormFiles -gg -scom -sreg -sfrag -srd -dr INSTALLLOCATION -var env.SuperFormFilesDir -out "$(ProjectDir)Fragments\FilesFragment.wxs" After you install WiX you’ll get the WIX environment variable. In the pre/post-build events environment variables are referenced like this: $(WIX). By using this you don’t have to think about the installation path of the WiX. Remember: for 32 bit applications Program files folder is named differently between 32 and 64 bit systems. $(ProjectDir) is obviously the path to your project and is a Visual Studio built in variable. You can view all Heat.exe options by running it without parameters but I’ll explain some that stick out the most. dir "$(SuperFormFilesDir)": tell Heat to harvest the whole directory at the set location. That is the location we’ve set in our System Environment variable. –cg SuperFormFiles: the name of the Component group that will be created. This name is included in out Feature tag as is seen in the previous post. -dr INSTALLLOCATION: the directory reference this fragment will fall under. You can see the top level directory structure in the previous post. -var env.SuperFormFilesDir: the name of the variable that will replace the SourceDir text that would otherwise appear in the fragment file. -out "$(ProjectDir)Fragments\FilesFragment.wxs": the full path and name under which the fragment file will be saved. If you have source control you have to include the FilesFragment.wxs into your project but remove its source control binding. The auto generated FilesFragment.wxs for our test app looks like this: <?xml version="1.0" encoding="utf-8"?><Wix xmlns="http://schemas.microsoft.com/wix/2006/wi"> <Fragment> <ComponentGroup Id="SuperFormFiles"> <ComponentRef Id="cmp5BB40DB822CAA7C5295227894A07502E" /> <ComponentRef Id="cmpCFD331F5E0E471FC42A1334A1098E144" /> <ComponentRef Id="cmp4614DD03D8974B7C1FC39E7B82F19574" /> <ComponentRef Id="cmpDF166522884E2454382277128BD866EC" /> </ComponentGroup> </Fragment> <Fragment> <DirectoryRef Id="INSTALLLOCATION"> <Component Id="cmp5BB40DB822CAA7C5295227894A07502E" Guid="{117E3352-2F0C-4E19-AD96-03D354751B8D}"> <File Id="filDCA561ABF8964292B6BC0D0726E8EFAD" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.exe" /> </Component> <Component Id="cmpCFD331F5E0E471FC42A1334A1098E144" Guid="{369A2347-97DD-45CA-A4D1-62BB706EA329}"> <File Id="filA9BE65B2AB60F3CE41105364EDE33D27" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.pdb" /> </Component> <Component Id="cmp4614DD03D8974B7C1FC39E7B82F19574" Guid="{3443EBE2-168F-4380-BC41-26D71A0DB1C7}"> <File Id="fil5102E75B91F3DAFA6F70DA57F4C126ED" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.vshost.exe" /> </Component> <Component Id="cmpDF166522884E2454382277128BD866EC" Guid="{0C0F3D18-56EB-41FE-B0BD-FD2C131572DB}"> <File Id="filF7CA5083B4997E1DEC435554423E675C" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.vshost.exe.manifest" /> </Component> </DirectoryRef> </Fragment></Wix> The $(env.SuperFormFilesDir) will be replaced at build time with the directory where the files to be installed are located. There is nothing too complicated about this. In the end it turns out that this sort of automation is great! There are a few other ways that Heat.exe can compose the wxs file but this is the one I prefer. It just seems the clearest. Play with its options to see what can it do. It’s one awesome little tool.   WiX 3 tutorial by Mladen Prajdic navigation WiX 3 Tutorial: Solution/Project structure and Dev resources WiX 3 Tutorial: Understanding main wxs and wxi file WiX 3 Tutorial: Generating file/directory fragments with Heat.exe

    Read the article

  • Send large JSON data to WCF Rest Service

    - by Christo Fur
    Hi I have a client web page that is sending a large json object to a proxy service on the same domain as the web page. The proxy (an ashx handler) then forwards the request to a WCF Rest Service. Using a WebClient object (standard .net object for making a http request) The JSON successfully arrives at the proxy via a jQuery POST on the client webpage. However, when the proxy forwards this to the WCF service I get a Bad Request - Error 400 This doesn't happen when the size of the json data is small The WCF service contract looks like this [WebInvoke(Method = "POST", BodyStyle = WebMessageBodyStyle.Wrapped, RequestFormat = WebMessageFormat.Json, ResponseFormat = WebMessageFormat.Json)] [OperationContract] CarConfiguration CreateConfiguration(CarConfiguration configuration); And the DataContract like this [DataContract(Namespace = "")] public class CarConfiguration { [DataMember(Order = 1)] public int CarConfigurationId { get; set; } [DataMember(Order = 2)] public int UserId { get; set; } [DataMember(Order = 3)] public string Model { get; set; } [DataMember(Order = 4)] public string Colour { get; set; } [DataMember(Order = 5)] public string Trim { get; set; } [DataMember(Order = 6)] public string ThumbnailByteData { get; set; } [DataMember(Order = 6)] public string Wheel { get; set; } [DataMember(Order = 7)] public DateTime Date { get; set; } [DataMember(Order = 8)] public List<string> Accessories { get; set; } [DataMember(Order = 9)] public string Vehicle { get; set; } [DataMember(Order = 10)] public Decimal Price { get; set; } } When the ThumbnailByteData field is small, all is OK. When it is large I get the 400 error What are my options here? I've tried increasing the MaxBytesRecived config setting but that is not enough Any ideas?

    Read the article

  • Text mining on large database (data mining)

    - by yox
    Hello, I have a large database of resumes (CV), and a certain table skills grouping all users skills. inside that table there's a field skill_text that describes the skill in full text. I'm looking for an algorithm/software/method to extract significant terms/phrases from that table in order to build a new table with standarized skills.. Here are some examples skills extracted from the DB : Sectoral and competitive analysis Business Development (incl. in international settings) Specific structure and road design software - Microstation, Macao, AutoCAD (basic knowledge) Creative work (Photoshop, In-Design, Illustrator) checking and reporting back on campaign progress organising and attending events and exhibitions Development : Aptana Studio, PHP, HTML, CSS, JavaScript, SQL, AJAX Discipline: One to one marketing, E-marketing (SEO & SEA, display, emailing, affiliate program) Mix marketing, Viral Marketing, Social network marketing. The output shoud be something like : Sectoral and competitive analysis Business Development Specific structure and road design software - Macao AutoCAD Photoshop In-Design Illustrator organising events Development Aptana Studio PHP HTML CSS JavaScript SQL AJAX Mix marketing Viral Marketing Social network marketing emailing SEO One to one marketing As you see only skills remains no other representation text. I know this is possible using text mining technics but how to do it ? the database is realy large.. it's a good thing because we can calculate text frequency and decide if it's a real skill or just meaningless text... The big problem is .. how to determin that "blablabla" is a skill ? thanks

    Read the article

< Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >