Search Results

Search found 29949 results on 1198 pages for 'large scale website'.

Page 146/1198 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • How large is a "buffer" in PostgreSQL

    - by Konrad Garus
    I am using pg_buffercache module for finding hogs eating up my RAM cache. For example when I run this query: SELECT c.relname, count(*) AS buffers FROM pg_buffercache b INNER JOIN pg_class c ON b.relfilenode = c.relfilenode AND b.reldatabase IN (0, (SELECT oid FROM pg_database WHERE datname = current_database())) GROUP BY c.relname ORDER BY 2 DESC LIMIT 10; I discover that sample_table is using 120 buffers. How much is 120 buffers in bytes?

    Read the article

  • TSQL, select values from large many-to-many relationship

    - by eugeneK
    I have two tables Publishers and Campaigns, both have similar many-to-many relationships with Countries,Regions,Languages and Categories. more info Publisher2Categories has publisherID and categoryID which are foreign keys to publisherID in Publishers and categoryID in Categories which are identity columns. On other side i have Campaigns2Categories with campaignID and categoryID columns which are foreign keys to campaignID in Campaigns and categoryID in Categories which again are identities. Same goes for Regions, Languages and Countries relationships I pass to query certain publisherID and want to get campaignIDs of Campaigns that have at least one equal to Publisher value from regions, countries, language or categories thanks

    Read the article

  • How can I share an entity framework model across website users

    - by richardmoss
    Hello, Currently my website is based around MVC and the Entity Framework running against a SQL Server 2005 database. So far, it has all been running very smoothly, and I really enjoy MVC and its slimmer more concise code (and no huge viewstates or soul destroying postbacks ;)) Recently I was working on upgrading the site to use a simple forum system, and this is where I started running into problems. When I was testing the site using two different browsers, if I created or replied to a post in one browser, the other browser couldn't see the post. At the moment, each visitor to the site gets their own copy of the entity model, which I store in their session data. Obviously this is the problem as updates to one model aren't getting carried to the other. As a test, I tried storing a single copy of the model which all visitors would access by assigning the model to a static variable. This worked, and both browsers could see each others modifications. However, it had its side effects. For example, if I fired up both browsers at the same time and the model was initialized, one browser would crash, and the other would work fine, despite me using a locking object so in theory one of them should have been delayed until the model was ready (of course I could have implemented this wrong ;)). Also, originally this site did use one model for all visitors and when it was live, it frequently shut down - killing the IIS application pool while it did. Now I'm not sure if this was related, but I don't really want to reintroduce whatever bug I had that caused this shut down. So, my question is a simple one really - what is the best way of either using the same model for all website users so they all see updates, or if they do have separate copies (which I imagine will have a performance impact in time) how can the models detect changes in the database and update themselves according. Thanks in advance for any advice! Regards; Richard Moss

    Read the article

  • inserting large number of dates

    - by Radhe
    How can I insert all dates in an year(or more) in a table using sql My dates table has following structure dates(date1 date); Suppose I want to insert dates between "2009-01-01" to "2010-12-31" inclusive. Is there any sql query for the above?

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

  • Internet explore is unresponsive while loading a large page

    - by kdhamane
    We have a html page being rendered in the browser (IE) that causes the browser to hang. The page is generated through server side script (ASP.NET and viewstate is disabled). The page while loading takes a long time (its not a b\w issue since we can reproduce it on local machine) and sometimes results in script unresponsive error. On debugging the issue we found that the html size on the client side is 4.73 MB. There's also a lot of DOM traversal (using JQuery) after document is ready (jquery-document.ready). After loading as well, the page simply hangs on any user interaction (scroll, mouseover) etc. A CPU usage spike (25-50% usage) is seen during loading and on any user interaction

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • designing an ASP.NET MVC partial view - showing user choices within a large set of choices

    - by p.campbell
    Consider a partial view whose job is to render markup for a pizza order. The desire is to reuse this partial view in the Create, Details, and Update views. It will always be passed an IEnumerable<Topping>, and output a multitude of checkboxes. There are lots... maybe 40 in all (yes, that might smell). A-OK so far. Problem The question is around how to include the user's choices on the Details and Update views. From the datastore, we've got a List<ChosenTopping>. The goal is to have each checkbox set to true for each chosen topping. What's the easiest to read, or most maintainable way to achieve this? Potential Solutions Create a ViewModel with the List and List. Write out the checkboxes as per normal. While writing each, check whether the ToppingID exists in the list of ChosenTopping. Create a new ViewModel that's a hybrid of both. Perhaps call it DisplayTopping or similar. It would have property ID, Name and IsUserChosen. The respective controller methods for Create, Update, and Details would have to create this new collection with respect to the user's choices as they see fit. The Create controller method would basically set all to false so that it appears to be a blank slate. The real application isn't pizza, and the organization is a bit different from the fakeshot, but the concept is the same. Is it wise to reuse the control for the 3 different scenarios? How better can you display the list of options + the user's current choices? Would you use jQuery instead to show the user selections? Any other thoughts on the potential smell of splashing up a whole bunch of checkboxes?

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Load large images into Bitmap?

    - by GuyNoir
    I'm trying to make a basic application that displays an image from the camera, but I when I try to load the .jpg in from the sdcard with BitmapFactory.decodeFile, it returns null. It doesn't give an out of memory error which I find strange, but the exact same code works fine on smaller images. How does the generic gallery display huge pictures from the camera with so little memory?

    Read the article

  • Hang during databinding of large amount of data to WPF DataGrid

    - by nihi_l_ist
    Im using WPFToolkit datagrid control and do the binding in such way: <WpfToolkit:DataGrid x:Name="dgGeneral" SelectionMode="Single" SelectionUnit="FullRow" AutoGenerateColumns="False" CanUserAddRows="False" CanUserDeleteRows="False" Grid.Row="1" ItemsSource="{Binding Path=Conversations}" > public List<CONVERSATION> Conversations { get { return conversations; } set { if (conversations != value) { conversations = value; NotifyPropertyChanged("Conversations"); } } } public event PropertyChangedEventHandler PropertyChanged; public void NotifyPropertyChanged(string propertyName) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } public void GenerateData() { BackgroundWorker bw = new BackgroundWorker(); bw.WorkerSupportsCancellation = bw.WorkerReportsProgress = true; List<CONVERSATION> list = new List<CONVERSATION>(); bw.DoWork += delegate { list = RefreshGeneralData(); }; bw.RunWorkerCompleted += delegate { try { Conversations = list; } catch (Exception ex) { CustomException.ExceptionLogCustomMessage(ex); } }; bw.RunWorkerAsync(); } And than in the main window i call GenerateData() after setting DataCotext of the window to instance of the class, containing GenerateData(). RefreshGeneralData() returns some list of data i want and it returns it fast. Overall there are near 2000 records and 6 columns(im not posting the code i used during grid's initialization, because i dont think it can be the reason) and the grid hangs for almost 10 secs!

    Read the article

  • Problem processing large data using Applet-Servlet communication

    - by Marquinio
    Hi everyone. I have an Applet that makes a request to a Servlet. On the servlet it's using the PrintWriter to write the response back to Applet: out.println("Field1|Field2|Field3|Field4|Field5......|Field10"); There are about 15000 records, so the out.println() gets executed about 15000 times. Problem is that when the Applet gets the response from Servlet it takes about 15 minutes to process the records. I placed System.out.println's and processing is paused at around 5000, then after 15 minutes it continues processing and then its done. Has anyone faced a similar problem? The servlet takes about 2 seconds to execute. So seems that the browser/Applet is too slow to process the records. Any ideas appreciated. Thanks.

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Anyone have real world experience with Rackspace Cloud Sites at high scale?

    - by Allara
    I have a pure web service application layer using .NET. I was originally planning to use Amazon EC2, but rolling my own autoscaling procedures is a bit intimidating, and the scaling isn't very granular from a cost perspective. If the app is successful, we could be looking at relatively high scale (millions of requests per month). The app uses Amazon SimpleDB as the database layer. As a test, I have the app running successfully in Rackspace Cloud Sites. Performance seems to be equal to (if not better than) a standard EC2 instance, even with the added latency of the SimpleDB requests travelling to the Rackspace network. However, testing at this stage is at a very low scale. My question is this: has anyone had real-world experience running a high scale application on Rackspace Cloud Sites? Moreover, once you pass the "included" 10,000 compute cycles per month, does the overall cost seem to be lower than rolling lots of EC2 instances? My assumption would be that with completely smooth scaling (i.e. only adding compute resources as needed), the cost could be lower on average. However, their stated goal of calibrating 10,000 CCs as a single 1.2 Ghz CPU seems on average to be much more expensive than EC2. I like the idea of no-touch scaling, but is it too good to be true?

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • How to load a type in parent-child website

    - by salvationishere
    I am developing a C# VS 2008 / SQL Server 2008 website. Although this same code compiles in the Project version, the website version does not compile. Many of their files are the same so I do not understand even where to look. The only compile error I get is: Could not load type 'DataMatch' in my DataMatch.aspx file. Is the problem in my web.config file? How do websites differ from projects in VS? All four of these files reside in same directory. Default.aspx file: <%@ Page Language="C#" MasterPageFile="~/Site.master" AutoEventWireup="true" CodeFile="Default.aspx.cs" Inherits="AddFileToSQL" Title="Untitled Page" % ... Default.aspx.cs file: ... using System.Data.SqlClient; using System.Security.Principal; namespace AddFileToSQL { public partial class AddFileToSQL : System.Web.UI.Page { ... DataMatch.aspx file: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="DataMatch.aspx.cs" Inherits="DataMatch" % ... DataMatch.aspx.cs file: ... using System.Web.UI.WebControls; using AddFileToSQL; public partial class DataMatch : AddFileToSQL { ...

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Assigning large UInt32 constants in VB.Net

    - by Kumba
    I inquired on VB's erratic behavior of treating all numerics as signed types back in this question, and from the accepted answer there, was able to get by. Per that answer: Visual Basic Literals Also keep in mind you can add literals to your code in VB.net and explicitly state constants as unsigned. So I tried this: Friend Const POW_1_32 As UInt32 = 4294967296UI And VB.NET throws an Overflow error in the IDE. Pulling out the integer overflow checks doesn't seem to help -- this appears to be a flaw in the IDE itself. This, however, doesn't generate an error: Friend Const POW_1_32 As UInt64 = 4294967296UL So this suggests to me that the IDE isn't properly parsing the code and understanding the difference between Int32 and UInt32. Any suggested workarounds and/or possible clues on when MS will make unsigned data types intrinsic to the framework instead of the hacks they currently are?

    Read the article

  • Extract anything that looks like links from large amount of data in python

    - by Riz
    Hi, I have around 5 GB of html data which I want to process to find links to a set of websites and perform some additional filtering. Right now I use simple regexp for each site and iterate over them, searching for matches. In my case links can be outside of "a" tags and be not well formed in many ways(like "\n" in the middle of link) so I try to grab as much "links" as I can and check them later in other scripts(so no BeatifulSoup\lxml\etc). The problem is that my script is pretty slow, so I am thinking about any ways to speed it up. I am writing a set of test to check different approaches, but hope to get some advices :) Right now I am thinking about getting all links without filtering first(maybe using C module or standalone app, which doesn't use regexp but simple search to get start and end of every link) and then using regexp to match ones I need.

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >