Search Results

Search found 13815 results on 553 pages for 'gae python'.

Page 139/553 | < Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >

• Opening SSL URLs with Python

  - by RadiantHex

  Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

  Read the article

• a general tree implementation in python

  - by vishnu

  i want to build a general tree in which a root node contains 'n' childrens and those childrens may contain other childrens.....

  Read the article

• Python: Class factory using user input as class names

  - by Sano98

  Hi everyone, I want to add class atttributes to a superclass dynamically. Furthermore, I want to create classes that inherit from this superclass dynamically, and the name of those subclasses should depend on user input. There is a superclass "Unit", to which I can add attributes at runtime. This already works. def add_attr (cls, name, value): setattr(cls, name, value) class Unit(object): pass class Archer(Unit): pass myArcher = Archer() add_attr(Unit, 'strength', 5) print "Strenght ofmyarcher: " + str(myArcher.strength) Archer.strength = 2 print "Strenght ofmyarcher: " + str(myArcher.strength) This leads to the desired output: Strenght ofmyarcher: 5 Strenght ofmyarcher: 2 But now I don't want to predefine the subclass Archer, but I'd rather let the user decide how to call this subclass. I've tried something like this: class Meta(type, subclassname): def __new__(cls, subclassname, bases, dct): return type.__new__(cls, subclassname, Unit, dct) factory = Meta() factory.__new__("Soldier") but no luck. I guess I haven't really understood what new does here. What I want as a result here is class Soldier(Unit): pass being created by the factory. And if I call the factory with the argument "Knight", I'd like a class Knight, subclass of Unit, to be created. Any ideas? Many thanks in advance! Bye -Sano

  Read the article

• Python: Split by 1 or more occurrences of a delimiter

  - by Adam Matan

  Hi, I have a formatted string from a log file, which looks like: >>> a="test result" That is, the test and the result are split by some spaces - it was probably created using formatted string which gave test some constant spacing. Simple splitting won't do the trick: >>> a.split(" ") ['test', '', '', '', ... '', '', '', '', '', '', '', '', '', '', '', 'result'] split(DELIMITER, COUNT) cleared some unnecessary values: >>> a.split(" ",1) ['test', ' result'] This helped - but of course, I really need: ['test', 'result'] I can use split() followed by map + strip(), but I wondered if there is a more Pythonic way to do it. Thanks, Adam

  Read the article

• How to Extract data asocaited with attribute of XML file using python 3.2

  - by user1460383

  I have this xml format..... <event timestamp="0.447463" bustype="LIN" channel="LIN 1"> <col name="Time"/> <col name="Start of Frame">0.440708</col> <col name="Channel">LIN 1</col> <col name="Dir">Tx</col> <col name="Event Type">LIN Frame (Diagnostic Request)</col> <col name="Frame Name">MasterReq_DB</col> <col name="Id">3C</col> <col name="Data">81 06 04 04 FF FF 50 4C</col> <col name="Publisher">TestMaster (simulated)</col> <col name="Checksum">D3 &quot;Classic&quot;</col> <col name="Header Duration">2.090 ms (40.1 bits)</col> <col name="Resp. Duration">4.688 ms (90.0 bits)</col> <col name="Time difference">0.049987</col> <empty/> </event> In above xml, i need to extract data associated with attribute 'name' Am able to get all names but am unable to fetch MasterReq_DB< field Please help me ... Thanks in advance

  Read the article

• read a binary file (python)

  - by beratch

  Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

  Read the article

• Errno socket error in python

  - by Emma

  i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

  Read the article

• python parsing file json

  - by michele

  File json: {"maps":[{"id":"blabla","iscategorical":"0"},{"id":"blabla","iscategorical":"0"}], "masks":["id":"valore"], "om_points":"value", "parameters":["id":"valore"] } I write this script but it only print all the text. json_data=open(file_directory).read() data = json.loads(json_data) pprint(data) How can I parse the file and extract single values? Thanks in advance.

  Read the article

• Python metaclass for enforcing immutability of custom types

  - by Mark Lehmacher

  Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Python dealing with dates and times

  - by randombits

  I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

  Read the article

• Python, a smarter way of string to integer conversion

  - by Hellnar

  Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

  Read the article

• mouse rollover event in Python (VPython)

  - by kame

  Is there something similar to scene.mouse.getclick in the visual module (VPython)? I need it for a rollover. Thanks in advance. EDIT: I need a function for doing something when the mouse moves inside a special area without clicking.

  Read the article

• Python: unable to inherit from a C extension.

  - by celil

  I am trying to add a few extra methods to a matrix type from the pysparse library. Apart from that I want the new class to behave exactly like the original, so I chose to implement the changes using inheritance. However, when I try from pysparse import spmatrix class ll_mat(spmatrix.ll_mat): pass this results in the following error TypeError: Error when calling the metaclass bases cannot create 'builtin_function_or_method' instances What is this causing this error? Is there a way to use delegation so that my new class behaves exactly the same way as the original?

  Read the article

• Python learner needs help spotting an error

  - by Protean

  This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

  Read the article

• python search replace using wildcards

  - by tom smith

  hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

  Read the article

• Compiler options wrong with python setup.py

  - by John Smith

  I'm trying to install matplotlib on my mac setup. I find that setup.py has inaccurate flags, in particular the isysroot points to an earlier SDK. Where does setup.py get its info and how can i fix it?

  Read the article

• Python TKinter connect variable to entry widget

  - by Sano98

  Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

  Read the article

• Listing all possible values for SOAP enumeration with Python SUDS

  - by bdk

  I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

  Read the article

• how to send file via http with python

  - by ep45

  Hello, I have a problem. I use Apache with mod_wsgi and webpy, and when i send a file on http, a lot packets are lost. This is my code : web.header('Content-Type','video/x-flv') web.header('Content-length',sizeFile) f = file(FILE_PATH, 'rb') while True: buffer = f.read(4*1024) if buffer : yield buffer else : break f.close() What in my code is wrong ? thanks.

  Read the article

• removing pairs of elements from numpy arrays that are NaN (or another value) in Python

  - by user248237

  I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

  Read the article

• Convert alphabet letters to number in python

  - by altin

  Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

  Read the article

• python raw_input odd behavior with accents containing strings

  - by Ryan

  I'm writing a program that asks the user for input that contains accents. The user input string is tested to see if it matches a string declared in the program. As you can see below, my code is not working: code # -*- coding: utf-8 -*- testList = ['má'] myInput = raw_input('enter something here: ') print myInput, repr(myInput) print testList[0], repr(testList[0]) print myInput in testList output in eclipse with pydev enter something here: má mv° 'm\xe2\x88\x9a\xc2\xb0' má 'm\xc3\xa1' False output in IDLE enter something here: má má u'm\xe1' má 'm\xc3\xa1' Warning (from warnings module): File "/Users/ryanculkin/Desktop/delete.py", line 8 print myInput in testList UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal False How can I get my code to print True when comparing the two strings? Additionally, I note that the result of running this code on the same input is different depending on whether I use eclipse or IDLE. Why is this? My eventual goal is to put my program on the web; is there anything that I need to be aware of, since the result seems to be so volatile?

  Read the article

• python: using __import__ to import a module which in turn generates an ImportError

  - by bbb

  Hi there, I have a funny problem I'd like to ask you guys ('n gals) about. I'm importing some module A that is importing some non-existent module B. Of course this will result in an ImportError. This is what A.py looks like import B Now let's import A >>> import A Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/tmp/importtest/A.py", line 1, in <module> import B ImportError: No module named B Alright, on to the problem. How can I know if this ImportError results from importing A or from some corrupt import inside A without looking at the error's string representation. The difference is that either A is not there or does have incorrect import statements. Hope you can help me out... Cheers bb

  Read the article

• Python: how to enclose strings in a list with < and >

  - by Michael Konietzny

  Hello, i would like to enclose strings inside of list into < (formatted like <%s). The current code does the following: def create_worker (general_logger, general_config): arguments = ["worker_name", "worker_module", "worker_class"] __check_arguments(arguments) def __check_arguments(arguments): if len(sys.argv) < 2 + len(arguments): print "Usage: %s delete-project %s" % (__file__," ".join(arguments)) sys.exit(10) The current output looks like this: Usage: ...\handler_scripts.py delete-project worker_name worker_module worker_class and should look like this: Usage: ...\handler_scripts.py delete-project <worker_name> <worker_module> <worker_class> Is there any short way to do this ? Greetings, Michael

  Read the article

< Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >