Search Results

Search found 29956 results on 1199 pages for 'query builder methods'.

Page 134/1199 | < Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >

  • How to use kyewordsearch query in c#

    - by Lalit
    How to use kyewordsearch query in c# to implement the Search object. What settings need through Central administration to enable kyewordsearch query ? Also please send me Syntax for KeywordQuery.QueryText. means how to write query ?

    Read the article

  • LINQ count query returns a 1 instead of a 0

    - by user335810
    I have the following view:- CREATE VIEW tbl_adjudicator_result_view AS SELECT a.adjudicator_id, sar.section_adjudicator_role_id, s.section_id, sdr.section_dance_role_id, d.dance_id, c.contact_id, ro.round_id, r.result_id, c.title, c.first_name, c.last_name, d.name, r.value, ro.type FROM tbl_adjudicator a INNER JOIN tbl_section_adjudicator_role sar on sar.section_adjudicator_role2adjudicator = a.adjudicator_id INNER JOIN tbl_section s on sar.section_adjudicator_role2section = s.section_id INNER JOIN tbl_section_dance_role sdr on sdr.section_dance_role2section = s.section_id INNER JOIN tbl_dance d on sdr.section_dance_role2dance = d.dance_id INNER JOIN tbl_contact c on a.adjudicator2contact = c.contact_id INNER JOIN tbl_round ro on ro.round2section = s.section_id LEFT OUTER JOIN tbl_result r on r.result2adjudicator = a.adjudicator_id AND r.result2dance = d.dance_id When I run the following query directly against the db I get 0 in the count column where there is no result select adjudicator_id, first_name, COUNT(result_id) from tbl_adjudicator_result_view arv where arv.round_id = 16 group by adjudicator_id, first_name However when I use LINQ query I always get 1 in the Count Column var query = from arv in db.AdjudicatorResultViews where arv.round_id == id group arv by new { arv.adjudicator_id, arv.first_name} into grp select new AdjudicatorResultViewGroupedByDance { AdjudicatorId = grp.Key.adjudicator_id, FirstName = grp.Key.first_name, Count = grp.Select(p => p.result_id).Distinct().Count() }; What do I need to change in the View / Linq query.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to unit test private methods in BDD / TDD?

    - by robert_d
    I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

    Read the article

  • Linq query joining with a subquery

    - by Alan Fisher
    I am trying to reproduce a SQL query using a LINQ to Entities query. The following SQL works fine, I just don't see how to do it in LINQ. I have tried for a few hours today but I'm just missing something. SELECT h.ReqID, rs.RoutingSection FROM ReqHeader h JOIN ReqRoutings rr ON rr.ReqRoutingID = (SELECT TOP 1 r1.ReqRoutingID FROM ReqRoutings r1 WHERE r1.ReqID = h.ReqID ORDER BY r1.ReqRoutingID desc) JOIN ReqRoutingSections rs ON rs.RoutingSectionID = rr.RoutingSectionID Edit*** Here is my table scema- Requisitions: ReqID PK string ReqDate datetime etc... ReqRoutings: ID PK int ReqID FK RoutingSection FK int RoutingDate ReqRoutingSections: Id PK int RoutingSection string The idea is that each Requisition can be routed many times, for my query I need the last RoutingSection to be returned along with the Requisition info. Sample data: Requisitions: - 1 record ReqID 123456 ReqDate '12/1/2012' ReqRoutings: -- 3 records id 1 ReqID 123456 RoutingSection 3 RoutingDate '12/2/2012' id 2 ReqID 123456 RoutingSection 2 RoutingDate '12/3/2012' id 3 ReqID 123456 RoutingSection 4 RoutingDate '12/4/2012' ReqRoutingSections: -- 3 records id 2 Supervision id 3 Safety id 4 Qaulity Control The results of the query would be ReqID = '123456' RoutingSection = 'QualityControl' -- Last RoutingSection requisition was routed to

    Read the article

  • Fulltext and composite indexes and how they affect the query

    - by Brett
    Just say I had a query as below.. SELECT name,category,address,city,state FROM table WHERE MATCH(name,subcategory,category,tag1) AGAINST('education') AND city='Oakland' AND state='CA' LIMIT 0, 10; ..and I had a fulltext index as name,subcategory,category,tag1 and a composite index as city,state; is this good enough for this query? Just wondering if something extra is needed when mixing additional AND's when making use of the fulltext index with the MATCH/AGAINST. Edit: What I am trying to understand is, what happens with the additional columns that are within the query but are not indexed in the chosen index (the fulltext index), the above example being city and state. How does MySQL now find the matching rows for these since it can't use two indexes (or can it?) - so, basically, I'm trying to understand how MySQL goes about finding the data optimally for the columns NOT in the chosen fulltext index and if there is anything I can or should do to optimize the query.

    Read the article

  • How to get unique values when using a UNION mysql query

    - by Roland
    I have 2 sql queries that return results, both contain a contract number, now I want to get the unique values of contract numbers HEre's the query (SELECT contractno, dsignoff FROM campaigns WHERE clientid = 20010490 AND contractno != '' GROUP BY contractno,dsignoff) UNION (SELECT id AS contractno,signoffdate AS dsignoff FROM contract_details WHERE clientid = 20010490) So for example, if the first query before the union returns two results with contract no 10, and the sql query after the union also returns 10, then we have 3 rows in total, however because contractno of all three rows is 10, I need to have only one row returned, Is this possible?

    Read the article

  • MySQL Single Query Benchmarking Strategies

    - by Pepper
    Hello, I have a slow mySQL query in my application that I need to re-write. The problem is, it's only slow on my production server and only when it's not cached. The first time I run it, it will take 12 seconds, then anytime after that it'll be 500 milliseconds. Is there an easy way to test this query without it hitting the query cache so I can see the results of my refactoring? Thanks!

    Read the article

  • Very Different Execution Times of SQL Query in C# and SQL Server Management Studio

    - by Paul
    I have a simple SQL query that when run from C# takes over 30 seconds then times-out every time, whereas when run on SQL Server Management Studio successfully completes instantly. In the latter case, a query execution plan reveals nothing troubling, and the execution time is spread nicely through a few simple operations. I've run 'EXEC sp_who2' while the query is running from C#, and it is listed as taking 29,000 milliseconds of CPU time, and is not blocked by anything. I have no idea how to begin solving this. Does anyone have some insight? The query is: SELECT c.lngId, ... FROM tblCase c INNER JOIN tblCaseStatus s ON s.lngId = c.lngId INNER JOIN tblCaseStatusType t ON t.lngId = s.lngId INNER JOIN [Another Database]..tblCompany cm ON cm.lngId = cs.lngCompanyId WHERE t.lngId = 25 AND c.IsDeleted = 0 AND s.lngStatus = 1

    Read the article

  • Update query in google app engine data store (java)

    - by sumeet
    How to use the update query in google app engine while using with gwt. I'm trying to make a chat application where apart from submitting and deleting the previous messages, the administrator can edit out the portions of existing messages. For editing the existing messages update query is needed and I could not find anything like update query in data store. How can we update the existing data?

    Read the article

  • Why I can't use template table in dynamic query SQL SERVER 2005

    - by StuffHappens
    Hello! I have the following t-sql code which generates an error Declare @table TABLE ( ID1 int, ID2 int ) INSERT INTO @table values(1, 1); INSERT INTO @table values(2, 2); INSERT INTO @table values(3, 3); DECLARE @field varchar(50); SET @field = 'ID1' DECLARE @query varchar(MAX); SET @query = 'SELECT * FROM @table WHERE ' + @field + ' = 1' EXEC (@query) The error is Must declare the table variable "@table". What's wrong with the query. How to fix it?

    Read the article

  • Query Becnhmark.

    - by Deepika
    I am using autobech for doing becnhmark. An example of autobench command is as shown below. autobench --single_host --host1 testhost.foo.com --uri1 /index.html --quiet --timeout 5 --low_rate 20 --high_rate 200 --rate_step 20 --num_call 10 --num_conn 5000 --file bench.tsv The uri which I have to specify has a query attached to it. When I run the command which has the query, I get the following result dem_req_rate req_rate_localhost con_rate_localhost min_rep_rate_localhost avg_rep_rate_localhost max_rep_rate_localhost stddev_rep_rate_localhost resp_time_localhost net_io_localhost errors_localhost 200 0 20 0 0 0 0 0 0 101 400 0 40 0 0 0 0 0 0 101 600 0 60 0 0 0 0 0 0 101 800 0 80 0 0 0 0 0 0 101 1000 0 100 0 0 0 0 0 0 101 1200 0 120 0 0 0 0 0 0 101 1400 0 140 0 0 0 0 0 0 101 1600 0 160 0 0 0 0 0 0 101 1800 0 180 0 0 0 0 0 0 101 2000 0 200 0 0 0 0 0 0 101 The query request, response are all zeroes. Can anybody please tell me how to give a query as part of the uri? Thank you in advance

    Read the article

  • SQL Server 2008 - Query takes forever to finish even though work is actually done

    - by Brian
    Running the following simple query in SSMS: UPDATE tblEntityAddress SET strPostCode= REPLACE(strPostCode,' ','') The update to the data (at least in memory) is complete in under a minute. I verified this by performing another query with transaction isolation level read uncommitted. The update query, however, continues to run for another 30 minutes. What is the issue here? Is this caused by a delay to write to disk? TIA

    Read the article

  • Efficiently select top row for each category in the set

    - by VladV
    I need to select a top row for each category from a known set (somewhat similar to this question). The problem is, how to make this query efficient on the large number of rows. For example, let's create a table that stores temperature recording in several places. CREATE TABLE #t ( placeId int, ts datetime, temp int, PRIMARY KEY (ts, placeId) ) -- insert some sample data SET NOCOUNT ON DECLARE @n int, @ts datetime SELECT @n = 1000, @ts = '2000-01-01' WHILE (@n>0) BEGIN INSERT INTO #t VALUES (@n % 10, @ts, @n % 37) IF (@n % 10 = 0) SET @ts = DATEADD(hour, 1, @ts) SET @n = @n - 1 END Now I need to get the latest recording for each of the places 1, 2, 3. This way is efficient, but doesn't scale well (and looks dirty). SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 1 ORDER BY ts DESC ) t1 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 2 ORDER BY ts DESC ) t2 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 3 ORDER BY ts DESC ) t3 The following looks better but works much less efficiently (30% vs 70% according to the optimizer). SELECT placeId, ts, temp FROM ( SELECT placeId, ts, temp, ROW_NUMBER() OVER (PARTITION BY placeId ORDER BY ts DESC) rownum FROM #t WHERE placeId IN (1, 2, 3) ) t WHERE rownum = 1 The problem is, during the latter query execution plan a clustered index scan is performed on #t and 300 rows are retrieved, sorted, numbered, and then filtered, leaving only 3 rows. For the former query three times one row is fetched. Is there a way to perform the query efficiently without lots of unions?

    Read the article

  • Strange LINQ to SQL Behavior

    - by mcass20
    What is wrong with the last query? Is it a bug or am I missing something? This query returns 2 records (correct): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>David</value>%")); This query returns 2 records (correct): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>%David%</value>%")); This query returns 0 records (correct): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>av</value>%")); This query returns 2 records (correct): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>%av%</value>%")); This query returns 0 records (correct): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>v</value>%")); This query returns 15 records (incorrect, should return 2): query = query.Where(Log => SqlMethods.Like(Log.FormattedMessage, "%<key>Name</key><value>%v%</value>%"));

    Read the article

  • Getting counts of 0 from a query with a double group by

    - by Maltiriel
    I'm trying to write a query that gets the counts for a table (call it item) categorized by two different things, call them type and code. What I'm hoping for as output is the following: Type Code Count 1 A 3 1 B 0 1 C 10 2 A 0 2 B 13 2 C 2 And so forth. Both type and code are found in lookup tables, and each item can have just one type but more than one code, so there's also a pivot (aka junction or join) table for the codes. I have a query that can get this result: Type Code Count 1 A 3 1 C 10 2 B 13 2 C 2 and it looks like (with join conditions omitted): SELECT typelookup.name, codelookup.name, COUNT(item.id) FROM typelookup LEFT OUTER JOIN item JOIN itemcodepivot RIGHT OUTER JOIN codelookup GROUP BY typelookup.name, codelookup.name Is there any way to alter this query to get the results I'm looking for? This is in MySQL, if that matters. I'm not actually sure this is possible all in one query, but if it is I'd really like to know how. Thanks for any ideas.

    Read the article

  • Why does "non exists" SQL query work and "not in" doesn't

    - by Josh
    I spent some time trying to figure out why this query isn't pulling the results i expected: SELECT * FROM NGS WHERE ESPSSN NOT IN (SELECT SSN FROM CENSUS) finally i tried writing the query another way and this ended up getting the expected results: SELECT * FROM NGS n WHERE NOT EXISTS (SELECT * FROM CENSUS WHERE SSN = n.ESPSSN) The first query seems more appropriate and "correct". I use "in" and "not in" all the time for similar selects and have never had a problem that i know of.

    Read the article

  • Codeigniter view file looping query

    - by user2505513
    Right, I'm unsure about how to code my view file to generate following query results WITHOUT compromising the principles of mvc. Query in model: SELECT * FROM events GROUP BY country, area ORDER BY country, area View: <?php if (isset($query)):?> <?php foreach ($query as $row):?> <h2><?=$row->country?></h2> <h3><?=$row->area?></h3> <?php endforeach;?> <?php endif;?> I want the results to display: England North South West - utilising the GROUP BY parameter As opposed to: England North England South England West Has anybody any advice as to how to achieve this?

    Read the article

  • Get the first and last posts in a thread

    - by Grampa
    I am trying to code a forum website and I want to display a list of threads. Each thread should be accompanied by info about the first post (the "head" of the thread) as well as the last. My current database structure is the following: threads table: id - int, PK, not NULL, auto-increment name - varchar(255) posts table: id - int, PK, not NULL, auto-increment thread_id - FK for threads The tables have other fields as well, but they are not relevant for the query. I am interested in querying threads and somehow JOINing with posts so that I obtain both the first and last post for each thread in a single query (with no subqueries). So far I am able to do it using multiple queries, and I have defined the first post as being: SELECT * FROM threads t LEFT JOIN posts p ON t.id = p.thread_id ORDER BY p.id LIMIT 0, 1 The last post is pretty much the same except for ORDER BY id DESC. Now, I could select multiple threads with their first or last posts, by doing: SELECT * FROM threads t LEFT JOIN posts p ON t.id = p.thread_id ORDER BY p.id GROUP BY t.id But of course I can't get both at once, since I would need to sort both ASC and DESC at the same time. What is the solution here? Is it even possible to use a single query? Is there any way I could change the structure of my tables to facilitate this? If this is not doable, then what tips could you give me to improve the query performance in this particular situation?

    Read the article

  • mysql query that has array

    - by Xainee Khan
    //get all id's of ur friend that has installed your application $friend_pics=$facebook->api( array( 'method' => 'fql.query', 'query' => "SELECT uid FROM user WHERE uid IN(SELECT uid2 from friend WHERE uid1='$user') AND is_app_user = 1" ) ); // this query work fine //your top10 friends in app $result="SELECT * FROM fb_user WHERE user_id IN($friend_pics) ORDER BY oldscore DESC LIMIT 0,10"; db_execute($result); i want to retrive ten top scorer from my database stored in oldscore but in my second query the array name $friend_pics is not working i guess,plz help me thanks

    Read the article

  • GQL Query with __key__ in List of KEYs

    - by bossylobster
    In the GQL reference [1], it is encouraged to use the IN keyword with a list of values, and to construct a Key from hand the GQL query SELECT * FROM MyModel WHERE __key__ = KEY('MyModel', 'my_model_key') will succeed. However, using the code you would expect to work: SELECT * FROM MyModel WHERE __key__ IN (KEY('MyModel', 'my_model_key1'), KEY('MyModel', 'my_model_key2')) in the Datastore Viewer, there is a complaint of "Invalid GQL query string." What is the correct way to format such a query? [1] http://code.google.com/appengine/docs/python/datastore/gqlreference.html PS I know there are more efficient ways to do this in Python (without constructing a GQL query) and using the remote_api, but each call to the remote_api counts against quota. In an environment where quota is not (necessarily) free, quick and dirty queries are very helpful.

    Read the article

  • MySQL: Limit rows linked to each joined row

    - by SolidSnakeGTI
    Hello, Specifications: MySQL 4.1+ I've certain situation that requires certain result set from MySQL query, let's see the current query first & then ask my question: SELECT thread.dateline AS tdateline, post.dateline AS pdateline, MIN(post.dateline) FROM thread AS thread LEFT JOIN post AS post ON(thread.threadid = post.threadid) LEFT JOIN forum AS forum ON(thread.forumid = forum.forumid) WHERE post.postid != thread.firstpostid AND thread.open = 1 AND thread.visible = 1 AND thread.replycount >= 1 AND post.visible = 1 AND (forum.options & 1) AND (forum.options & 2) AND (forum.options & 4) AND forum.forumid IN(1,2,3) GROUP BY post.threadid ORDER BY tdateline DESC, pdateline ASC As you can see, mainly I need to select dateline of threads from 'thread' table, in addition to dateline of the second post of each thread, that's all under the conditions you see in the WHERE CLAUSE. Since each thread has many posts, and I need only one result per thread, I've used GROUP BY CLAUSE for that purpose. This query will return only one post's dateline with it's related unique thread. My questions are: How to limit returned threads per each forum!? Suppose I need only 5 threads -as a maximum- to be returned for each forum declared in the WHERE CLAUSE 'forum.forumid IN(1,2,3)', how can this be achieved. Is there any recommendations for optimizing this query (of course after solving the first point)? Notes: I prefer not to use sub-queries, but if it's the only solution available I'll accept it. Double queries not recommended. I'm sure there's a smart solution for this situation. Appreciated advice in advance :)

    Read the article

  • need help to construct query

    - by Learner
    i have the following result and i would like to construct the select query from the following result in java, Please help me how to go about , tablename columnname size order employee name 25 1 employee sex 25 2 employee contactNumber 50 3 employee salary 25 4 address street 25 5 address country 25 6 from this i would like to construct query like select T1.name, T1.sex,T1.contactNumber, T1.salaryT2.street, T2.contry from tablename1[employee] T1, tablename2[address] T2 how to construt the above query in java, here table name can be N also the columname can be also N. Please help me to achieve the above. Thanks and Regards

    Read the article

< Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >