Search Results

Search found 34267 results on 1371 pages for 'dynamic script loading'.

Page 149/1371 | < Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >

  • jQuery - Loading content into div, styles not applied?

    - by Kenny Bones
    Hi! I'm trying to get this content loader to work and I've managed to get it to get new content, once the content is loaded it isn't styled correctly. Also the character "é" becomes a questionmark. Doctype problem? As well as the h2 tag normally having Cufon applied to it is not triggering. So basically, this content loader require me to have a bunch of pages being essentially the same, except for the content I want to retreice. This way, users can use the actual URL as you'd normally exect. Only when a link is clicked on an already loaded page, it's only the content from the #content div that's realle being replaced. I can post code here, but I think it's better to just watch it happen on the testpage. It's very low on graphics btw ;) http://www.matkalenderen.no Just click the blue text link and you'll see it. Also, the red button on the second loaded content is supposed to revert the content back to previous. But it's not being triggered or something. What's happening?

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • Exception loading CustomMeta from Tridion Broker Service (2009 SP1)

    - by Rob Stevenson-Leggett
    I am trying to load some Custom Meta from a component which is published into the Tridion Broker. This is 2009 SP1 I can see the component in the Custom_Meta table with a query like: SELECT * FROM [Tridion_Broker].[dbo].[CUSTOM_META] WHERE ITEM_ID = 204221 However using the below code, I get a Java Runtime exception. string queryStringId = HttpUtility.UrlDecode(Request.QueryString["component_uri"]); string pageId = ((BasePage) Page).PageTcmId; int publicationId = int.Parse(pageId.Split(':')[1].Split('-')[0]); using (var cmf = new ComponentMetaFactory(publicationId)) { IComponentMeta cm = cmf.GetMeta(queryStringId); if(cm != null) { VideoId = cm.CustomMeta.GetValue("video_url").ToString(); } else { litMessage.Visible = true; } } Stack trace: [RuntimeException] Codemesh.JuggerNET.NTypeValue.Throw(Int64 inst) +351 Codemesh.JuggerNET.JavaClass.ThrowTypedException(Int64 inst) +1278 Codemesh.JuggerNET.JavaMethod.CallObject(JavaProxy jpo, JavaMethodArguments args) +551 Codemesh.JuggerNET.JavaMethod.CallObject(JavaProxy jpo, Type declaredType, Boolean bLeaf, JavaMethodArguments jargs) +50 Com.Tridion.Meta.ComponentMetaFactory.GetMeta(Int32 componentId) +118 Tridion.ContentDelivery.Meta.ComponentMetaFactory.GetMeta(Int32 componentId) +16 ASP._controls_video_ascx.Page_Load(Object sender, EventArgs args) in c:\Inetpub\wwwroot\borland\us\_controls\Video.ascx:18 System.Web.Util.CalliHelper.EventArgFunctionCaller(IntPtr fp, Object o, Object t, EventArgs e) +14 System.Web.Util.CalliEventHandlerDelegateProxy.Callback(Object sender, EventArgs e) +35 System.Web.UI.Control.OnLoad(EventArgs e) +99 System.Web.UI.Control.LoadRecursive() +50 System.Web.UI.Control.LoadRecursive() +141 System.Web.UI.Control.LoadRecursive() +141 System.Web.UI.Control.LoadRecursive() +141 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +627

    Read the article

  • Java WebApp: Loading resource from .jar located in WEB-INF

    - by shaman.sir
    There are a lot of similar questions, but, probably, mine is a little bit different: What is the right way to load resource from inside of .jar file located in WEB-INF/lib folder (if I know the jar file name and the name of the class it resource belongs to), while Web Application is running? Should I use getServletContext().getResourceAsStream(?) for this purpose or the <name-of-known-class>.getResourseAsStream(?), and what path do I need to specify there? So, the structure is: /WEB-INF /classes /some/package/name ?.class #some Java code or Servlet that tries to read 'required-file.xml' /lib /<jar-with-known-name>.jar /another/package/with/known/name SomeKnownClass.class required-file.xml

    Read the article

  • A dynamic array of class "landmark", inside another single class "landmarks"

    - by pinnacler
    I'm working on a robot localization simulator and I created a class called "landmark". The end result is going to be a robot that is always centered and always faces the top of the screen. As it turns, the birds eye view map will rotate around the robot. To accomplish this, I'm assuming I can rotate one class and have all elements inside rotate as well. So, the landmark class has properties x,y, label, and radius. This is suppose to simulate a tree location in a forest. To test everything, I need "forest data," and I wrote a script to generate 100 trees in a 100m x 100m area. The script automatically generates values within an acceptable range for x,y, radius. The generated data is stored in an object called tempForest and is 100x3. Ideally, I want to create a class called "landmarks" (plural) that has 100 landmark instances inside. How would I instantiate 100 instances of landmark in one instance of landmarks using that randomly generated data? Ideally, I'd just type treeBeacons = landmarks(); and it would randomly populate 100 (user definable, set in config file) instances with x, y, radius data. I'm not sure how to deal with a dynamic array of class "Landmark", inside another single class "landmarks." Any ideas?

    Read the article

  • Problem while loading the application on iPAD?

    - by chaitanya
    Hi, I developed a simple application for iPAD. I want to test the app how it works on the device. I have paid developer licence, and i have added the device id and created the app id and i have downloaded the provisioning profile using both. The same way how we will build the app for iphone i have done for ipad. i have sent the provisioning profile and .ipa file to my friend to load on to the ipad device(same device which i have added in the developer.apple.com). when he tried to drag n drop the provisioning file on to the device from iTunes it is giving below error. "abc.mobileprovision" was not copied on to the iPAD, because it cannot be palyed on this iPAD I am not able to understand what the exact error is. Can anyone please let me know how to dump the applicatio on to the ipad device?

    Read the article

  • Error loading my managedObjectModel

    - by niklassaers
    Hi guys, When I call [myAppDelegate managedObjectModel], in the retain line below, my application will crash (iPhone SDK v3.1.3): - (NSManagedObjectModel *)managedObjectModel { if (managedObjectModel != nil) { return managedObjectModel; } managedObjectModel = [[NSManagedObjectModel mergedModelFromBundles:nil] retain]; return managedObjectModel; } Here is my crash trace #0 0x905c44e6 in objc_exception_throw #1 0x01e78c3b in +[NSException raise:format:arguments:] #2 0x01e78b9a in +[NSException raise:format:] #3 0x000af99b in _NSArrayRaiseInsertNilException #4 0x0001c360 in -[NSCFArray insertObject:atIndex:] #5 0x0001c274 in -[NSCFArray addObject:] #6 0x01c16a7e in +[NSManagedObjectModel mergedModelFromBundles:] #7 0x00002432 in -[myAppDelegate managedObjectModel] at myAppDelegate.m:102 What is going on here? This is template code that I haven't seen fail before. Cheers Nik

    Read the article

  • loading data from file into 2d array

    - by Chris
    I am just starting with perl and would like some help with arrays please. I am reading lines from a data file and splitting the line into fields: open (INFILE, $infile); do { my $linedata = <INFILE>; my @data= split ',',$linedata; .... } until eof; I then want to store the individual field values (in @data) in and array so that the array looks like the input data file ie, the first "row" of the array contains the first line of data from INFILE etc. Each line of data from the infile contains 4 values, x,y,z and w and once the data are all in the array, I have to pass the array into another program which reads the x,y,z,w and displays the w value on a screen at the point determined by the x,y,z value. I can not pas the data to the other program on a row-by-row basis as the program expects the data to in a 2d matrtix format. Any help greatly appreciated. Chris

    Read the article

  • Django template not loading properly

    - by fmsf
    Hey, When this one runs everything goes fine: (r"^newobject$", "views.myobjects.newobject"), All the CSS + JS files are properly fetched from: static/css/... static/js/... When this one runs: (r"^mybjects/(([a-z]|[A-Z]|[0-9])+)$","views.myobjects.loadobject"), All the css and JS files that are being fetched, are run trough the urlpatterns and are returning my defailt page: (r"", 'views.main.index'), This makes all my CSS and JS code to actualy be HTML. My guess is that i'm giving some noob mistake. Is there any common reason why this should happen? And how to fix it?

    Read the article

  • Optimising local image loading/rendering on iPhone

    - by Tricky
    Hi, I'm looking to create an interface where the user can navigate through large volumes of images. Each image has a thumbnail of 128x128 that I wish to display and will be kind of similar to coverflow in operation. I have this all working in principle but am becoming stuck when navigating through content at speed. The interface begins to stutter and becoming jerky. I believe this is primarily because of disk i/o and the cost of rendering each image. Is there anyway this can be handed over to a seperate thread simply? Defaulting to a greyed out thumbnail until the image has loaded? How have Apple managed to achieve this in coverflow? Many thanks,

    Read the article

  • Lazy property loading in Nhibernate and Spring

    - by Khash
    I'm using NHibernate 2.1.2 and Spring 1.3 I have two Text columns (blobs) in one of my classes. I'm trying to use lazy="true" for the mapping of those properties but NHProfiler still shows the two columns being added to the SELECT statement when the main object is loaded. I'm using Spring.NHibernate session factory and have configured ProxyFactory with both Castle and Spring with no luck.

    Read the article

  • Menu item for each module, with module content loading dynamically with Prism or MEF

    - by user573145
    I am developing an application currently using Prism and MEF. I would ideally like to generate a toolbar or menu with an item for each module, and when an item is clicked, only the views declared within that module load into a tab control. For example: Menu Region: ModuleA(Selected) | ModuleB Tab Region: ModuleAViewA | ModuleAViewB | ModuleAViewC Changes to Menu Region: Employees | Inventory(selected) Tab Region: Items | In Fi

    Read the article

  • loading child swf as3

    - by RichW
    Hi, I've been given an fla to make some changes too. Basically its a fairly long timeline animation with sound. So far I've successfully added a few button functions for sound etc.. but one has got me stumped. One of the buttons needs to load a child swf. I'm using the code below but I'm recieving an error - 'Error #1009: Cannot access a property or method of a null object reference'. I believe this may be refferring to an object that isn't set yet but I have no idea which one it is: Code: var mcExt:MovieClip = new MovieClip(); var ldr:Loader = new Loader(); ldr.contentLoaderInfo.addEventListener(Event.COMPLETE, swfLoaded); ldr.load(new URLRequest("Downloads.swf")); function swfLoaded(e:Event):void { mcExt = MovieClip(ldr.contentLoaderInfo.content); ldr.contentLoaderInfo.removeEventListener(Event.COMPLETE, swfLoaded); mcExt.x = 50; mcExt.y = 50; addChild(mcExt); } Any help on what is going wrong would be greatly appreciated! Thanks

    Read the article

  • unix at command pass variable to shell script?

    - by Andrew
    Hi, I'm trying to setup a simple timer that gets started from a Rails Application. This timer should wait out its duration and then start a shell script that will start up ./script/runner and complete the initial request. I need script/runner because I need access to ActiveRecord. Here's my test lines in Rails output = `at #{(Time.now + 60).strftime("%H:%M")} < #{Rails.root}/lib/parking_timer.sh STRING_VARIABLE` return render :text => output Then my parking_timer.sh looks like this #!/bin/sh ~/PATH_TO_APP/script/runner -e development ~/PATH_TO_APP/lib/ParkingTimer.rb $1 echo "All Done" Finally, ParkingTimer.rb reads the passed variable with ARGV.each do|a| puts "Argument: #{a}" end The problem is that the Unix command "at" doesn't seem to like variables and only wants to deal with filenames. I either get one of two errors depending on how I position "s If I put quotes around the right hand side like so ... "~/PATH_TO_APP/lib/parking_timer.sh STRING_VARIABLE" I get, -bash: ~/PATH_TO_APP/lib/parking_timer.sh STRING_VARIABLE: No such file or directory I I leave the quotes out, I get, at: garbled time This is all happening on a Mac OS 10.6 box running Rails 2.3 & Ruby 1.8.6 I've already messed around w/ BackgrounDrb, and decided its a total PITA. I need to be able to cancel the job at any time before it is due.

    Read the article

  • Apache not loading Xdebug, but does when started from the Command Line

    - by JamesD
    I know that this sounds odd, but believe me, it's what is happening. Here are my system settings: Windows7 Apache 2.2 PHP 5.2.12 Xdebug 2.0.5 I have XDebug configured in my PHP.ini file. When I run php -m, I do in fact see that Xdebug is loaded. Now, if I start Apache AS A SERVICE (or by the Apache Monitor), and run phpinfo(), it is NOT showing Xdebug as being loaded. However, (now here's the crazy part), if I go to my Apache bin directory, and simply run httpd.exe, and then go and look at phpinfo(), Xdebug now shows as being loaded! Also, comparing some phpinfo() when started via service or by command line, it looks like the php.ini file is the same for either case. Everything looks the same except for the Xdebug being loaded part. Please, if you have any ideas it would be greatly appreciated.

    Read the article

  • Setting the colour scheme for a Silverlight app from an external resource

    - by Alex Angas
    I have a Silverlight 3 application containing six custom user controls. I'd like to load the colour scheme for these controls from an external resource. The code and XAML containing a default colour scheme would be built in the XAP. Then a parameter on the object tag would contain a URL from where alternate colours can be dynamically loaded. By the way, the Silverlight 3 application theme feature could be used if that's possible but is really overkill. Only colours need to be changed. Is this possible and how would you recommend to do it?

    Read the article

  • Prevent deferred creation of controls.

    - by Scott Chamberlain
    Here is a test framework to show what I am doing, just create a new project add a tabbed control, on tab 1 put a button on tab 2 put a check box (default names) and paste this code for its code public partial class Form1 : Form { private List<bool> boolList = new List<bool>(); BindingSource bs = new BindingSource(); public Form1() { InitializeComponent(); boolList.Add(false); bs.DataSource = boolList; checkBox1.DataBindings.Add("Checked", bs, ""); } bool updating = false; private void button1_Click(object sender, EventArgs e) { updating = true; boolList[0] = true; bs.ResetBindings(false); Application.DoEvents(); updating = false; } private void checkBox1_CheckedChanged(object sender, EventArgs e) { if (!updating) MessageBox.Show("CheckChanged fired outside of updating"); } } The issue is if you run the program and look at tab 2 then press the button on tab 1 the program works as expected, however if you press the button on tab 1 then look at tab 2 the event for the checkbox will not fire untill you look at tab 2. The reason for this is the controll on tab 2 is not in the "created" state, so its binding to change the checkbox from unchecked to checked does not happen until after the control has been "Created". checkbox1.CreateControl() does not do anything because according to MSDN CreateControl does not create a control handle if the control's Visible property is false. You can either call the CreateHandle method or access the Handle property to create the control's handle regardless of the control's visibility, but in this case, no window handles are created for the control's children. I tried getting the value of Handle(there is no CreateHandle for Button) but still the same result. Any suggestions other than have the program quickly flash all of my tabs that have data-bound check boxes when it first loads?

    Read the article

  • UIwebview delays loading

    - by malleswar
    Hi, I have Login screen and second view which will be shown after login. On second view I have UIWebview which loads the url. After login first it shows the empty view and slowly it loads the url. I want to show login screen with wait cursor, until the uiwebview loads the url and then want show that screen. Can any body please provide code or sample for this? Regards, Malleswar

    Read the article

  • htaccess rewrite rule not loading site content

    - by peter
    I am struggling with .htaccess rewrite rules. Let's say I have this URL. localhost/site/index.php and I want to rewrite it as this URL localhost/site/tutorial I would use this RewriteRule Options +FollowSymLinks RewriteEngine on RewriteRule ^tutorial/(.*)$ /up/index.php The page works, but the CSS files don't load. Also, if I have a URL like this: index.php?page=home Then I would have to parse through that URL to get 'home' not using $_GET anymore correct??

    Read the article

  • Standalone XULRunner app not loading the Flash player plugin

    - by Rajeesh
    Hi, I have created a standalone XUL application, and I copied "NPSWF32.dll"(flash plugin dll) to the "plugins" folder under the browser. When I launch the application, flash content is not getting displayed. If I set the MOZ_PLUGIN_PATH to the "plugins" directory before launching the application, everything is working as expected. Could someone tell me, what I needs to do in order to load the flash plugin automatically from the "plugins" folder. Thanks, Rajeesh

    Read the article

  • VisualAssert Testing in C++, Loading a test fixture.

    - by C_Bevan
    Good day, I am learning Testing in Visual Studio C++ and I have several tutorials which I have followed. I am trying to load a test fixture. I have tried to put the test .cpp file in many different places but it will still not pick up on it when I click on "Run Tests" or "Run Tests without debugging" In the tutorials I found, they seemed to load into the Test Explorer automatically, but in mine is an icon with a X + (PROJECTNAME).EXE and when I hoover over it I get the process exited without registering with the agent... this is due to the model not containing any test fixtures... How can I load my tests into the Test Explorer...or register them with my project... I've tried right click and "Add Fixture...".... but that just starts a new test file and I have the same problem. Anybody know how I solve this issue?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Mootools not loading fast enough IE6

    - by Tom
    Very random and annoying problem with IE6. We keep our common JS files on a resources server so we only have to update them in one place. As well as our custom classes we also keep our build of mootools and more on the resources server and link to it in the head of our sites. This is fine in all the browsers accept IE6. In IE6 it seems to not loads the core quick enough from the external link before trying to process the mootools code in my site.js file. It will go wrong on the first line "windows.addEvent". If i put a mootools core in a folder where the site is though its fine. Does anyone know why it might be doing this and if so a way around it, but still keeping the files on the resources domain? Thanks Tom

    Read the article

< Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >