Search Results

Search found 14154 results on 567 pages for 'spooky note'.

Page 144/567 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • set the focus of a popup window everytime

    - by hunt
    I have two pages one.html and two.html i am opening a new window using following code //here popup is a global variable popup=window.open('two.html','two'); for the first time a popup window open successfully and get the focus but if i try to open it again without closing already opened popup then two.html is not getting focus for the second time. note: i have set popup window's name as 'two'

    Read the article

  • jQuery, Animate opacity to 1 then remove the opacity property to make it better looking on IE

    - by Emily
    Hi everyone, I tried the jQuery fadeIn animation in all browsers and it work good, but not that much on IE. the Alpha png images are so creepy after appending the CSS opacity, but i have an idea and i don't know how to implement it using jQuery. The idea is to fadeIn the element and when the animation is finished it will automatically remove the opacity property in order to make the picture quality better. How to do that? Note: i'm using Animate and not FadeIn. Thanks

    Read the article

  • nginx and trailing slashes on $document_root?

    - by shadowhand
    I use the following configuration for nginx: http://gist.github.com/340956 However, this configuration causes a No input file specified error with PHP. The only way I have been able to solve it is by altering this line: fastcgi_param SCRIPT_FILENAME $document_root/$fastcgi_script_name; Note the "/" between $document_root and $fastcgi_script_name. I was informed that this is the wrong configuration but no one has been able to tell me exactly why my configuration requires this extra slash. How can I get rid of that extra slash?

    Read the article

  • How to set offset in GORM when using createCriteria?

    - by firnnauriel
    I'm just wondering if it's possible for 'createCriteria' to specify the paginateParams (i.e. offset) similar to dynamic finder (findAll, etc.) Note that this code is not working since 'offset' is not documented in http://www.grails.org/doc/1.2.1/ref/Domain%20Classes/createCriteria.html def c = SnbrItemActDistance.createCriteria() def results = c.list { eq('iid', newsId) ge('distance', cap) maxResults(count) offset(offset) order('distance', 'desc') }

    Read the article

  • C# getting the results from an asynchronous call

    - by Jim Beam
    I have an API that I'm working with and it has limited documentation. I have been told that some of the methods that it executes are called asynchronously. How can I get the result of these asynchronous calls. Note that I am not doing anything special to call them, the API handles the asynchronous part. But I can't seem to get a "reply" back from these calls - I'm assuming that's because they are in another thread.

    Read the article

  • What good tiny or basic SVG editors are there?

    - by Sander Versluys
    I'm in need for a good SVG editor which can produce valid xml according to spec of the Tiny SVG profile. I would prefer if the tool was open-source or free but good commercial tools are welcome as well. Note: I have used some online tools and Inkscape, but those do not allow specifying the spec they must adhere to.

    Read the article

  • If you could take one computer science course now, what would it be?

    - by HenryR
    If you had the opportunity to take one computer science course now, and as a result significantly increase your knowledge in a subject area, what would it be? Undergraduate or graduate level. Compilers? Distributed algorithms? Concurrency theory? Advanced operating systems? Let me know why. (Note that I appreciate this isn't a far fetched scenario - but time and inertia might be preventing people from taking the course or reading the book or whatever)

    Read the article

  • json webservice security

    - by crisgomez
    I have a problem regarding json web service security. I tried to developed a sample web application using json webservice,but the problem is the url was exposed on the client side.So from there,anybody can make a program and call the service for a thousand times. Please take note, that the web service will be using for a registration page, in which checks if the user was exist on the database.So there is no authentication happened on this process. What are the approach to secure the calling of the exposed web service?

    Read the article

  • Using s/// in an expression

    - by mikeY
    I got a headache looking for this: How do you use s/// in an expression as opposed to an assignment. To clarify what I mean, I'm looking for a perl equivalent of python's re.sub(...) when used in the following context: newstring = re.sub('ab', 'cd', oldstring) The only way I know how to do this in perl so far is: $oldstring =~ s/ab/cd/; $newstring = $oldstring; Note the extra assignment.

    Read the article

  • PowerShell and interactive external programs

    - by CC
    Hi all I'm attempting to write a PowerShell script that, among other things, runs two external programs, harvesting the output of one and providing it to the other. The problem is that the second program is interactive and asks for: - a password - an option (1, 2, or 3) - an option (Y or N) - output of external program 1 Note also that this is on XP with PowerShell v1 and .net v2.0 (no I can't upgrade) Any ideas how I would do this? CC

    Read the article

  • No pre-built ActionBar for Android pre-3.0?

    - by Ollie C
    I note the release a few days ago of the static library bringing fragments to Android versions prior to 3.0, but does this library include the ActionBar? I suspect not. I assume that for an app that will work on pre-3.0 versions, that it needs a hand-built ActionBar implementation for versions up to 2.3 and then to use the OS default ActionBar in v3.0? for some reason I assumed the library had ActionBar in it, but as I dig further I'm not finding any evidence of its presence.

    Read the article

  • Avoiding SQL Injection in SQL query with Like Operator using parameters?

    - by MikeJ
    Taking over some code from my predecessor and I found a query that uses the Like operator: SELECT * FROM suppliers WHERE supplier_name like '%'+name+%'; Trying to avoid SQL Injection problem and parameterize this but I am not quite sure how this would be accomplished. Any suggestions ? note, I need a solution for classic ADO.NET - I don't really have the go-ahead to switch this code over to something like LINQ.

    Read the article

  • SQL simple selection of rows according to their time

    - by iracema78280
    Hello, I have a table with measures and the time this measures have been taken in the following form: MM/DD/YYYY HH:MI:SS AM. I have measures over many days starting at the same time every day.The datas are minute by minute so basically the seconds are always = 0. I want to select only the measures for the first 5 minutes of each day. I would have used the where statement but the condition would only be on the minutes and note the date is there a way to do this? Thanks

    Read the article

  • libXcodeDebuggerSupport.dylib is missing in iOS 4.2.1 development SDK

    - by Kalle
    Note: creating a symbolic link to use the 4.2 lib seems to work fine -- maybe cd /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1\ \(8C148\)/Symbols/ sudo ln -s ../../4.2 (8C134)/Symbols/Developer Request: See end of this question! After upgrading from 4.2.0 (beta, I believe) to 4.2.1, the libXcodeDebuggerSupport.dylib file is missing, which results in: warning: Unable to read symbols for /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1 (8C148)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib (file not found). which I guess isn't good. Looking at the directory in question I note: .../DeviceSupport/4.2 (8C134)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib but .../DeviceSupport/4.2.1 (8C148)/Symbols/System/ .../DeviceSupport/4.2.1 (8C148)/Symbols/usr/ the above two dirs make up all the content in the 4.2.1 folder. No "Developer" folder. Checking the /usr/ dir there, I find no libXcodeDebuggerSupport.dylib file in the lib dir either, so ln -s'ing isn't an option. Worth mentioning: after the upgrade, I plugged the iPad in and had to click "Use for development" in Xcode organizer. Doing so, I got a message about symbols missing for that version, and Xcode proceeded to generate such, then failed. I restored the iPad and did "Use for development" again, and nothing about missing symbols appeared... Update: deletion of /Developer and reinstallation of Xcode from scratch does not fix this issue. Update 2: I just realized that after the reinstall of Xcode, .../DeviceSupport/4.2 (8C134)/Symbols is now a symbolic link, lrwxr-xr-x 1 root admin 36 Dec 3 17:17 Symbols -> ../../Developer/SDKs/iPhoneOS4.2.sdk And the directory in question has the appropriate files. Maybe this is simply a matter of linking the 4.2.1 dir in the same fashion? I'll try that and see if Xcode freaks out. If someone who has this file could provide a md5 sum that would be splendid. This is what it says for me: $ md5 /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2\ \(8C134\)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib MD5 (/Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2 (8C134)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib) = 08f93a0a2e3b03feaae732691f112688 If the MD5 sum is identical to the output of $ md5 /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1\ \(8C148\)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib then we're all set.

    Read the article

  • Unable to add PageFunction to my project.

    - by Shimmy
    I add to my project a PageFunction and I get a dozen of the following error and the project won't compile: 'ResourceDictionary' root element is a generic type and requires a x:Class attribute to support the x:TypeArguments attribute specified on the root element tag. Basically I get an error for each DataTemplate I merge in the ResourceDictionary, has anyone encoutered this problem before? Note: I use VB.NET 3.5 on VS 2010.

    Read the article

  • call to shellexecte causes antivirus to give a warning?

    - by omair iqbal
    when ever i write the following line of code any where in any app i program with delphi ShellExecute(self.WindowHandle,'open','www.yahoo.com',nil,nil, SW_SHOWNORMAL); kaspersky 2010 beeps this message ''behavior similar to pdm.hidden data sending. detected'' why is that and how do i get rid of this note: i am using delphi 2007

    Read the article

  • cyrtsal report how to hide records based on condition of a field like date

    - by hatemgamil
    hi all i have a question about hiding records in crystal report and i am using cyrstal report in vs 2008 ,i dont know its version as i am new in crystal reporting lets say i have report like that customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 3 dre 7 07/02/2009 4 kila 3 08/02/2009 i wana ask is there a pssibilty to hide the record if Order_Date year in 2009 and show only the records where Order_date year in 2010 to be like that : customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 **note i do need the data of 2009 to make a bar chart for this year thanks in advance

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • fread and fwrite are not recommended for use with structured data

    - by forest58
    A book beginning linux programming 3ed says "Note that fread and fwrite are not recommended for use with structured data.Part of the problem is that files written with fwrite are potentially nonportable between different machines." What does that mean exactly? what calls should I use if I want to write a portable structured data reader or writer? direct system calls?

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >