Search Results

Search found 9517 results on 381 pages for 'customize ie'.

Page 140/381 | < Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >

  • htaccess mod_rewrite check file/directory existence, else rewrite?

    - by devians
    I have a very heavy htaccess mod_rewrite file that runs my application. As we sometimes take over legacy websites, I sometimes need to support old urls to old files, where my application processes everything post htaccess. My ultimate goal is to have a 'Demilitarized Zone' for old file structures, and use mod rewrite to check for existence there before pushing to the application. This is pretty easy to do with files, by using: RewriteCond %{IS_SUBREQ} true RewriteRule .* - [L] RewriteCond %{ENV:REDIRECT_STATUS} 200 RewriteRule .* - [L] RewriteCond Public/DMZ/$1 -F [OR] RewriteRule ^(.*)$ Public/DMZ/$1 [QSA,L] This allows pseudo support for relative urls by not hardcoding my base path (I cant assume I will ever be deployed in document root) anywhere and using subrequests to check for file existence. Works fine if you know the file name, ie http://domain.com/path/to/app/legacyfolder/index.html However, my legacy urls are typically http://domain.com/path/to/app/legacyfolder/ Mod_Rewrite will allow me to check for this by using -d, but it needs the complete path to the directory, ie RewriteCond Public/DMZ/$1 -F [OR] RewriteCond /var/www/path/to/app/Public/DMZ/$1 -d RewriteRule ^(.*)$ Public/DMZ/$1 [QSA,L] I want to avoid the hardcoded base path. I can see one possible solutions here, somehow determining my path and attaching it to a variable [E=name:var] and using it in the condition. Another option is using -U, but the tricky part is stopping it from hijacking every other request when they should flow through, since -U is really easy to satisfy. Any implementation that allows me to existence check a directory is more than welcome. I am not interested in using RewriteBase, as that requires my htaccess to have a hardcoded base path.

    Read the article

  • How do I dynamically create a document for download in Javascript?

    - by Nelson
    I'm writing some Javascript code that generates an XML document in the client (via Google Earth plugin). I'd like the user to be able to click a button on the page and be prompted to save that XML to a new file. If I were generating the XML server-side this would be easy, just make the button open the link. But the XML is generated client-side. I've come up with a couple of hacks that half-work, inspired in part by this StackOverflow question. But neither completely work. Here's a demo HTML with embedded code: <html><head><script> function getData() { return '<?xml version="1.0" encoding="UTF-8"?><doc>Hello</doc>'; } function dlDataURI() { window.open("data:text/xml;charset=utf-8," + getData()); } function dlWindow() { var w = window.open(); w.document.open(); w.document.write(getData()); w.document.close(); } </script><body> <div onclick="dlDataURI()">Click for Data URL</div> <div onclick="dlWindow()">Click for Window</div> </body></html> The dlDataURI() version works great in Firefox, poorly in Chrome (can't save), and not at all in IE. The Window() version works OK in Firefox and IE, and not well in Chrome (can't save, XML embedded inside HTML). Neither version ever prompts a user download, it always opens a new window trying to display the XML. Is there a good way to do what I want in client side Javascript? I'd like this to work in today's browsers, ideally Firefox, MSIE 8, and Chrome.

    Read the article

  • Please help! request compression

    - by Naor
    Hi, I wrote an IHttpModule that compress my respone using gzip (I return a lot of data) in order to reduce response size. It is working great as long as the web service doesn't throws an exception. In case exception is thrown, the exception gzipped but the Content-encoding header is disappear and the client doesn't know to read the exception. How can I solve this? Why the header is missing? I need to get the exception in the client. Here is the module: public class JsonCompressionModule : IHttpModule { public JsonCompressionModule() { } public void Dispose() { } public void Init(HttpApplication app) { app.BeginRequest += new EventHandler(Compress); } private void Compress(object sender, EventArgs e) { HttpApplication app = (HttpApplication)sender; HttpRequest request = app.Request; HttpResponse response = app.Response; try { //Ajax Web Service request is always starts with application/json if (request.ContentType.ToLower(CultureInfo.InvariantCulture).StartsWith("application/json")) { //User may be using an older version of IE which does not support compression, so skip those if (!((request.Browser.IsBrowser("IE")) && (request.Browser.MajorVersion <= 6))) { string acceptEncoding = request.Headers["Accept-Encoding"]; if (!string.IsNullOrEmpty(acceptEncoding)) { acceptEncoding = acceptEncoding.ToLower(CultureInfo.InvariantCulture); if (acceptEncoding.Contains("gzip")) { response.AddHeader("Content-encoding", "gzip"); response.Filter = new GZipStream(response.Filter, CompressionMode.Compress); } else if (acceptEncoding.Contains("deflate")) { response.AddHeader("Content-encoding", "deflate"); response.Filter = new DeflateStream(response.Filter, CompressionMode.Compress); } } } } } catch (Exception ex) { int i = 4; } } } Here is the web service: [WebMethod] public void DoSomething() { throw new Exception("This message get currupted on the client because the client doesn't know it gzipped."); } I appriciate any help. Thanks!

    Read the article

  • Crystal reports 11 RDC (COM API) displays printer dialog even when I tell it not to prompt

    - by bdonlan
    I'm using Crystal Reports 11's RDC (COM) API to print. My code looks like this: HRESULT res = m_Report->SelectPrinter(b_driver, b_device, b_port); if (FAILED(res)) return res; // For these calls, the #import wrapper throws on error m_Report->PutPrinterDuplex(dmDuplex); m_Report->PutPaperSize(dmPaperSize); m_Report->PutPaperSource((CRPaperSource)pdlg->GetDevMode()->dmDefaultSource); if (m_Report->GetPaperOrientation() == crDefaultPaperOrientation) m_Report->PutPaperOrientation(crPortrait); VARIANT vfalse; VariantInit(&vfalse); vfalse.vt=VT_BOOL; vfalse.boolVal=0; res = m_Report->PrintOut(vfalse); However, at the end of all this, crystal reports still shows its own printer selection dialog - but only for some reports, it seems. Why does crystal reports show a print dialog even when I pass false for promptUser? And how, then, can I suppress crystal reports' internal printer selection dialog and force it to use my values? Edit: Whoops, CR11, not CR9. Some further information: The reports that work properly (ie, do not show the print dialog) are generated internally using the RDC API; we create a new report object, import subreports into it, then print the result. No problem there. The reports that do not work properly (ie, force the print dialog to open) have been created with a previous version of crystal reports; however, opening and saving the report does not seem to help. Sample reports in the Crystal Reports installation directory show the same problem. I tried reproducing with VBScript; however, the result was that nothing was printed at all (no dialog, no nothing): Set app = CreateObject("CrystalRuntime.Application.11") Set report = app.OpenReport("C:\Program Files\Business Objects\Crystal Reports 11.5\Samples\en\Reports\General Business\Inventory Crosstab.rpt") report.PrintOut(True) rem Testing with a True parameter to force a print dialog - but no printout and nothing appears (no error either though)

    Read the article

  • Microsoft Reporting 2005 and Report Viewer Report ASP.Net Session Has Expired on Load

    - by ThaKidd
    At my job, I have been tasked with fixing an error with our reporting server. That error is ASP.Net Session Has Expired. This error occurs when the Visual Studio ReportViewer 2005 Control attempts to load a report. We are trying to host this report to users hitting our Internet exposed Windows 2003 Server running IIS 6.0. The reportviewer control is attempting to load this report from a second server running Microsoft SQL 2005 w/Reporting Services. The SQL server is not exposed to the Internet. Here is the weird thing. This error never occurs on the development box. When it is transferred to the production IIS server, the error starts to occur. It only happens every time the report is first loaded. If the browser's refresh button is clicked 5-10 times, the report will finally load correctly. I have reproduced this same error on the latest version of Mozilla Firefox, IE 7, and IE 8. The report only takes 10-20 seconds to load. I have tried timeouts in the 300+ second range on the reporting server/iis production server. I have tried a few options like Async (which causes images not to load properly) and setting the session mode to iproc with a high timeout value in the Reporting Server's web.config. I have also tried using the reporting server's IP address in the report viewer's code instead of the server name. I plan on verifying a picture loading issue which I also read about tomorrow when I get into work. I am unsure what service packs Visual Studio 2005 and the MSSQL server are running. Was an update released to fix this problem that I could not find? Does anyone have a fix for this?

    Read the article

  • Best way to pan & scan images with jquery

    - by guy
    Hello, I am trying to make an image pan & scan system. I have a slider that zooms the image (that can be dragged) and also a small map in the corner of the image (that can also be dragged). You can see a rough example here (sorry, I am not allowed to use the design, so it's not formatted): http://lighe.madetokill.com/test/test.html My problem is that although it works great in firefox and opera, it stutters in chrome, safari and IE (it doesn't currently work in IE) at any zoom level except 100% (at 100% it's butter smooth). What is the reason for webkit's poor performance? Am I implementing this wrong? I am basically changing the margin-left and margin-top properties of the image. I know this is fast enough since at 100% it's perfectly smooth. Would I be better off using canvas? I am trying to avoid flash (or any other plugins) if possible. Also please note this is work in progress, there are other bugs except this, so do not bother with those :) Thanks in advance!

    Read the article

  • IE9 selectAllChildren on an out-of-view element

    - by MrSlayer
    I am trying to replicate a service that is provided by Tynt.com that appends some text to a user's selection when copying. I understand that users don't particularly like this, but it is a client's request to append the URL and copyright notice whenever a user copies something from their website. In current browsers, I am able to do this by creating a DOM element, adding the selected text, appending the copyright text and then selecting the new node: var newSelection = document.createElement( 'div' ); newSelection.style.cssText = "height: 1px; width: 1px; overflow: hidden;"; if( window.getSelection ) { var selection = window.getSelection( ); if( selection.getRangeAt ) { var range = selection.getRangeAt( 0 ); newSelection.appendChild( range.cloneContents( ) ); appendCopyright( ); document.body.appendChild( newSelection ); selection.selectAllChildren( newSelection ); // ... remove element, return selection } } In IE9, this errors out on the selection.selectAllChildren( newSelection ) statement and I was able to figure out that this is because newSelection was effectively "hidden" from the viewport due to the styles applied in the second line above. Commenting that out works, but obviously the new node is shown to the end user. It appears that this was resolved in later versions of IE, but I am having trouble coming up with a workaround that is sufficient for IE9, a browser that I need to support. I've tried a variety of alternatives, like setting visibility: hidden;, positioning it off-screen, and trying some alternative selection functions, but they each present different problems. The error thrown by IE is: SCRIPT16389: Unspecified error.

    Read the article

  • IE8 window.opener problems

    - by fire
    Having problems with IE8... I have a button that onclick fires the showImageBrowser() function. function showImageBrowser(params) { var open = window.open('http://localhost/admin/browse?'+params,'newwin','toolbar=0,location=0,directories=0,status=1,menubar=0,scrollbars=1,resizable=1,width=950,height=500'); if (!open) { alert('Could not open the image browser, please disable your popup blocker.'); } } Now in the image browser when you click on an image it calls this function: function selectFile(url, el) { window.opener.replaceImage('Test_Image', url); window.close(); } Which is calling the replaceImage() function in the parent window, as expeted. This is the code: function replaceImage(el, url) { $('#'+el).html('<a href="'+url+'" target="_blank" class="image">'+basename(url)+'</a>'); $("input[name='"+el+"']").val(url); } Now if you click on the original showImageBrowser() button for the second time, IE will bring up the window but this time it freezes for a few seconds and then you get the alert "Could not open the image browser, please disable your popup blocker." This works fine in Firefox (obviously) but not in IE. I haven't even tried it in IE7/6 because if it doesn't work in 8 then I know I'm going to have problems. Any advice?

    Read the article

  • How to debug jQuery ajax POST to .NET webservice

    - by Nick
    Hey all. I have a web service that I have published locally. I wrote an HTML page to test the web service. The webservice is expecting a string that will be XML. When I debug the web service from within VS everything works great. I can use FireBug and see that my web service is indeed being hit by they AJAX call. After deploying the web service locally to IIS it does not appear to be working. I need to know the best way to trouble shoot this problem. My AJAX js looks like this: function postSummaryXml(data) { $.ajax({ type: 'POST', url: 'http://localhost/collection/services/datacollector.asmx/SaveSummaryDisplayData', data: { xml: data }, error: function(result) { alert(result); }, success: function(result) { alert(result); } }); The web method looks like so: [WebMethod] public string SaveSummaryDisplayData(string xml) { XmlDocument xmlDocument = new XmlDocument(); xmlDocument.LoadXml(xml); XmlParser parser = new XmlParser(xmlDocument); IModel repository = new Repository(); if(repository.AddRecord("TestData",parser.TestValues)) { return "true"; } return "false"; } } I added the return string to the web method in an attempt to ensure that the web-service is really hit from the ajax. The problem is this: In FF the 'Success' function is always called yet the result is always 'NULL'. And the web method does not appear to have worked (no data saved). In IE the 'Error' function is called and the response is server error: 500. I think (believe it or not) IE is giving me a more accurate indication that something is wrong but I cannnot determine what the issue is. Can someone please suggest how I should expose the specific server error message? Thanks for the help!

    Read the article

  • Code Golf: Quickly Build List of Keywords from Text, Including # of Instances

    - by Jonathan Sampson
    I've already worked out this solution for myself with PHP, but I'm curious how it could be done differently - better even. The two languages I'm primarily interested in are PHP and Javascript, but I'd be interested in seeing how quickly this could be done in any other major language today as well (mostly C#, Java, etc). Return only words with an occurrence greater than X Return only words with a length greater than Y Ignore common terms like "and, is, the, etc" Feel free to strip punctuation prior to processing (ie. "John's" becomes "John") Return results in a collection/array Extra Credit Keep Quoted Statements together, (ie. "They were 'too good to be true' apparently")Where 'too good to be true' would be the actual statement Extra-Extra Credit Can your script determine words that should be kept together based upon their frequency of being found together? This being done without knowing the words beforehand. Example: "The fruit fly is a great thing when it comes to medical research. Much study has been done on the fruit fly in the past, and has lead to many breakthroughs. In the future, the fruit fly will continue to be studied, but our methods may change." Clearly the word here is "fruit fly," which is easy for us to find. Can your search'n'scrape script determine this too? Source text: http://sampsonresume.com/labs/c.txt Answer Format It would be great to see the results of your code, output, in addition to how long the operation lasted.

    Read the article

  • vimscript: calling dictionary functions with call()

    - by intuited
    I'm hoping to call a "static" dictionary function using call(). By "static" I mean that the keyword 'dict' is not used in the function's definition. I use this nomenclature in the hopes that the effect of this keyword is to declare a static member function as is possible in java/C++/etc, ie to put the function name in the class namespace but allow it to be called without referencing an object. However this doesn't seem to work. For example: " Setup: let testdict = { } funct! testdict.funct() echo "called" endfunct " Tests: " Following each line is an indented comment " containing its output in message land, ie what was echoed. call testdict.funct() " called echo testdict.funct " 667 echo string(testdict.funct) " function('667') echo function('667') " E475: Invalid argument: 667 echo function('testdict.funct') " testdict.funct call call(testdict.funct, [ ]) " E725: Calling dict function without Dictionary: 667 " Same deal if there's an intermediate variable involved. let TestdictDotFunct = testdict.funct echo TestdictDotFunct " 667 echo string(TestdictDotFunct) " function('667') call TestdictDotFunct() " E725: Calling dict function without Dictionary: 667 From the help topic E725: It is also possible to add a function without the "dict" attribute as a Funcref to a Dictionary, but the "self" variable is not available then. So logic would seem to indicate that if "self" is not available, then it should be possible to call the function referenced by the Funcref without a Dictionary. However this doesn't seem to be the case. Am I missing something? Vim version info: $ aptitude show vim-gnome Package: vim-gnome State: installed Automatically installed: no Version: 2:7.2.245-2ubuntu2

    Read the article

  • setcookie, Cannot modify header information - headers already sent

    - by Nano HE
    Hi,I am new to PHP, I practised PHP setcookie() just now and failed. http://localhost/test/index.php <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <title></title> </head> <body> <?php $value = 'something from somewhere'; setcookie("TestCookie", $value); ?> </body> </html> http://localhost/test/view.php <?php // I plan to view the cookie value via view.php echo $_COOKIE["TestCookie"]; ?> But I failed to run index.php, IE warning like this. Warning: Cannot modify header information - headers already sent by (output started at C:\xampp\htdocs\test\index.php:9) in C:\xampp\htdocs\test\index.php on line 12 I enabled my IE 6 cookie no doubt. Is there anything wrong on my procedure above? Thank you. WinXP OS and XAMPP 1.7.3 used.

    Read the article

  • WCF Service in Azure with ClaimsIdentity over SSL

    - by Sunil Ramu
    Hello , Created a WCF service as a WebRole using Azure and a client windows application which refers to this service. The Cloud Service is refered to a certificate which is created using the "Hands On Lab" given in windows identity foundation. The Web Service is hosted in IIS and it works perfect when executed. I've created a client windows app which refers to this web service. Since WIF Claims identity is used, I have a claimsAuthorizationManager Class, and also a Policy class with set of defilned policies. The Claims is set in the web.config file. When I execute the windows app as the start up project, the app prompts for authentication, and when the account credentials are given as in the config file, it opens a new "Windows Card Space" Window and Says "Incoming Policy Failed". When I close the window the System throws and Exception The incoming policy could not be validated. For more information, please see the event log. Event Log Details Incoming policy failed validation. No valid claim elements were found in the policy XML. Additional Information: at System.Environment.get_StackTrace() at Microsoft.InfoCards.Diagnostics.InfoCardTrace.BuildMessage(InfoCardBaseException ie) at Microsoft.InfoCards.Diagnostics.InfoCardTrace.TraceAndLogException(Exception e) at Microsoft.InfoCards.Diagnostics.InfoCardTrace.ThrowHelperError(Exception e) at Microsoft.InfoCards.InfoCardPolicy.Validate() at Microsoft.InfoCards.Request.PreProcessRequest() at Microsoft.InfoCards.ClientUIRequest.PreProcessRequest() at Microsoft.InfoCards.Request.DoProcessRequest(String& extendedMessage) at Microsoft.InfoCards.RequestFactory.ProcessNewRequest(Int32 parentRequestHandle, IntPtr rpcHandle, IntPtr inArgs, IntPtr& outArgs) Details: System Provider [ Name] CardSpace 3.0.0.0 EventID 267 [ Qualifiers] 49157 Level 2 Task 1 Keywords 0x80000000000000 EventRecordID 6996 Channel Application EventData No valid claim elements were found in the policy XML. Additional Information: at System.Environment.get_StackTrace() at Microsoft.InfoCards.Diagnostics.InfoCardTrace.BuildMessage(InfoCardBaseException ie) at Microsoft.InfoCards.Diagnostics.InfoCardTrace.TraceAndLogException(Exception e) at Microsoft.InfoCards.Diagnostics.InfoCardTrace.ThrowHelperError(Exception e) at Microsoft.InfoCards.InfoCardPolicy.Validate() at Microsoft.InfoCards.Request.PreProcessRequest() at Microsoft.InfoCards.ClientUIRequest.PreProcessRequest() at Microsoft.InfoCards.Request.DoProcessRequest(String& extendedMessage) at Microsoft.InfoCards.RequestFactory.ProcessNewRequest(Int32 parentRequestHandle, IntPtr rpcHandle, IntPtr inArgs, IntPtr& outArgs)

    Read the article

  • jQuery: Traversing AJAX response in Chrome/Safari

    - by jitzo
    I'm trying to traverse an AJAX response, which contains a remote web page (an HTML output). My goal is to iterate through the 'script', 'link', and 'title' elements of the remote page - load them if necessary, and embed its contents to the current page. Its working great in FF/IE, but for some reason - Chrome & Safari behaves differently: When I run a .each() loop on the response, Chrome/Safari seems to omit everything that is under the section of the page. Here's my current code: $.ajax({ url: 'remoteFile.php', cache: false, dataFilter: function(data) { console.log(data); /* The output seems to contain the entire response, including the <head> section - on all browsers, including Chrome/Safari */ $(data).filter("link, script, title").each(function(i) { console.log($(this)); /* IE/FF outputs all of the link/script/title elements, Chrome will output only those that are not in the <head> section */ }); console.log($(data)); /* This also outputs the incomplete structure on Chrome/Safari */ return data; }, success: function(response) {} }); I've been struggling with this problem for quite a while now, i've found some other similar cases on google searches, but no real solution. This happens on both jQuery 1.4.2, and jQuery 1.3.2. I really don't want to parse the response with .indexOf() and .substring() - it seems to me that it will be an overkill for the client. Many thanks in advance!

    Read the article

  • Modified jQuery innerfade sluggish

    - by Jay Hankins
    HI. I am using the jQuery innerfade plugin to scroll through some images on my site. Innerfade is sluggish to move on Firefox 3.6.3, and IE 8. IE 8 is much worse than Firefox, and Chrome runs smoothly. Can you analyze my code to see what the problem is? I've used the modified innerfade from here: http://www.stylephp.com/2009/01/17/customizing-jquery-innerfade-plug-in-adding-controls-navigation-and-caption/ My sites are here: Without bg image: http://dl.dropbox.com/u/145908/doozie2/index.html With bg image: http://dl.dropbox.com/u/145908/doozie2/index2.html Removing my background image fixes the situation; it's not that big of a file. I don't understand why that is an issue. I am using a technique to resize the image to fit the browser window, as you can see in the CSS. Thanks so much. P.S. Sorry, I'm a new user so I can't post more than one link. Please copy and paste the address between <.

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • Heroku taps push weirdness...

    - by holden
    I have the strangest experience using taps to move data between my machine and heroku. It works fine except that it seems to loose 0s directly behind the decimal place for my geo coordinates. Ie 50.0519322 for some reason gets set to 50.519322... no idea why. When I pull the data from the remote location ie. heroku db:pull... it works fine, all decimal places intact on my machine, however, when i push it back to the remote server it loses these zeros. Especially directly behind the decimal place, though I haven't noticed it elsewhere yet. At first I was storing the lat and lng as simply numeric but refined it to: change_column :places, :lat, :numeric, :precision => 15, :scale => 10 change_column :places, :lng, :numeric, :precision => 15, :scale => 10 With no result, any ideas what's going on? From the console on the remote server i get the lat as being: #<BigDecimal:2aebcc5967c0,'0.50519322E2',18(18)> and my machine as: #<BigDecimal:10232f7c8,'0.50519322E2',12(16)> which is also odd, the second one because it shows up as 50.0519322 when i edit it thru my view but when i do to_f via console it gives me 50.519322

    Read the article

  • Very strange jQuery / AJAX behavior

    - by Dr. DOT
    I have an Ajax call to the server that only works when I pass an alert(); to it. Cannot figure out what is wrong. Can anyone help? This Does Not Work (ie., Ajax call to server does not get made): <!-- jQuery.support.cors = true; // needed for ajax to work in certain older browsers and versions $('input[name="status"]').on("change", function() { if ($('input:radio[name="status"]:checked').val() == 'Y') { $.ajax({ url: 'http://mydomain.com/dir/myPHPscript.php?param=' + $('#param').val() + '&id=' + ( $('#id').val() * 1 ) + '&mode=' + $('#mode').val() }); } window.parent.closePP(); window.top.location.href = $('#redirect').val(); // reloads page }); //--> This Works! (ie., Ajax call to server gets made when I have the alert() present): <!-- jQuery.support.cors = true; // needed for ajax to work in certain older browsers and versions $('input[name="status"]').on("change", function() { if ($('input:radio[name="status"]:checked').val() == 'Y') { $.ajax({ url: 'http://mydomain.com/dir/myPHPscript.php?param=' + $('#param').val() + '&id=' + ( $('#id').val() * 1 ) + '&mode=' + $('#mode').val() }); **alert('this makes it work');** } window.parent.closePP(); window.top.location.href = $('#redirect').val(); // reloads page }); //--> Thanks.

    Read the article

  • How to stop MVC caching the results of invoking and action method?

    - by Trey Carroll
    I am experiencing a problem with IE caching the results of an action method. Other articles I found were related to security and the [Authorize] attribute. This problem has nothing to do with security. This is a very simple "record a vote, grab the average, return the avg and the number of votes" method. The only slightly interesting thing about it is that it is invoked via Ajax and returns a Json object. I believe that it is the Json object that is getting catched. When I run it from FireFox and watch the XHR traffic with Firebug, everything works perfectly. However, under IE 8 the "throbber" graphic doesn't ever have time to show up and the page elements that display the "new" avg and count that are being injected into the page with jQuery are never different. I need a way to tell MVC to never cache this action method. This article seems to address the problem, but I cannot understand it: http://stackoverflow.com/questions/1441467/prevent-caching-of-attributes-in-asp-net-mvc-force-attribute-execution-every-tim I need a bit more context for the solution to understand how to extend AuthorizationAttribute. Please address your answer as if you were speaking to someone who lacks a deep understanding of MVC even if that means replying with an article on some basics/prerequisites that are required. Thanks, Trey Carroll

    Read the article

  • Circle drawing with SVG's arc path

    - by ????
    The following SVG path can draw 99.99% of a circle: (try it on http://jsfiddle.net/DFhUF/46/ and see if you see 4 arcs or only 2, but note that if it is IE, it is rendered in VML, not SVG, but have the similar issue) M 100 100 a 50 50 0 1 0 0.00001 0 But when it is 99.99999999% of a circle, then nothing will show at all? M 100 800 a 50 50 0 1 0 0.00000001 0 And that's the same with 100% of a circle (it is still an arc, isn't it, just a very complete arc) M 100 800 a 50 50 0 1 0 0 0 How can that be fixed? The reason is I use a function to draw a percentage of an arc, and if I need to "special case" a 99.9999% or 100% arc to use the circle function, that'd be kind of silly. Again, a test case on jsfiddle using RaphaelJS is at http://jsfiddle.net/DFhUF/46/ (and if it is VML on IE 8, even the second circle won't show... you have to change it to 0.01) Update: This is because I am rendering an arc for a score in our system, so 3.3 points get 1/3 of a circle. 0.5 gets half a circle, and 9.9 points get 99% of a circle. But what if there are scores that are 9.99 in our system? Do I have to check whether it is close to 99.999% of a circle, and use an arc function or a circle function accordingly? Then what about a score of 9.9987? Which one to use? It is ridiculous to need to know what kind of scores will map to a "too complete circle" and switch to a circle function, and when it is "a certain 99.9%" of a circle or a 9.9987 score, then use the arc function.

    Read the article

  • jQuery Autocomplete Json Ajax cross browser issue with Google Search Appliance

    - by skyfoot
    I am implementing a jquery autocomplete on a search form and am getting the suggestions from the Google Search Appliance Autocomple suggestions service which returns a result set in json. What I am trying to do is go off to the GSA to get suggestions when the user types something in the search box. The url to get the json suggestions is as follows: http://gsaurl/suggest?q=<query>&max=10&site=default_site&client=default_frontend&access=p&format=rich The json which is returned is as follows: { "query":"re", "results": [ {"name":"red", "type":"suggest"}, {"name":"read", "type":"suggest"}] } The jQuery autocomplete code is as follows: $(#q).autocomplete(searchUrl, { width: 320, dataType: 'json', highlight: false, scroll: true, scrollHeight: 300, parse: function(data) { var array = new Array(); for(var i=0;i<data.results.length;i++) { array[i] = { data: data.results[i], value: data.results[i].name, result: data.results[i].name }; } return array; }, formatItem: function(row) { return row.name; } }); This works in IE but fails in firefox as the data returned in the parse function is null. Any ideas why this would be the case? Workaround I created an aspx page to call the GSA suggest service and to return the json from the suggest service. Using this page as a proxy and setting it as the url in the jQuery autocomplete worked in both IE and FireFox.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Java Applet in Firefox

    - by prakash
    Hi All, I am facing a weird problem in Testing server while using applet (using embed tag) in my ASP.NET MVC application Applet works fine locally in both browsers IE and Firefox but when deployed to Testing server its throwing below exception for Firefox only (IE works fine). Please help me out in this basic: exception: javax.xml.parsers.FactoryConfigurationError: Provider <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> not found. java.lang.RuntimeException: javax.xml.parsers.FactoryConfigurationError: Provider <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> not found at sun.plugin2.applet.Plugin2Manager.createApplet(Unknown Source) at sun.plugin2.applet.Plugin2Manager$AppletExecutionRunnable.run(Unknown Source) at java.lang.Thread.run(Unknown Source) Caused by: javax.xml.parsers.FactoryConfigurationError: Provider <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> not found at javax.xml.parsers.DocumentBuilderFactory.newInstance(Unknown Source) at org.apache.log4j.xml.DOMConfigurator.doConfigure(DOMConfigurator.java:772) at org.apache.log4j.xml.DOMConfigurator.doConfigure(DOMConfigurator.java:696) at org.apache.log4j.helpers.OptionConverter.selectAndConfigure(OptionConverter.java:471) at org.apache.log4j.LogManager.<clinit>(LogManager.java:125) at org.apache.log4j.Logger.getLogger(Logger.java:105) at com.goldleaf.scanner.Logger.<init>(Unknown Source) at com.goldleaf.scanner.Logger.<init>(Unknown Source) at com.goldleaf.scanner.Logger$LoggerHolder.<clinit>(Unknown Source) at com.goldleaf.scanner.Logger.getInstance(Unknown Source) at com.goldleaf.scanner.ScannerApplet.<init>(Unknown Source) at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(Unknown Source) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(Unknown Source) at java.lang.reflect.Constructor.newInstance(Unknown Source) at java.lang.Class.newInstance0(Unknown Source) at java.lang.Class.newInstance(Unknown Source) at sun.plugin2.applet.Plugin2Manager$12.run(Unknown Source) at java.awt.event.InvocationEvent.dispatch(Unknown Source) at java.awt.EventQueue.dispatchEvent(Unknown Source) at java.awt.EventDispatchThread.pumpOneEventForFilters(Unknown Source) at java.awt.EventDispatchThread.pumpEventsForFilter(Unknown Source) at java.awt.EventDispatchThread.pumpEventsForHierarchy(Unknown Source) at java.awt.EventDispatchThread.pumpEvents(Unknown Source) at java.awt.EventDispatchThread.pumpEvents(Unknown Source) at java.awt.EventDispatchThread.run(Unknown Source) Exception: java.lang.RuntimeException: javax.xml.parsers.FactoryConfigurationError: Provider <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> not found Ignored exception: java.lang.RuntimeException: javax.xml.parsers.FactoryConfigurationError: Provider <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> not found basic: Starting applet teardown basic: Finished applet teardown

    Read the article

  • Emulating a web browser

    - by Sean
    Hello, we are tasked with basically emulating a browser to fetch webpages, looking to automate tests on different web pages. This will be used for (ideally) console-ish applications that run in the background and generate reports. We tried going with .NET and the WatiN library, but it was built on a Marshalled IE, and so it lacked many features that we hacked in with calls to unmanaged native code, but at the end of the day IE is not thread safe nor process safe, and many of the needed features could only be implemented by changing registry values and it was just terribly unflexible. Proxy support JavaScript support- we have to be able to parse the actual DOM after any javascript has executed (and hopefully an event is raised to handle any ajax calls) Ability to save entire contents of page including images FROM THE loaded page's CACHE to a separate location ability to clear cookies/cache, get the cookies/cache, etc. Ability to set headers and alter post data for any browser call And for the love of drogs, an API that isn't completely cryptic Languages acceptable C++, C#, Python, anything that can be a simple little console application that doesn't have a retarded syntax like Ruby. From my own research, and believe me I am terrible at google searches, I have heard good things about WebKit... would the Qt module QtWebKit handle all these features?

    Read the article

  • imagegrabwindow + https = black screen

    - by earls
    I'm doing something stupid and trying to capture thumbnails, snapshots, images of a html webpages. I'm doing something along the lines of: http://stackoverflow.com/questions/443837/how-might-i-obtain-a-snapshot-or-thumbnail-of-a-web-page-using-php DCOM + IE + PHP (imagegrabwindow; example from manual) Everything works PERFECT until I try to capture a HTTPS website... https://mail.google.com for example. imagegrabwindow produces a png, but it only shows the browser. the contents of the browser are black. If I log out of Google, I can capture the browser window and the contents thereof - the second I log in, the contents (not the browser frame) are black screen. Yes, I've increased the timeout (before closing the browser window). IE has clearly loaded the page, it just refuses to render for imagegrabwindow. I've been fighting this long enough I know it's either a permissions problem or a service needs to interact with the desktop. Does anyone have any clue what permissions need to be set or which service needs access? I assumed cryptographic services, but that's run as a network service and trying to change it to interact makes it shout and carry on. This is the last piece of the puzzle, I'd really like to get it working. Thank you!

    Read the article

< Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >