Search Results

Search found 14131 results on 566 pages for 'of note'.

Page 146/566 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • Converting part of a multi-purpose XML file to RSS using XSL

    - by Nate McCloud
    I have an XML file that I use for storing and displaying recipes that I collect, but that same XML file also has updates for the site at the top of it. How would I, say, use Recipes.xsl to transform Recipes.xml for display as an actual website, and use RecipesRSS.xsl to transform Recipes.xml into Recipes.rss? Currently, my XML file is formatted something like this: <book> <updates> <update when="2010-04-19"> <format> <update>Formatting updates here, if any. Otherwise, omit the Format section.</update> ... </format> <recipes> <update>Recipe updates here, if any. Otherwise, omit the Recipes section.</update> ... </recipes> </update> ... </updates> <recipe name="Recipe Name"> <from>Recipe source</from> <category>Recipe category</category> <ingredients> <ingredient>Recipe ingredient</ingredient> ... </ingredients> <instructions> <step>Recipe instructions go here.</step> ... </instructions> <notes> <note>Additional notes go here, if any. Otherwise, Notes section is omitted.</note> ... </notes> </recipe> ... </book> Any help would be greatly appreciated.

    Read the article

  • Compresing View

    - by shilpa
    Hi all, in "iPhone tips" app when u scroll view from right to left,thay have show view being comppresed.It gives the effect like when u will open pages in book.Like when u go go next next page in a note book.How to achive this.Including the fonts in page will also get compressed.How to achive this.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Big O and Little o

    - by hyperdude
    If algorithm A has complexity O(n) and algorithm B has complexity o(n^2), what, if anything, can we say about the relationship between A and B? Note: the complexity of A is expressed using big-Oh, and the complexity of B is expressed using little-Oh.

    Read the article

  • How to split records per hour in order to display them as a chart?

    - by Axel
    Hi, I have an SQL table like this : sales(product,timestamp) I want to display a chart using Open Flash Chart but i don't know how to get the total sales per hour within the last 12 hours. ( the timestamp column is the sale date ) By example i will end up with an array like this : array(12,5,8,6,10,35,7,23,4,5,2,16) every number is the total sales in each hour. Note: i want to use php or only mysql for this. Thanks

    Read the article

  • What Java/Scala or .NET web frameworks support modify source code and instantly run workflow e.i. wi

    - by Alexey
    As far as I can see the key advantage of dynamic languages like Ruby or Python over Java/Scala/C# etc is "hot" applying of your changes to source code to the running application. What are the frameworks for JVM or .NET that support the same workflow - apply changes to configuration and source code on the fly? Can they also watch changes to custom configurations and notify application? Note: Frameworks for dynamic languages on JVM/.NET like Grails or Compojure are out of scope here.

    Read the article

  • Laravel with Homestead

    - by Ahmed el-Gendy
    I new with virtual box and vagrant , Now I using Homestead image and every thing is run well but when i create my project named laravel on virtual machine it supposed that i see this new folder named laravel on my machine but i didn't get any thing on my machine , The synchronization is not working. NOTE: I'm using ubuntu 14.04 This is my homestead.yaml ip: "192.168.10.10" memory: 2048 cpus: 1 authorize: ~/.ssh/id_rsa.pub keys: - ~/.ssh/id_rsa folders: - map: /var/projects/ to: /home/vagrant/projects/ sites: - map: homestead.app to: /home/vagrant/projects/laravel/public variables: - key: APP_ENV value: local thanks advance

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • Cannot resolve the collation conflict ???

    - by HAJJAJ
    hi guys I had this error and i don't know how to fix it Message=Cannot resolve the collation conflict between "Arabic_CI_AS" and "SQL_Latin1_General_CP1_CI_AS" in the equal to operation. note: I already change the collation from the database option -- Collation i change it from "Arabic_CI_AS" to "SQL_Latin1_General_CP1_CI_AS" and i am still getting the same error !! any suggestion to solve this ?

    Read the article

  • Issue with UIImage files not being found on phone

    - by Driss Zouak
    Note: Using Monotouch. I have a directory called Images where I have all my PNG files. In my code I have the following _imgMinusDark = UIImage.FromFile("images/MinusDark.png"); On the simulator it runs fine, on the phone it's null. I have the Images folder content (all the PNGs) in my MonoDevelop marked as Content in terms of Build Action. What am I missing? thanks

    Read the article

  • Regular Expression problem

    - by Yatendra Goel
    I want a regex to find the following types of strings: http://anything.abc.tld http://anything.abc.tld/ where abc - abc always remains abc anything - it could be any string tld - it could be any tld (top-level-domain) like .com .net .co.in .co.uk etc. Note: The url must not contain any other thing at the end, means http://anything.abc.tld/xyz is not acceptable.

    Read the article

  • How to determine the browser of the user using PHP?

    - by ron8
    How to determine the browser of the user using PHP? So that if the users browser is IE then the variable $alert="onbeforeunload" and if it is not IE, for example Firefox (else) then $alert="onload. Help is much appreciated. Thanks Also please note that I can not install browscap.ini on my PHP server.

    Read the article

  • How do I read an attribute on a class at runtime?

    - by Zaff
    I am trying to create a generic method that will read an attribute on a class and return that value at runtime. How do would I do this? Note: DomainName attribute is of class DomainNameAttribute. [DomainName(“MyTable”)] Public class MyClass : DomianBase {} What I am trying to generate: //This should return “MyTable” String DomainNameValue = GetDomainName<MyClass>();

    Read the article

  • Check for Windsor Container Component Instance

    - by jeffn825
    How can I use my Windsor container to check if an instance (not just a component) has been registered? ie. container.ContainsInstance(typeof(MyType)) [EDIT] Another way of writing this might be Kernel.GetAssignableHandlers(typeof(object)) .Where(handler => handler.Service == typeof(MyType) || handler.ComponentModel.Implementation == typeof(MyType)) .Any(handler => handler.***Instance*** != null) Note that the property Instance doesn't exist in the API. Thanks.

    Read the article

  • How to get the trending tags using php and mysql?

    - by Tom
    Hello I have a table : tags(tagname,entryid,stamp) and i want to make a section for the most trending tags today, the tagname column has no unique value, because many entries has the same tag, so the php code that i want should display the most attached tags today. Note: the "stamp" column is the date of adding the tag in UNIX time stamp format. Thanks

    Read the article

  • Flash: Loadmovie() in a specific width and height ?

    - by Axel
    Hi, i'm using loadmovie() to load a youtube video player inside my flash website but i want to specify the width and height so it can fit my box. This is my code: vloader.loadMovie("http://www.youtube.com/v/Alw5hs0chj0&hl=fr&fs=1hJ-mPcGtC"); I have an empty CLIP called "vloader" where i load the video player. Note: it is recommended that i get a code in Action script 1.0 Thanks

    Read the article

  • How can I use linq to initialize an array of repeated elements?

    - by Eric
    At present, I'm using something like this to build a list of 10 objects: myList = (from _ in Enumerable.Range(0, 9) select new MyObject {...}).toList() This is based off my python background, where I'd write: myList = [MyObject(...) for _ in range(10)] Note that I want my list to contain 10 instances of my object, not the same instance 10 times. Is this still a sensible way to do things in C#? Is there a cost to doing it this way over a simple for loop?

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >