Search Results

Search found 9830 results on 394 pages for 'percent complete'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 139/394 | < Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >

  • exploratory SPARQL queries?

    - by significance
    whenever i start using sql i tend to throw a couple of exploratory statements at the database in order to understand what is avaliable, and what form the data takes. eg. show tables describe table select * from table could anyone help me understand the way to complete a similar exploration of an rdf datastore using a SPARQL endpoint? Thanks :)

    Read the article

  • Twitter API - oauth gem - not getting callback

    - by haries
    I redirect the user of my application to Twitter for oauth style authentication using my app's request_token. The user is able to enter username and password on Twitter's page BUT then, instead of calling back my application, Twitter displays a page You've successfully granted access to MyAppName! Simply return to MyAppName and enter the following PIN to complete the process. 123456 Why is this happening? I have set the callback url in my app's settings. Thanks

    Read the article

  • Could not load file or assembly for c1webreport1 tool in compnentone studio

    - by Omprakash
    I'm using Licensed componentone product in my ASP.NET application and spcefically i use C1WebReport1 control from the product.while upgrading C1WebReport1 control from version 2.5.20072.239 to 2.6.20093.53207,i get the error message as "Could not load file or assembly 'C1.Web.C1WebReport.2, Version=2.6.20093.53207, Culture=neutral, PublicKeyToken=594a0605db190bb9' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040)" can any one help me to bring complete solution? Thanks in advance. Regards Omprakash

    Read the article

  • How to pass arguments to Go program?

    - by oraz
    I can't see arguments for main() in package main. How to pass arguments from command line in Go? A complete program, possibly created by linking multiple packages, must have one package called main, with a function func main() { ... } defined. The function main.main() takes no arguments and returns no value.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Autocomplete functionality on a textarea

    - by sslepian
    Is there a way to implement auto-complete functionality in a region defined by textarea tags or something similar? I'm currently using a jquery autocomplete plugin to suggest input to the user inside input tags, but the issue is that the autocomplete phrases can often be fairly long and thus scroll off the edge of the input field.

    Read the article

  • how to detect whether strings are not captured for localization in .po files i.e no equivalent entry

    - by Manjushree
    Hi we have some queries regarding localization/.po files 1 We want to detect the missing strings or strings which are not being captured for L10N. how we can detect that? is that any method or command to update the strings 2 Locale files (.po) for "cn-zh" or another Locale are not complete (missing strings) 3 String has been captured for L10N but does not have a matching pair in .po files

    Read the article

  • FlexUnit 4 Error

    - by OXMO456
    Hi, I am facing a strange FlexUnit Error: Whoa... been asked to send another complete and I already did that The error seem to occur when the number of test exceede 27...? test exemple: [Test] public function whenDoingThat_expectThatIsTrue():void{ //blabla assertTrue(...) } Any help welcome !

    Read the article

  • How to poll the popular websites in PHP?

    - by Runner
    It's springed from this answer: http://superuser.com/questions/129741/how-does-search-engines-update-indexing-so-soon/129743#129743 BTW,for the servers that's polled,is it the same whether the request is just for polling(header information) or complete web page?

    Read the article

  • jQuery scroll fails for iframe (firefox)

    - by knappy
    I cannot get scroll to work, here is the complete stuff: http://zed.mit.edu/scroll2/buc.php I'm trying to refresh the page while maintaining the scroll position of the iframe inside. I'd like to have an alert when I actively scroll the iframe, these two both fail: $(top).frames['#iframe_bucinid'].scroll(function() .... $('#iframe_bucinid').scroll(function() ... The page's iframe is defined as: <iframe class="inframe" src="bucin.php" name="bucin" id="iframe_bucinid"> Notice that getting the scrollTop works with top.frames['bucin'].document.body.scrollTop

    Read the article

  • LaTeX lstlisting underlined

    - by Gernot
    Hi, Is there an easy way to have the complete code in a lstlisting environment underlined? My current solution looks like this, but I'm not really happy with it. \begin{lstlisting}[mathescape] $\ul{if(gt(x1, 0)) then} $ ... \end{lstlisting} Thx for any tips.

    Read the article

  • What is an efficient way to find a non-colliding rectangle nearest to a location

    - by hyn
    For a 2D game I am working on, I am using y axis sorting in a simple rectangle-based collision detection. This is working fine, and now I want to find the nearest empty rectangle at a given location with a given size, efficiently. How can I do this? Is there an algorithm? I could think of a simple brute force grid test (with each grid the size of the empty space we're looking for) but obviously this is slow and not even a complete test.

    Read the article

  • download file exception handling

    - by klaus-vlad
    Hi, In my application I download several critical files from a server, and I want to write some code that handles the case where the a file download didn't complete for a reason or other ,to retry downloading it at next startup. The function that downloads a file at a time however throws only MalformedURLException and IOException , but if these exceptions are thrown that means that the download didn't even begin. How should I arrange things so I can treat the case where a download failed , even if it began ? download(String file) throws MalformedURLException ,IOException { }

    Read the article

  • ORDER BY in a Sql Server 2008 view

    - by eidylon
    Hi all... we have a view in our database which has an ORDER BY in it. Now, I realize views generally don't order, because different people may use it for different things, and want it differently ordered. This view however is used for a VERY SPECIFIC use-case which demands a certain order. (It is team standings for a soccer league.) The database is Sql Server 2008 Express, v.10.0.1763.0 on a Windows Server 2003 R2 box. The view is defined as such: CREATE VIEW season.CurrentStandingsOrdered AS SELECT TOP 100 PERCENT *, season.GetRanking(TEAMID) RANKING FROM season.CurrentStandings ORDER BY GENDER, TEAMYEAR, CODE, POINTS DESC, FORFEITS, GOALS_AGAINST, GOALS_FOR DESC, DIFFERENTIAL, RANKING It returns: GENDER, TEAMYEAR, CODE, TEAMID, CLUB, NAME, WINS, LOSSES, TIES, GOALS_FOR, GOALS_AGAINST, DIFFERENTIAL, POINTS, FORFEITS, RANKING Now, when I run a SELECT against the view, it orders the results by GENDER, TEAMYEAR, CODE, TEAMID. Notice that it is ordering by TEAMID instead of POINTS as the order by clause specifies. However, if I copy the SQL statement and run it exactly as is in a new query window, it orders correctly as specified by the ORDER BY clause.

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • Selecting random top 3 listings per shop for a range of active advertising shops

    - by GraGra33
    I’m trying to display a list of shops each with 3 random items from their shop, if they have 3 or more listings, that are actively advertising. I have 3 tables: one for the shops – “Shops”, one for the listings – “Listings” and one that tracks active advertisers – “AdShops”. Using the below statement, the listings returned are random however I’m not getting exactly 3 listings (rows) returned per shop. SELECT AdShops.ID, Shops.url, Shops.image_url, Shops.user_name AS shop_name, Shops.title, L.listing_id AS listing_id, L.title AS listing_title, L.price as price, L.image_url AS listing_image_url, L.url AS listing_url FROM AdShops INNER JOIN Shops ON AdShops.user_id = Shops.user_id INNER JOIN Listings AS L ON Shops.user_id = L.user_id WHERE (Shops.is_vacation = 0 AND Shops.listing_count > 2 AND L.listing_id IN (SELECT TOP 3 L2.listing_id FROM Listings AS L2 WHERE L2.listing_id IN (SELECT TOP 100 PERCENT L3.listing_id FROM Listings AS L3 WHERE (L3.user_id = L.user_id) ) ORDER BY NEWID() ) ) ORDER BY Shops.shop_name I’m stumped. Anyone have any ideas on how to fix it? The ideal solution would be one record per store with the 3 listings (and associated data) were in columns and not rows – is this possible?

    Read the article

  • Include a version control tag in VSS

    - by Sjuul Janssen
    I was reading Code Complete 2 and it mentions this: Many version-control tools wil insert version information into a file. In CVS, for exmple the characters // $id$ Will Automaticly expand to // $id: ClassName.java, v 1.1 2004/02/05 00:36:42 ismene Exp $ So now I would like to do something similar with VSS for our SQL scripts I have been googling around for the answer but can't find it. Is this possible? can someone maybe point me in the right direction?

    Read the article

  • Make index.cgi redirect to Apache webserver document root

    - by Casey
    I'm trying to expose a CGI file as my document root and web server. I do not want to expose the fact that the server is running a CGI script. How can I map a URL http://host/index.cgi/ back to http://host/ in Apache2? I'm guessing it involves mod-rewrite, but I haven't finished grokking all the docs yet. The following configuration is working, but I'm guessing there is a more complete solution: RewriteEngine ON Redirect /index.cgi/ /

    Read the article

  • Bipartite matching in Python

    - by vailen
    Does anybody know any module in Python that computes the best bipartite matching? I have tried the following two: munkres hungarian However, in my case, I have to deal with non-complete graph (i.e., there might not be an edge between two nodes), and therefore, there might not be a match if the node has no edge. The above two packages seem not to be able to deal with this. Any advice?

    Read the article

  • android threads

    - by rantravee
    Hi, I'm searching for some good material on android threads but I couldn't find references for a complete description about this subject. So if you know any valuable reference please point them to me.

    Read the article

  • List of Character Encodings

    - by helpme
    Is There A Book or Site That Teaches And Also Includes A Complete List of Character Encoding's That Includes Hexadecimal, Decimal and Name Versions? If you can name a couple of books and sites, that would be very helpful thank you.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >