Search Results

Search found 21661 results on 867 pages for 'look alterno'.

Page 142/867 | < Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >

  • How to effectively use WorkbookBeforeClose event correctly?

    - by Ahmad
    On a daily basis, a person needs to check that specific workbooks have been correctly updated with Bloomberg and Reuters market data ie. all data has pulled through and that the 'numbers look correct'. In the past, people were not checking the 'numbers' which led to inaccurate uploads to other systems etc. The idea is that 'something' needs to be developed to prevent the use from closing/saving the workbook unless he/she has checked that the updates are correct/accurate. The numbers look correct action is purely an intuitive exercise, thus will not be coded in any way. The simple solution was to prompt users prior to closing the specific workbook to verify that the data has been checked. Using VSTO SE for Excel 2007, an Add-in was created which hooks into the WorkbookBeforeClose event which is initialised in the add-in ThisAddIn_Startup private void wb_BeforeClose(Xl.Workbook wb, ref bool cancel) { //.... snip ... if (list.Contains(wb.Name)) { DailogResult result = MessageBox.Show("some message", "sometitle", MessageBoxButtons.YesNo); if (result != DialogResult.Yes) { cancel = true; // i think this prevents the whole application from closing } } } I have found the following ThisApplication.WorkbookBeforeSave vs ThisWorkbook.Application.WorkbookBeforeSave which recommends that one should use the ThisApplication.WorkbookBeforeClose event which I think is what I am doing since will span all files opened. The issue I have with the approach is that assuming that I have several files open, some of which are in my list, the event prevents Excel from closing all files sequentially. It now requires each file to be closed individually. Am I using the event correctly and is this effective & efficient use of the event? Should I use the Application level event or document level event? Is there a way to prevent the above behaviour? Any other suggestions are welcomed VS 2005 with VSTO SE

    Read the article

  • how to implement intel's tbb::blocked_range2d in C++

    - by Hristo
    I'm trying to parallelize nested for loops with parellel_for() and the blocked_range2d from Intel's TBB using C++. The for loops look like this: for(int i = 0; i < N; ++i) { for(int j = 0; j < E[i]; ++j) { for(int k = 0; k < T; ++k) { score[k] += delta(i, trRating[k][i], exRating[j][i]); } } } ... and I am trying to do the following: class LoopBody { private: int *myscore; public: LoopBody(int *score) { myscore = score; } void operator()(const blocked_range2d<int> &r) const { for(int i = r.rows().begin(); i != r.rows().end(); ++i); for(int j = 0; j < E[i]; ++j) { for(int k = r.cols().begin(); k != r.cols().end(); ++k) { myscore[k] += foo(...); // uses i,j,k to look up indices in arrays } } } } }; void computeScores(int score[]) { parallel_for(blocked_range2d<int>(0, N, 0, T), LoopBody(score)); } ... but I am getting the following compile errors: error: identifier "i" is undefined for(int j = 0; j < E[i]; ++j) { ^ error: expected an identifier }; ^ I'm not really sure if I am doing this the right way, but any advice is appreciated. Also, this is my first time using Intel's TBB so I really don't know anything about it. Any ideas how make this work? Thanks, Hristo

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • PHP XML Strategy: Parsing DOM to fill "Bean"

    - by Mike
    I have a question concerning a good strategy on how to fill a data "bean" with data inside an xml file. The bean might look like this: class Person { var $id; var $forename = ""; var $surname = ""; var $bio = new Biography(); } class Biography { var $url = ""; var $id; } the xml subtree containing the info might look like this: <root> <!-- some more parent elements before node(s) of interest --> <person> <name pre="forename"> Foo </name> <name pre="surname"> Bar </name> <id> 1254 </id> <biography> <url> http://www.someurl.com </url> <id> 5488 </id> </biography> </person> </root> At the moment, I have one approach using DOMDocument. A method iterates over the entries and fills the bean by "remembering" the last node. I think thats not a good approach. What I have in mind is something like preconstructing some xpath expression(s) and then iterate over the subtrees/nodeLists. Return an array containing the beans as defined above eventually. However, it seems not to be possible reusing a subtree /DOMNode as DOMXPath constructor parameter. Has anyone of you encountered such a problem?

    Read the article

  • Showing recent post from a specific category

    - by kwek-kwek
    I wanted to show post from just recent post from a specific categories so far this is what I have but: <ul> <?php $number_recents_post = 5; $recent_posts = wp_get_recent_posts($number_recents_post); foreach($recent_posts as $post){ echo '<li><a href="' . get_permalink($post["ID"]) . '" title="Look '.$post["post_title"].'" >' . $post["post_title"].'</a> </li> '; } ?> </ul> I tried turning it into this but not working <ul> <?php $number_recents_post = 5; $recent_posts = wp_get_recent_posts($number_recents_post . 'cat=3,4,5'); foreach($recent_posts as $post){ echo '<li><a href="' . get_permalink($post["ID"]) . '" title="Look '.$post["post_title"].'" >' . $post["post_title"].'</a> </li> '; } ?> </ul> Please let me know what am I doing wrong....

    Read the article

  • Autodetect Presence of CSV Headers in a File

    - by banzaimonkey
    Short question: How do I automatically detect whether a CSV file has headers in the first row? Details: I've written a small CSV parsing engine that places the data into an object that I can access as (approximately) an in-memory database. The original code was written to parse third-party CSV with a predictable format, but I'd like to be able to use this code more generally. I'm trying to figure out a reliable way to automatically detect the presence of CSV headers, so the script can decide whether to use the first row of the CSV file as keys / column names or start parsing data immediately. Since all I need is a boolean test, I could easily specify an argument after inspecting the CSV file myself, but I'd rather not have to (go go automation). I imagine I'd have to parse the first 3 to ? rows of the CSV file and look for a pattern of some sort to compare against the headers. I'm having nightmares of three particularly bad cases in which: The headers include numeric data for some reason The first few rows (or large portions of the CSV) are null There headers and data look too similar to tell them apart If I can get a "best guess" and have the parser fail with an error or spit out a warning if it can't decide, that's OK. If this is something that's going to be tremendously expensive in terms of time or computation (and take more time than it's supposed to save me) I'll happily scrap the idea and go back to working on "important things". I'm working with PHP, but this strikes me as more of an algorithmic / computational question than something that's implementation-specific. If there's a simple algorithm I can use, great. If you can point me to some relevant theory / discussion, that'd be great, too. If there's a giant library that does natural language processing or 300 different kinds of parsing, I'm not interested.

    Read the article

  • Finding subsets that can be completed to tuples without duplicates

    - by Jules
    We have a collection of sets A_1,..,A_n. The goal is to find new sets for each of the old sets. newA_i = {a_i in A_i such that there exist (a_1,..,a_n) in (A1,..,An) with no a_k = a_j for all k and j} So in words this says that we remove all the elements from A_i that can't be used to form a tuple (a_1,..a_n) from the sets (A_1,..,A_n) such that the tuple doesn't contain duplicates. My question is how to compute these new sets quickly. If you just implement this definition by generating all possible v's this will take exponential time. Do you know a better algorithm? Edit: here's an example. Take A_1 = {1,2,3,4} A_2 = {2}. Now the new sets look like this: newA_1 = {1,3,4} newA_2 = {2} The 2 has been removed from A_1 because if you choose it the tuple will always be (2,2) which is invalid because it contains duplicates. On the other hand 1,3,4 are valid because (1,2), (3,2) and (4,2) are valid tuples. Another example: A_1 = {1,2,3} A_2 = {1,4,5} A_3 = {2,4,5} A_4 = {1,2,3} A_5 = {1,2,3} Now the new sets are: newA_1 = {1,2,3} newA_2 = {4,5} newA_3 = {4,5} newA_4 = {1,2,3} newA_5 = {1,2,3} The 1 and 2 are removed from sets 2 and 3 because if you choose the 1 or 2 from these sets you'll only have 2 values left for sets 1, 4 and 5, so you will always have duplicates in tuples that look like (_,1,_,_,_) or like (_,_,2,_,_).

    Read the article

  • Facade Design Patterns and Subclassing

    - by Code Sherpa
    Hi. I am using a facade design pattern for a C# program. The program basically looks like this... public class Api { #region Constants private const int version = 1; #endregion #region Private Data private XProfile _profile; private XMembership _membership; private XRoles _role; #endregion Private Data public Api() { _membership = new XMembership(); _profile = new XProfile(); _role = new XRoles(); } public int GetUserId(string name) { return _membership.GetIdByName(name); } } Now, as I would like subclass my methods into three categories: Role, Profile, and Member. This will be easier on the developers eye because both Profile and Membership expose a lot of methods that look similar (and a few by Role). For example, getting a user's ID would look like: int _id = Namespace.Api.Member.GetUserId("Henry222"); Can somebody "illustrate" how subclassing should work in this case to achieve the effect I am looking for? Thanks in advance.

    Read the article

  • How to propagate .java file change to .class under eclipse, tomcat & stripes

    - by BigBourin
    Hi, i'm new to java and i got some problems. i'm developping a web application using the framework stripes on tomcat 6.0. I'm working with eclipse EE on windows. i successfully managed to get the stripes example application (called Bugzooky) up and running on my tomcat server. I imported the .war file and stripes libs in Eclipse. Here is the stripes archive containing the examples and libs But now i'm trying to change the example source files to learn how does it work. but whatever the modification made to the source files "WebContent/WEB-INF/src/*.java", nothing change! even after restarting the server. i noticed that the classes are compiled into .class files in the "ImportedClasses" folder, and tomcat always use these files, they are never updated, and if i removed one of them, the application just don't start. it look like my source files don't exists! I also tried to build my webapp from scratch, but when i tried to use the features used in the example files (like SecurityFilter.java): import javax.servlet.Filter; import javax.servlet.FilterChain; import javax.servlet.FilterConfig; import ... It ends up with plenty of: the import javax.servlet.Filter cannot be resolved I checked the Librairies and it look like i'm using exactly the same as the example. It's probably something i didn't understood about java but i googled 100 times yesterday, and i can't find the solution (i probably didn't search the right place because i don't really understand my problem). I hope you'll be able to help me.

    Read the article

  • using JQuery and Prototype in the same page

    - by Don
    Hi, Several of my pages use both JQuery and Protoype. Since I upgraded to version 1.3 of JQuery this appears to be causing problems, because both libraries define a function named '$'. JQuery provides a function noConflict() which relinquishes control of $ to other libraries that may be using it. So it seems like I need to go through all my pages that look like this: <head> <script type="text/javascript" src="/obp/js/prototype.js"></script> <script type="text/javascript" src="/obp/js/jquery.js"></script> </head> and change them to look like this: <head> <script type="text/javascript" src="/obp/js/prototype.js"></script> <script type="text/javascript" src="/obp/js/jquery.js"></script> <script type="text/javascript"> jQuery.noConflict(); var $j = jQuery; </script> </head> I should then be able to use '$' for Prototype and '$j' (or 'jQuery') for JQuery. I'm not entirely happy about duplicating these 2 lines of code in every relevant page, and expect that at some point somebody is likely to forget to add them to a new page. I'd prefer to be able to do the following Create a file jquery-noconflict.js which "includes" jquery.js and the 2 lines of code shown above Import jquery-noconflict.js (instead of jquery.js) in all my JSP/HTML pages However, I'm not sure if it's possible to include one JS file in another, in the manner I've described? Of course an alternate solution is simply to add the 2 lines of code above to jquery.js directly, but if I do that I'll need to remember to do it every time I upgrade JQuery. Thanks in advance, Don

    Read the article

  • A problem with connected points and determining geometry figures based on points' location analysis

    - by StolePopov
    In school we have a really hard problem, and still no one from the students has solved it yet. Take a look at the picture below: http://d.imagehost.org/0422/mreza.gif That's a kind of a network of connected points, which doesn't end and each point has its own number representing it. Let say the numbers are like this: 1-23-456-78910-etc. etc.. (You can't see the number 5 or 8,9... on the picture but they are there and their position is obvious, the point in middle of 4 and 6 is 5 and so on). 1 is connected to 2 and 3, 2 is connected to 1,3,5 and 4 etc. The numbers 1-2-3 indicate they represent a triangle on the picture, but the numbers 1-4-6 do not because 4 is not directly connected with 6. Let's look at 2-3-4-5, that's a parallelogram (you know why), but 4-6-7-9 is NOT a parallelogram because the in this problem there's a rule which says all the sides must be equal for all the figures - triangles and parallelograms. Also there are hexagons, for ex. 4-5-7-9-13-12 is a hexagon - all sides must be equal here too. 12345 - that doesn't represent anything, so we ignore it. I think i explained the problem well. The actual problem which is given to us by using an input of numbers like above to determine if that's a triangle/parallelogram/hexagon(according to the described rules). For ex: 1 2 3 - triangle 11 13 24 26 -parallelogram 1 2 3 4 5 - nothing 11 23 13 25 - nothing 3 2 5 - triangle I was reading computational geometry in order to solve this, but i gave up quickly, nothing seems to help here. One friend told me this site so i decided to give it a try. If you have any ideas about how to solve this, please reply, you can use pseudo code or c++ whatever. Thank you very much.

    Read the article

  • Test-Driven Development Problem

    - by Zeck
    Hi guys, I'm newbie to Java EE 6 and i'm trying to develop very simple JAX-RS application. RESTfull web service working fine. However when I ran my test application, I got the following. What have I done wrong? Or am i forget any configuration? Of course i'm create a JNDI and i'm using Netbeans 6.8 IDE. In finally, thank you for any advise. My Entity: @Entity @Table(name = "BOOK") @NamedQueries({ @NamedQuery(name = "Book.findAll", query = "SELECT b FROM Book b"), @NamedQuery(name = "Book.findById", query = "SELECT b FROM Book b WHERE b.id = :id"), @NamedQuery(name = "Book.findByTitle", query = "SELECT b FROM Book b WHERE b.title = :title"), @NamedQuery(name = "Book.findByDescription", query = "SELECT b FROM Book b WHERE b.description = :description"), @NamedQuery(name = "Book.findByPrice", query = "SELECT b FROM Book b WHERE b.price = :price"), @NamedQuery(name = "Book.findByNumberofpage", query = "SELECT b FROM Book b WHERE b.numberofpage = :numberofpage")}) public class Book implements Serializable { private static final long serialVersionUID = 1L; @Id @Basic(optional = false) @Column(name = "ID") private Integer id; @Basic(optional = false) @Column(name = "TITLE") private String title; @Basic(optional = false) @Column(name = "DESCRIPTION") private String description; @Basic(optional = false) @Column(name = "PRICE") private double price; @Basic(optional = false) @Column(name = "NUMBEROFPAGE") private int numberofpage; public Book() { } public Book(Integer id) { this.id = id; } public Book(Integer id, String title, String description, double price, int numberofpage) { this.id = id; this.title = title; this.description = description; this.price = price; this.numberofpage = numberofpage; } public Integer getId() { return id; } public void setId(Integer id) { this.id = id; } public String getTitle() { return title; } public void setTitle(String title) { this.title = title; } public String getDescription() { return description; } public void setDescription(String description) { this.description = description; } public double getPrice() { return price; } public void setPrice(double price) { this.price = price; } public int getNumberofpage() { return numberofpage; } public void setNumberofpage(int numberofpage) { this.numberofpage = numberofpage; } @Override public int hashCode() { int hash = 0; hash += (id != null ? id.hashCode() : 0); return hash; } @Override public boolean equals(Object object) { // TODO: Warning - this method won't work in the case the id fields are not set if (!(object instanceof Book)) { return false; } Book other = (Book) object; if ((this.id == null && other.id != null) || (this.id != null && !this.id.equals(other.id))) { return false; } return true; } @Override public String toString() { return "com.entity.Book[id=" + id + "]"; } } My Junit test class: public class BookTest { private static EntityManager em; private static EntityManagerFactory emf; public BookTest() { } @BeforeClass public static void setUpClass() throws Exception { emf = Persistence.createEntityManagerFactory("E01R01PU"); em = emf.createEntityManager(); } @AfterClass public static void tearDownClass() throws Exception { em.close(); emf.close(); } @Test public void createBook() { Book book = new Book(); book.setId(1); book.setDescription("Mastering the Behavior Driven Development with Ruby on Rails"); book.setTitle("Mastering the BDD"); book.setPrice(25.9f); book.setNumberofpage(1029); em.persist(book); assertNotNull("ID should not be null", book.getId()); } } My persistence.xml jta-data-sourceBookstoreJNDI And exception is: May 7, 2009 11:10:37 AM org.hibernate.validator.util.Version INFO: Hibernate Validator bean-validator-3.0-JBoss-4.0.2 May 7, 2009 11:10:37 AM org.hibernate.validator.engine.resolver.DefaultTraversableResolver detectJPA INFO: Instantiated an instance of org.hibernate.validator.engine.resolver.JPATraversableResolver. [EL Info]: 2009-05-07 11:10:37.531--ServerSession(13671123)--EclipseLink, version: Eclipse Persistence Services - 2.0.0.v20091127-r5931 May 7, 2009 11:10:40 AM com.sun.enterprise.transaction.JavaEETransactionManagerSimplified initDelegates INFO: Using com.sun.enterprise.transaction.jts.JavaEETransactionManagerJTSDelegate as the delegate May 7, 2009 11:10:43 AM com.sun.enterprise.connectors.ActiveRAFactory createActiveResourceAdapter SEVERE: rardeployment.class_not_found May 7, 2009 11:10:43 AM com.sun.enterprise.connectors.ActiveRAFactory createActiveResourceAdapter SEVERE: com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR at com.sun.enterprise.connectors.ActiveRAFactory.createActiveResourceAdapter(ActiveRAFactory.java:104) at com.sun.enterprise.connectors.service.ResourceAdapterAdminServiceImpl.createActiveResourceAdapter(ResourceAdapterAdminServiceImpl.java:216) at com.sun.enterprise.connectors.ConnectorRuntime.createActiveResourceAdapter(ConnectorRuntime.java:352) at com.sun.enterprise.resource.naming.ConnectorObjectFactory.getObjectInstance(ConnectorObjectFactory.java:106) at javax.naming.spi.NamingManager.getObjectInstance(NamingManager.java:304) at com.sun.enterprise.naming.impl.SerialContext.getObjectInstance(SerialContext.java:472) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:437) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:569) at javax.naming.InitialContext.lookup(InitialContext.java:396) at org.eclipse.persistence.sessions.JNDIConnector.connect(JNDIConnector.java:110) at org.eclipse.persistence.sessions.JNDIConnector.connect(JNDIConnector.java:94) at org.eclipse.persistence.sessions.DatasourceLogin.connectToDatasource(DatasourceLogin.java:162) at org.eclipse.persistence.internal.sessions.DatabaseSessionImpl.loginAndDetectDatasource(DatabaseSessionImpl.java:584) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryProvider.login(EntityManagerFactoryProvider.java:228) at org.eclipse.persistence.internal.jpa.EntityManagerSetupImpl.deploy(EntityManagerSetupImpl.java:368) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.getServerSession(EntityManagerFactoryImpl.java:151) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.createEntityManagerImpl(EntityManagerFactoryImpl.java:207) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.createEntityManager(EntityManagerFactoryImpl.java:195) at com.entity.BookTest.setUpClass(BookTest.java:31) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.RunBefores.evaluate(RunBefores.java:27) at org.junit.internal.runners.statements.RunAfters.evaluate(RunAfters.java:31) at org.junit.runners.ParentRunner.run(ParentRunner.java:220) at junit.framework.JUnit4TestAdapter.run(JUnit4TestAdapter.java:39) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.run(JUnitTestRunner.java:515) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.launch(JUnitTestRunner.java:1031) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.main(JUnitTestRunner.java:888) Caused by: java.lang.ClassNotFoundException: com.sun.gjc.spi.ResourceAdapter at java.net.URLClassLoader$1.run(URLClassLoader.java:200) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:188) at java.lang.ClassLoader.loadClass(ClassLoader.java:306) at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:276) at java.lang.ClassLoader.loadClass(ClassLoader.java:251) at com.sun.enterprise.connectors.ActiveRAFactory.createActiveResourceAdapter(ActiveRAFactory.java:96) ... 32 more [EL Severe]: 2009-05-07 11:10:43.937--ServerSession(13671123)--Local Exception Stack: Exception [EclipseLink-7060] (Eclipse Persistence Services - 2.0.0.v20091127-r5931): org.eclipse.persistence.exceptions.ValidationException Exception Description: Cannot acquire data source [BookstoreJNDI]. Internal Exception: javax.naming.NamingException: Lookup failed for 'BookstoreJNDI' in SerialContext ,orb'sInitialHost=localhost,orb'sInitialPort=3700 [Root exception is javax.naming.NamingException: Failed to look up ConnectorDescriptor from JNDI [Root exception is com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR]] at org.eclipse.persistence.exceptions.ValidationException.cannotAcquireDataSource(ValidationException.java:451) at org.eclipse.persistence.sessions.JNDIConnector.connect(JNDIConnector.java:116) at org.eclipse.persistence.sessions.JNDIConnector.connect(JNDIConnector.java:94) at org.eclipse.persistence.sessions.DatasourceLogin.connectToDatasource(DatasourceLogin.java:162) at org.eclipse.persistence.internal.sessions.DatabaseSessionImpl.loginAndDetectDatasource(DatabaseSessionImpl.java:584) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryProvider.login(EntityManagerFactoryProvider.java:228) at org.eclipse.persistence.internal.jpa.EntityManagerSetupImpl.deploy(EntityManagerSetupImpl.java:368) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.getServerSession(EntityManagerFactoryImpl.java:151) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.createEntityManagerImpl(EntityManagerFactoryImpl.java:207) at org.eclipse.persistence.internal.jpa.EntityManagerFactoryImpl.createEntityManager(EntityManagerFactoryImpl.java:195) at com.entity.BookTest.setUpClass(BookTest.java:31) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.RunBefores.evaluate(RunBefores.java:27) at org.junit.internal.runners.statements.RunAfters.evaluate(RunAfters.java:31) at org.junit.runners.ParentRunner.run(ParentRunner.java:220) at junit.framework.JUnit4TestAdapter.run(JUnit4TestAdapter.java:39) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.run(JUnitTestRunner.java:515) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.launch(JUnitTestRunner.java:1031) at org.apache.tools.ant.taskdefs.optional.junit.JUnitTestRunner.main(JUnitTestRunner.java:888) Caused by: javax.naming.NamingException: Lookup failed for 'BookstoreJNDI' in SerialContext ,orb'sInitialHost=localhost,orb'sInitialPort=3700 [Root exception is javax.naming.NamingException: Failed to look up ConnectorDescriptor from JNDI [Root exception is com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR]] at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:442) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:569) at javax.naming.InitialContext.lookup(InitialContext.java:396) at org.eclipse.persistence.sessions.JNDIConnector.connect(JNDIConnector.java:110) ... 23 more Caused by: javax.naming.NamingException: Failed to look up ConnectorDescriptor from JNDI [Root exception is com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR] at com.sun.enterprise.resource.naming.ConnectorObjectFactory.getObjectInstance(ConnectorObjectFactory.java:109) at javax.naming.spi.NamingManager.getObjectInstance(NamingManager.java:304) at com.sun.enterprise.naming.impl.SerialContext.getObjectInstance(SerialContext.java:472) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:437) ... 26 more Caused by: com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR at com.sun.enterprise.connectors.ActiveRAFactory.createActiveResourceAdapter(ActiveRAFactory.java:104) at com.sun.enterprise.connectors.service.ResourceAdapterAdminServiceImpl.createActiveResourceAdapter(ResourceAdapterAdminServiceImpl.java:216) at com.sun.enterprise.connectors.ConnectorRuntime.createActiveResourceAdapter(ConnectorRuntime.java:352) at com.sun.enterprise.resource.naming.ConnectorObjectFactory.getObjectInstance(ConnectorObjectFactory.java:106) ... 29 more Caused by: java.lang.ClassNotFoundException: com.sun.gjc.spi.ResourceAdapter at java.net.URLClassLoader$1.run(URLClassLoader.java:200) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:188) at java.lang.ClassLoader.loadClass(ClassLoader.java:306) at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:276) at java.lang.ClassLoader.loadClass(ClassLoader.java:251) at com.sun.enterprise.connectors.ActiveRAFactory.createActiveResourceAdapter(ActiveRAFactory.java:96) ... 32 more Exception Description: Cannot acquire data source [BookstoreJNDI]. Internal Exception: javax.naming.NamingException: Lookup failed for 'BookstoreJNDI' in SerialContext ,orb'sInitialHost=localhost,orb'sInitialPort=3700 [Root exception is javax.naming.NamingException: Failed to look up ConnectorDescriptor from JNDI [Root exception is com.sun.appserv.connectors.internal.api.ConnectorRuntimeException: Error in creating active RAR]])

    Read the article

  • how to know location of return address on stack c/c++

    - by Dr Deo
    i have been reading about a function that can overwrite its return address. void foo(const char* input) { char buf[10]; //What? No extra arguments supplied to printf? //It's a cheap trick to view the stack 8-) //We'll see this trick again when we look at format strings. printf("My stack looks like:\n%p\n%p\n%p\n%p\n%p\n% p\n\n"); //%p ie expect pointers //Pass the user input straight to secure code public enemy #1. strcpy(buf, input); printf("%s\n", buf); printf("Now the stack looks like:\n%p\n%p\n%p\n%p\n%p\n%p\n\n"); } It was sugggested that this is how the stack would look like Address of foo = 00401000 My stack looks like: 00000000 00000000 7FFDF000 0012FF80 0040108A <-- We want to overwrite the return address for foo. 00410EDE Question: -. Why did the author arbitrarily choose the second last value as the return address of foo()? -. Are values added to the stack from the bottom or from the top? apart from the function return address, what are the other values i apparently see on the stack? ie why isn't it filled with zeros Thanks.

    Read the article

  • JPA - Performance with using multiple entity manager

    - by Nguyen Tuan Linh
    My situation is: The code is not mine I have two kinds of database: one is Dad, one is Son. In Dad, I have a table to store JNDI name. I will look up Dad using JNDI, create entity manager, and retrieve this table. From these retrieved JNDI names, I will create multiple entity managers using multiple Son databases. The problem is: Son have thousands of entities. It takes each Son database around 10 minutes to load all entities. If there is 4 Son databases, it will be 40 minutes. My question: Is there any way to load all entities and use them for all entity manager? Please look at the code below For each Son JNDI: Map<String, String> puSonProperties = new HashMap<String, String>(); puSonProperties.put("javax.persistence.jtaDataSource", sonJndi); EntityManagerFactory emf = Persistence.createEntityManagerFactory("PUSon", puSonProperties); PUSon - All of them use the same persistence unit log.info("Verify entity manager for son: {0} - {1}", sonCode, emSon.find(Son_configuration.class, 0) != null ? "ok" : "failed!"); This is the actual code where the loading of all entities begins. 10 mins.

    Read the article

  • Django: Named URLs / Same Template, Different Named URL

    - by TheLizardKing
    I have a webapp that lists all of my artists, albums and songs when the appropriate link is clicked. I make extensive use of generic views (object_list/detail) and named urls but I am coming across an annoyance. I have three templates that pretty much output the exact same html that look just like this: {% extends "base.html" %} {% block content %} <div id="content"> <ul id="starts-with"> {% for starts_with in starts_with_list %} <li><a href="{% url song_list_x starts_with %}">{{ starts_with|upper }}</a></li> {% endfor %} </ul> <ul> {% for song in songs_list %} <li>{{ song.title }}</li> {% endfor %} </ul> </div> {% endblock content %} My artist and album template look pretty much the same and I'd like to combine the three template's into one. The fact that my variables start with song can easily be changed to the default obj. It's my <ul id="starts-with"> named url I don't know how to correct. Obviously I want it to link to a specific album/artist/song using the named urls in my urls.py but I don't know how to make it context aware. Any suggestions? urlpatterns = patterns('tlkmusic.apps.tlkmusic_base.views', # (r'^$', index), url(r'^artists/$', artist_list, name='artist_list'), url(r'^artists/(?P<starts_with>\w)/$', artist_list, name='artist_list_x'), url(r'^artist/(?P<artist_id>\d+)/$', artist_detail, name='artist_detail'), url(r'^albums/$', album_list, name='album_list'), url(r'^albums/(?P<starts_with>\w)/$', album_list, name='album_list_x'), url(r'^songs/$', song_list, name='song_list'), url(r'^songs/(?P<starts_with>\w)/$', song_list, name='song_list_x'), )

    Read the article

  • Cross-browser padding/margins

    - by Lucifer
    Hi All, I was wondering if you could give me some helpful hints on how to correct this issue? I have a main menu on my site, the code for it is as follows: li:hover { background-color: #222222; padding-top: 8px; padding-bottom: 9px; } And here's a demo of what it actually looks like: The problem is that when I hover over a menu option (li), the background appears, but it overflows to the outside of the menu's background, and makes it look really dodgy/crap/cheap/yuck! Note that (obviously) when I change the padding to make it display correctly in these browsers, it appears too small in height in IE! So I'm screwed either way. How can I make little imperfections like this look the same in all browsers? Update: HTML (The menu): <ul class="menu"> <li class="currentPage" href="index.php"><a>Home</a></li> <li><a href="services.php">Services</a></li> <li><a href="support.php">Support</a></li> <li><a href="contact.php">Contact Us</a></li> <li><a href="myaccount/" class="myaccount">My Account</a></li> </ul> The CSS: .menu { margin-top: 5px; margin-right: 5px; width: 345px; float: right; } li { font-size: 9pt; color: whitesmoke; padding-left: 6px; padding-right: 8px; display: inline; list-style: none; } li:hover { background-color: #222222; padding-top: 8px; padding-bottom: 9px; }

    Read the article

  • Is it possible to update old database from dbml file ? (C#, .Net 4, Linq, SQL Server)

    - by Emil
    Hi all, I began recently a new job, a very interesting project (C#,.Net 4, Linq, VS 2010 and SQL Server). And immediately I got a very exciting challenge: I must implement either a new tool or integrate the logic when program start, or whatever, but what must happen is the following: the customers have previous application and database (full with their specific data). Now a new version is ready and the customer gets the update. In the mean time we made some modification on DB (new table, columns, maybe an old column deleted, or whatever). I’m pretty new in Linq and also SQL databases and my first solution can be: I check the applications/databases version and implement all the changes step by step comparing all tables, columns, keys, constrains, etc. (all this new information I have in my dbml and the old I asked from the existing DB). And I’ll do this each time the version changed. But somehow I feel, this is NOT a smart solution so I look for a general solution of this problem. Is there a way to update customers DB from the dbml file? To create a new one is not a problem (CreateDatabase with DataContext), is there any update/alter database methods? I guess I’m not the only one who search for such a solution (I found nothing in internet – or I looked for bad keywords). How did you solve this problem? I look also for an external tool, but first for a solution with C#, Linq or something similar. For any idea thank you in advance! Best regards, Emil

    Read the article

  • Convert array to CSV/TSV-formated string in Python.

    - by dreeves
    Python provides csv.DictWriter for outputting CSV to a file. What is the simplest way to output CSV to a string or to stdout? For example, given a 2D array like this: [["a b c", "1,2,3"], ["i \"comma-heart\" you", "i \",heart\" u, too"]] return the following string: "a b c, \"1, 2, 3\"\n\"i \"\"comma-heart\"\" you\", \"i \"\",heart\"\" u, too\"" which when printed would look like this: a b c, "1,2,3" "i ""heart"" you", "i "",heart"" u, too" (I'm taking csv.DictWriter's word for it that that is in fact the canonical way to output that array as CSV. Excel does parse it correctly that way, though Mathematica does not. From a quick look at the wikipedia page on CSV it seems Mathematica is wrong.) One way would be to write to a temp file with csv.DictWriter and read it back with csv.DictReader. What's a better way? TSV instead of CSV It also occurs to me that I'm not wedded to CSV. TSV would make a lot of the headaches with delimiters and quotes go away: just replace tabs with spaces in the entries of the 2D array and then just intersperse tabs and newlines and you're done. Let's include solutions for both TSV and CSV in the answers to make this as useful as possible for future searchers.

    Read the article

  • storing/retrieving data for graph with long continuous stretches

    - by james
    i have a large 2-dimensional data set which i would like to graph. the graph is displayed in a browser and the data is retrieved via ajax. long stretches of this graph will be continuous - e.g., for x=0 through x=1000, y=9, then for x=1001 through x=1100, y=80, etc. the approach i'm considering is to send (from the server) and store (in the browser) only the points where the data changes. so for the example above, i would say data[0] = 9, then data[1001] = 80. then given x=999 for example, retrieving data[999] would actually look up data[0]. the problem that arises is finding a dictionary-like data structure which behaves like this. the approach i'm considering is to store the data in a traditional dictionary object, then also maintain a sorted array of key for that object. when given x=999, it would look at the mid-point of this array, determine whether the nearest lower key is left or right of that midpoint, then repeat with the correct subsection, etc.. does anyone have thoughts on this problem/approach?

    Read the article

  • array of structs in C

    - by Hristo
    I'm trying to create an array of structs and also a pointer to that array. I don't know how large the array is going to be, so it should be dynamic. My struct would look something like this: typedef struct _stats_t { int hours[24]; int numPostsInHour; int days[7]; int numPostsInDay; int weeks[20]; int numPostsInWeek; int totNumLinesInPosts; int numPostsAnalyzed; } stats_t; ... and I need to have multiple of these structs for each file (unknown amount) that I will analyze. I'm not sure how to do this. I don't like the following approach because of the limit of the size of the array: # define MAX 10 typedef struct _stats_t { int hours[24]; int numPostsInHour; int days[7]; int numPostsInDay; int weeks[20]; int numPostsInWeek; int totNumLinesInPosts; int numPostsAnalyzed; } stats_t[MAX]; So how would I create this array? Also, would a pointer to this array would look something this? stats_t stats[]; stats_t *statsPtr = &stats[0]; Thanks, Hristo

    Read the article

  • jQuery ui checkboxes drive me crazy

    - by Luca Belluco
    Hello, I'm using a form with checkboxes from jQuery UI and I'm having some problems with them : here is my code : php <input type="checkbox" id="check'. $empl->getAttr('id') .'" class="intervenants" /><label for="check'. $empl->getAttr('id') .'">'.$empl->getAttr('nom').'</label>'; javascript $('.intervenants').each(function() { $(this).attr('checked',false); }); for(i = 0; i < data.list_empl.length; i++) { $('#check'+data.list_empl[i].id).attr('checked',true); } I want, as you can see, uncheck all the checkboxes, then I look in my array and try to check only the checkboxes existing in my array. The problem is that it doesn't work... I don't know what doesn't work, I've tried to put alert, to look in html but it looks like it's totall incoherent. I would really appreciate your help, thanks in advance, Luca.

    Read the article

  • How can I find out why a website looks different when I upload it to IIS ?

    - by UXdesigner
    Good day... I've been working on a website project, that requires to be on a Microsoft IIS Web Server. It is HTML, pure HTML, with really nice CSS, web-standards, etc. I open this website using in my computer, using Firefox, IE 8.0, Safari, Google Chrome and it looks fine everywhere. But as I upload it to the Microsoft IIS server, it changes a few things. for example: the main menu, which is a navigation bar that has dropdowns, seems to change it's line-height for some reason, and it is bigger. Some <h3> or <h2> Alignment seems wrong as well... And the lines that are supposed to surround the photographs in the website (like a frame - dotted line) won't appear. But all the rest of the CSS is loading perfectly fine. I don't think it's a path problem as everything is loading fine. But this is making me look bad and it is very important to have this done as soon as possible. Can someone give me good suggestions on what to look at ? The IIS permissions seem fine. I'm not a big Microsoft fan...but I have to develop the website there. Also, I uploaded the site to my apache server and it worked wonders. I wish I could change the policies in this corporation, but I can't. Thank you so much for your kind help.

    Read the article

  • loaded resources looks ugly

    - by Xaver
    I have the TreeView class using in my project. I use icons for it.First i load icons so: ImageList^ il = gcnew ImageList(); il->Images->Add(Image::FromFile("DISK.ico")); il->Images->Add(Image::FromFile("FILE.ico")); il->Images->Add(Image::FromFile("FOLDER.ico")); treeView1->ImageList = il; All was good. But i dont like that if i delete my icons from directory of project. there is error in my project. I decide to add icons in .resx file. Now icons loading look so: ImageList^ il = gcnew ImageList(); Resources::ResourceManager^ resourceManager = gcnew Resources::ResourceManager ("FilesSaver.Form1", GetType()->Assembly); Object^ disk = resourceManager->GetObject("DISK"); il->Images->Add(reinterpret_cast<Image^>(disk)); Object^ file = resourceManager->GetObject("FILE"); il->Images->Add(reinterpret_cast<Image^>(file)); Object^ folder = resourceManager->GetObject("FOLDER"); il->Images->Add(reinterpret_cast<Image^>(folder)); treeView1->ImageList = il; And why icons in the TreeView looks ugly (they look lighter and have a big black border). Why did this happen?

    Read the article

  • JPA @ManyToMany on only one side?

    - by Ethan Leroy
    I am trying to refresh the @ManyToMany relation but it gets cleared instead... My Project class looks like this: @Entity public class Project { ... @ManyToMany(cascade = CascadeType.ALL, fetch = FetchType.EAGER) @JoinTable(name = "PROJECT_USER", joinColumns = @JoinColumn(name = "PROJECT_ID", referencedColumnName = "ID"), inverseJoinColumns = @JoinColumn(name = "USER_ID", referencedColumnName = "ID")) private Collection<User> users; ... } But I don't have - and I don't want - the collection of Projects in the User entity. When I look at the generated database tables, they look good. They contain all columns and constraints (primary/foreign keys). But when I persist a Project that has a list of Users (and the users are still in the database), the mapping table doesn't get updated gets updated but when I refresh the project afterwards, the list of Users is cleared. For better understanding: Project project = ...; // new project with users that are available in the db System.out.println(project getUsers().size()); // prints 5 em.persist(project); System.out.println(project getUsers().size()); // prints 5 em.refresh(project); System.out.println(project getUsers().size()); // prints 0 So, how can I refresh the relation between User and Project?

    Read the article

  • How to improve this piece of code

    - by user303518
    Can anyone help me on this. It may be very frustrating for you all. But I want you guys to take a moment to look at the code below and please tell me all the things that are wrong in the below piece of code. You can copy it into your visual studio to analyze this better. You don’t have to make this code compile. My task is to get the following things: Most obvious mistakes with this code All the things that are wrong/bad practices with the code below Modify/Write an optimized version of this code. Keep in mind, the code DOES NOT need to compile. Reduce the number of lines of code You should NEVER try to implement something like below: public List<ValidationErrorDto> ProcessEQuote(string eQuoteXml, long programUniversalID) { // Get Program Info. DataTable programs = GetAllPrograms(); DataRow[] programRows = programs.Select(string.Format("ProgramUniversalID = {0}", programUniversalID)); long programID = (long)programRows[0]["ProgramID"]; string programName = (string)programRows[0]["Description"]; // Get Config file values. string fromEmail = ConfigurationManager.AppSettings["eQuotesFromEmail"]; string technicalSupportPhone = ConfigurationManager.AppSettings["TechnicalSupportPhone"]; string fromEmailDisplayName = string.IsNullOrEmpty(ConfigurationManager.AppSettings["eQuotesFromDisplayName"]) ? null : string.Format(ConfigurationManager.AppSettings["eQuotesFromDisplayName"], programName); string itEmail = !string.IsNullOrEmpty(ConfigurationManager.AppSettings["ITEmail"]) ? ConfigurationManager.AppSettings["ITEmail"] : string.Empty; string itName = !string.IsNullOrEmpty(ConfigurationManager.AppSettings["ITName"]) ? ConfigurationManager.AppSettings["ITName"] : "IT"; try { List<ValidationErrorDto> allValidationErrors = new List<ValidationErrorDto>(); List<ValidationErrorDto> validationErrors = new List<ValidationErrorDto>(); if (validationErrors.Count == 0) { validationErrors.AddRange(ValidateEQuoteXmlAgainstSchema(eQuoteXml)); if (validationErrors.Count == 0) { XmlDocument eQuoteXmlDoc = new XmlDocument(); eQuoteXmlDoc.LoadXml(eQuoteXml); XmlElement rootElement = eQuoteXmlDoc.DocumentElement; XmlNodeList quotesList = rootElement.SelectNodes("Quote"); foreach (XmlNode node in quotesList) { // Each node should be a quote node but to be safe, check if (node.Name == "Quote") { string groupName = node.SelectSingleNode("Group/GroupName").InnerText; string groupCity = node.SelectSingleNode("Group/GroupCity").InnerText; string groupPostalCode = node.SelectSingleNode("Group/GroupZipCode").InnerText; string groupSicCode = node.SelectSingleNode("Group/GroupSIC").InnerText; string generalAgencyLicenseNumber = node.SelectSingleNode("Group/GALicenseNbr").InnerText; string brokerName = node.SelectSingleNode("Group/BrokerName").InnerText; string deliverToEmailAddress = node.SelectSingleNode("Group/ReturnEmailAddress").InnerText; string brokerEmail = node.SelectSingleNode("Group/BrokerEmail").InnerText; string groupEligibleEmployeeCountString = node.SelectSingleNode("Group/GroupNbrEmployees").InnerText; string quoteEffectiveDateString = node.SelectSingleNode("Group/QuoteEffectiveDate").InnerText; string salesRepName = node.SelectSingleNode("Group/SalesRepName").InnerText; string salesRepPhone = node.SelectSingleNode("Group/SalesRepPhone").InnerText; string salesRepEmail = node.SelectSingleNode("Group/SalesRepEmail").InnerText; string brokerLicenseNumber = node.SelectSingleNode("Group/BrokerLicenseNbr").InnerText; DateTime? quoteEffectiveDate = null; int eligibleEmployeeCount = int.Parse(groupEligibleEmployeeCountString); DateTime quoteEffectiveDateOut; if (!DateTime.TryParse(quoteEffectiveDateString, out quoteEffectiveDateOut)) validationErrors.Add(ValidationHelper.CreateValidationError((long)QuoteField.EffectiveDate, "Quote Effective Date", ValidationErrorDto.ValueOutOfRange, false, ValidationHelper.CreateValidationContext(Entity.QuoteDetail, "Quote"))); else quoteEffectiveDate = quoteEffectiveDateOut; Dictionary<string, string> replacementCodeValues = new Dictionary<string, string>(); if (string.IsNullOrEmpty(Resources.ParameterMessageKeys.ResourceManager.GetString("GroupName"))) throw new InvalidOperationException("GroupName key is not configured"); replacementCodeValues.Add(Resources.ParameterMessageKeys.GroupName, groupName); replacementCodeValues.Add(Resources.ParameterMessageKeys.ProgramName, programName); replacementCodeValues.Add(Resources.ParameterMessageKeys.SalesRepName, salesRepName); replacementCodeValues.Add(Resources.ParameterMessageKeys.SalesRepPhone, salesRepPhone); replacementCodeValues.Add(Resources.ParameterMessageKeys.SalesRepEmail, salesRepEmail); replacementCodeValues.Add(Resources.ParameterMessageKeys.TechnicalSupportPhone, technicalSupportPhone); replacementCodeValues.Add(Resources.ParameterMessageKeys.EligibleEmployeCount, eligibleEmployeeCount.ToString()); // Retrieve the CityID and StateID long? cityID = null; long? stateID = null; DataSet citiesAndStates = Addresses.GetCitiesAndStatesFromPostalCode(groupPostalCode); DataTable cities = citiesAndStates.Tables[0]; DataTable states = citiesAndStates.Tables[1]; DataRow[] cityRows = cities.Select(string.Format("Name = '{0}'", groupCity)); if (cityRows.Length > 0) { cityID = (long)cityRows[0]["CityID"]; DataRow[] stateRows = states.Select(string.Format("CityID = {0}", cityID)); if (stateRows.Length > 0) stateID = (long)stateRows[0]["StateID"]; } // If the StateID does not exist, then we cannot get the GeneralAgency, so set a validation error and do not contine. // Else, Continue and look for an General Agency. If a GA was found, look for or create a Broker. Then look for or create a Prospect Group // Then using the info, create a quote. if (!stateID.HasValue) validationErrors.Add(ValidationHelper.CreateValidationError((long)ProspectGroupField.State, "Prospect Group State", ValidationErrorDto.RequiredFieldMissing, false, ValidationHelper.CreateValidationContext(Entity.ProspectGroup, "Prospect Group"))); bool brokerValidationError = false; SalesRepDto salesRep = GetSalesRepByEmail(salesRepEmail, ref validationErrors); if (salesRep == null) { string exceptionMessage = "Sales Rep Not found in Opportunity System. Please make sure Sales Rep is present in the system by adding the sales rep in AWP SR Add Screen." + Environment.NewLine; exceptionMessage = exceptionMessage + " Sales Rep Name: " + salesRepName + Environment.NewLine; exceptionMessage = exceptionMessage + " Sales Rep Email: " + salesRepEmail + Environment.NewLine; exceptionMessage = exceptionMessage + " Module : E-Quote Service" + Environment.NewLine; throw new Exception(exceptionMessage); } if (validationErrors.Count == 0) { // Note that StateID and EffectiveDate should be valid at this point. If it weren't there would be validation errors. // Find General Agency long? generalAgencyID; validationErrors.AddRange(GetEQuoteGeneralAgency(generalAgencyLicenseNumber, stateID.Value, out generalAgencyID)); // If GA was found, check for Broker. if (validationErrors.Count == 0 && generalAgencyID.HasValue) { Dictionary<string, string> brokerNameParts = ContactHelper.GetNamePartsFromFullName(brokerName); long? brokerID; validationErrors.AddRange(CreateEQuoteBroker(brokerNameParts["FirstName"], brokerNameParts["LastName"], brokerEmail, brokerLicenseNumber, stateID.Value, generalAgencyID.Value, salesRep, programID, out brokerID)); // If Broker was found but had validation errors if (validationErrors.Count > 0) { DeliverEmailMessage(programID, quoteEffectiveDate.Value, fromEmail, fromEmailDisplayName, itEmail, DocumentType.EQuoteBrokerValidationFailureMessageEmail, replacementCodeValues); brokerValidationError = true; } // If Broker was found, check for Prospect Group if (validationErrors.Count == 0 && brokerID.HasValue) { long? prospectGroupID; validationErrors.AddRange(CreateEQuoteProspectGroup(groupName, cityID, stateID, groupPostalCode, groupSicCode, brokerID.Value, out prospectGroupID)); if (validationErrors.Count == 0 && prospectGroupID.HasValue) { if (validationErrors.Count == 0) { long? quoteID; validationErrors.AddRange(CreateEQuote(programID, prospectGroupID.Value, generalAgencyID.Value, quoteEffectiveDate.Value, eligibleEmployeeCount, deliverToEmailAddress, node.SelectNodes("Employees/Employee"), deliverToEmailAddress, out quoteID)); if (validationErrors.Count == 0 && quoteID.HasValue) { QuoteFromServiceDto quoteFromService = GetQuoteByQuoteID(quoteID.Value); // Generate Pre-Message replacementCodeValues.Add(Resources.ParameterMessageKeys.QuoteNumber, string.Format("{0}.{1}", quoteFromService.QuoteNumber, quoteFromService.QuoteVersion)); replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, brokerName); replacementCodeValues.Add(Resources.ParameterMessageKeys.LicenseNumbers, brokerLicenseNumber); DeliverEmailMessage(programID, quoteEffectiveDate.Value, fromEmail, fromEmailDisplayName, deliverToEmailAddress, DocumentType.EQuotePreMessageEmail, replacementCodeValues); bool quoteGenerated = false; try { quoteGenerated = GenerateAndDeliverInitialQuote(quoteID.Value); } catch (Exception exception) { TraceLogger.LogException(exception, LoggingCategory); if (replacementCodeValues.ContainsKey(Resources.ParameterMessageKeys.Name)) replacementCodeValues[Resources.ParameterMessageKeys.Name] = itName; else replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, itName); if (replacementCodeValues.ContainsKey(Resources.ParameterMessageKeys.Errors)) replacementCodeValues[Resources.ParameterMessageKeys.Errors] = string.Format("Errors:\r\n:{0}", exception); else replacementCodeValues.Add(Resources.ParameterMessageKeys.Errors, string.Format("Errors:\r\n:{0}", exception)); DeliverEmailMessage(programID, quoteEffectiveDate.Value, fromEmail, fromEmailDisplayName, itEmail, DocumentType.EQuoteSystemFailureMessageEmail, replacementCodeValues); } if (!quoteGenerated) { // Generate System Failure Message if (replacementCodeValues.ContainsKey(Resources.ParameterMessageKeys.Name)) replacementCodeValues[Resources.ParameterMessageKeys.Name] = brokerName; else replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, brokerName); if (replacementCodeValues.ContainsKey(Resources.ParameterMessageKeys.Errors)) replacementCodeValues[Resources.ParameterMessageKeys.Errors] = string.Empty; else replacementCodeValues.Add(Resources.ParameterMessageKeys.Errors, string.Empty); DeliverEmailMessage(programID, quoteEffectiveDate.Value, fromEmail, fromEmailDisplayName, itEmail, DocumentType.EQuoteSystemFailureMessageEmail, replacementCodeValues); } } } } } } } //if (validationErrors.Count > 0) // Per spec, if Broker Validation returned an error we already sent an email, don't send another generic one if (validationErrors.Count > 0 && (!brokerValidationError)) { StringBuilder errorString = new StringBuilder(); foreach (ValidationErrorDto validationError in validationErrors) errorString = errorString.AppendLine(string.Format(" - {0}", ValidationHelper.GetValidationErrorReason(validationError, true))); replacementCodeValues.Add(Resources.ParameterMessageKeys.Errors, errorString.ToString()); if (replacementCodeValues.ContainsKey(Resources.ParameterMessageKeys.Name)) replacementCodeValues[Resources.ParameterMessageKeys.Name] = brokerName; else replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, brokerName); // HACK: If there is no effective date, then use Today's date. Do we care about the effecitve dat on validation message? if (quoteEffectiveDate.HasValue) DeliverEmailMessage(programID, quoteEffectiveDate.Value, fromEmail, fromEmailDisplayName, itEmail, DocumentType.EQuoteValidationFailureMessageEmail, replacementCodeValues); else DeliverEmailMessage(programID, DateTime.Now, fromEmail, fromEmailDisplayName, itEmail, DocumentType.EQuoteValidationFailureMessageEmail, replacementCodeValues); } allValidationErrors.AddRange(validationErrors); validationErrors.Clear(); } } } else { // Use todays date as the effective date. Dictionary<string, string> replacementCodeValues = new Dictionary<string, string>(); StringBuilder errorString = new StringBuilder(); foreach (ValidationErrorDto validationError in validationErrors) errorString = errorString.AppendLine(string.Format(" - {0}", ValidationHelper.GetValidationErrorReason(validationError, true))); replacementCodeValues.Add(Resources.ParameterMessageKeys.Errors, string.Format("The following validation errors occurred: \r\n{0}", errorString)); replacementCodeValues.Add(Resources.ParameterMessageKeys.ProgramName, programName); replacementCodeValues.Add(Resources.ParameterMessageKeys.GroupName, "Group"); replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, itName); DeliverEmailMessage(programID, DateTime.Now, fromEmail, null, itEmail, DocumentType.EQuoteSystemFailureMessageEmail, replacementCodeValues); allValidationErrors.AddRange(validationErrors); validationErrors.Clear(); } } return allValidationErrors; } catch (Exception exception) { TraceLogger.LogException(exception, LoggingCategory); // Use todays date as the effective date. Dictionary<string, string> replacementCodeValues = new Dictionary<string, string>(); replacementCodeValues.Add(Resources.ParameterMessageKeys.ProgramName, programName); replacementCodeValues.Add(Resources.ParameterMessageKeys.GroupName, "Group"); replacementCodeValues.Add(Resources.ParameterMessageKeys.Name, itName); replacementCodeValues.Add(Resources.ParameterMessageKeys.Errors, string.Format("Errors:\r\n:{0}", exception)); DeliverEmailMessage(programID, DateTime.Now, fromEmail, null, itEmail, DocumentType.EQuoteSystemFailureMessageEmail, replacementCodeValues); throw new FaultException(exception.ToString()); } }

    Read the article

< Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >