Search Results

Search found 32752 results on 1311 pages for 'multi line'.

Page 149/1311 | < Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >

  • Putting max. 30 characters per line with CSS

    - by Pieter
    I have a paragraph of text: <p>Lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum</p> How can I make sure that no more than 30 characters are shown on one line with CSS?

    Read the article

  • Recommended Clang command line options

    - by frou
    The Manual for Clang seems to be work in progress, so could you help me formulate the definitive command line options for compiling ANSI-C (AKA C89, C90) with maximum strictness and relevant/helpful warnings? Clang is a compiler front end for the C, C++, and Objective-C programming languages. It uses the Low Level Virtual Machine (LLVM) as its back end. It is still under development. Its goal is to offer a replacement to the GNU Compiler Collection (GCC)

    Read the article

  • Source Safe Command line - Getting all changed files since label until current time

    - by Albert
    Hi All, I would like to do a 'GET' (From the command line, ss.exe) of files that has been added/changed since a label, and place them in say C:\temp\db I have files a.cs, b.cs, c.cs currently If I label my project version1.0 then add files 10.cs,11.cs,12.cs and 13.cs I would like my GET to get 10, 11, 12 and 13... Let me know if this is possible! I have tried: ss GET "$/xyz/parentproject/project" -GLc:\temp\db\ -Vl~"proj 3.2.27" -I-N Regards, Albert

    Read the article

  • Debugging Django from the command-line

    - by chiggsy
    I'm working on debugging Django from the command-line. I'm working with django_extensions, and I have IPython installed and ideally I'd like to be able to extract as much information in the shell as possible. How would I go about this task most efficiently?

    Read the article

  • die $template->error() produces no line number

    - by Kinopiko
    In the following short program: use Template; my $template = Template->new (INCLUDE_PATH => "."); $template->process ("non-existent-file") or die $template->error (); why does "die" not produce a line number and newline? Output looks like this: $ perl template.pl file error - non-existent-file: not found ~ 503 $

    Read the article

  • How to ask UIImageView if MultipleTouchEnabled is "YES"

    - by Rob
    I have created a few UIImageViews programmatically, but I have a feeling that even though I setMultipleTouchEnabled to YES during the setup, it is not getting set properly and it's leading to multi-touch issues. My question is, within touchesBegan how do I go about asking the UIImageView that was touched if it has MultipleTouchEnabled or not? I am fairly new to this so I'm really stumbling through code and learning as I go (with your help of course). Thank you ahead of time!

    Read the article

  • Calling VS 2008 refactoring methods through command line?

    - by Huck
    Hello all, I want to create a simple batch file that would perform some Visual Studio 2008 refactoring tasks on some files. For example, I would like to call the Refactor.ExtractInferface command on a given file. Can I do this from the command line? Is there a better way (I am sure there is) of doing this? Thanks, H.

    Read the article

  • WPF Coordinates of intersection from two Line objects

    - by Becky Franklin
    I have two Line objects in C# WPF, and I'm trying to construct a method to work out the coordinates at which the lines intersect (if at all). After giving myself a headache reminding myself of high school maths to do this, I can't work out how to map it into programming format - anyone know how to do this? Thanks very much, Becky

    Read the article

  • Command line or library "compare tables" utility for SQL server with comprehensive diff output to a

    - by MicMit
    I can't find anything like that. Commercial or free ( XSQL Lite is suitable for my case and ) tools show diffs in grids with possibility to export to CSV. Also they generate sync SQL scripts when run from command line. What I need is an output as a comprehensive report ( XML , HTML ) suitable for parsing so that I would be able to show similar diff grid in my application ( updated old/new values for each column , added - all values for row , deleted - all values for row and etc... ) .

    Read the article

  • java.util.logging: how to suppress date line

    - by andrews
    I'm trying to suppress output of the date line durinng logging when using the default logger in java.util.logging. For example, here is a typical output: Jun 1, 2010 10:18:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:18:12.0, local-time=20100601t101812, duration=180000 Jun 1, 2010 10:21:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:21:12.0, local-time=20100601t102112, duration=180000 I would like to get rid of the Jun 1, 2010... lines, they just clutter my log output. How can I do this?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • How to transform multiple line into one line in bash stdout ?

    - by Samantha
    Hello, I sometimes do this in my shell : sam@sam-laptop:~/shell$ ps aux | grep firefox | awk '{print $2}' 2681 2685 2689 4645 $ kill -9 2681 2685 2689 4645 Is there a way I can transform the multiple lines containing the PIDs into one line separated by spaces ? (It's a little bit annoying to type the PIDs every time and I really would like to learn :) ) Thanks a lot.

    Read the article

  • Current Line For Visual Studio Macros

    - by Vadim
    How can I read text of a current line (where cursor is situated) from Macros? I'm going to use such a fucntion: Public Sub AddTextToChangeLogFile() Dim textOnACurrentLine As ??? textOnACurrentLine = ??? If textOnACurrentLine.Text <> String.Empty Then Dim sw As New StreamWriter("C:\###\Changes.txt", True) sw.WriteLine(textOnACurrentLine + ". file: " + DTE.ActiveDocument.Name) sw.Close() End If End Sub

    Read the article

  • Animating gradient displays line artifacts in ActionScript

    - by TheDarkIn1978
    i've programatically created a simple gradient (blue to red) sprite rect using my own basic class called GradientRect, but moving or animation the sprite exhibits line artifacts. when the sprite is rotating, it kind of resembles bad reception of an old television set. i'm almost certain the cause is because each line slice of the gradient is vector so there are gaps between the lines - this is visible when the sprite is zoomed in. var colorPickerRect:GradientRect = new GradientRect(200, 200, 0x0000FF, 0xFF0000); addChild(colorPickerRect); colorPickerRect.cacheAsBitmap = true; colorPickerRect.x = colorPickerRect.y = 100; colorPickerRect.addEventListener(Event.ENTER_FRAME, rotate); function rotate(evt:Event):void { evt.target.rotation += 1; } ________________________ //CLASS PACKAGE package { import flash.display.CapsStyle; import flash.display.GradientType; import flash.display.LineScaleMode; import flash.display.Sprite; import flash.geom.Matrix; public class GradientRect extends Sprite { public function GradientRect(gradientRectWidth:Number, gradientRectHeight:Number, ...leftToRightColors) { init(gradientRectWidth, gradientRectHeight, leftToRightColors); } private function init(gradientRectWidth:Number, gradientRectHeight:Number, leftToRightColors:Array):void { var leftToRightAlphas:Array = new Array(); var leftToRightRatios:Array = new Array(); var leftToRightPartition:Number = 255 / (leftToRightColors.length - 1); var pixelColor:Number; var i:int; //Push arrays for (i = 0; i < leftToRightColors.length; i++) { leftToRightAlphas.push(1); leftToRightRatios.push(i * leftToRightPartition); } //Graphics matrix and lineStyle var leftToRightColorsMatrix:Matrix = new Matrix(); leftToRightColorsMatrix.createGradientBox(gradientRectWidth, 1); graphics.lineStyle(1, 0, 1, false, LineScaleMode.NONE, CapsStyle.NONE); for (i = 0; i < gradientRectWidth; i++) { graphics.lineGradientStyle(GradientType.LINEAR, leftToRightColors, leftToRightAlphas, leftToRightRatios, leftToRightColorsMatrix); graphics.moveTo(i, 0); graphics.lineTo(i, gradientRectHeight); } } } } how can i solve this problem?

    Read the article

  • NetBeans Java code formatter: logical operators on new line

    - by mizipzor
    My code looks like this: if (firstCondition() && secondCondition()) { // ... code } The default settings for the code formatter in NetBeans wants to put the && on a new line, like this: if (firstCondition() && secondCondition()) { // ... code } The formatter works well so I would just like to find the setting so it doesnt change the code to the latter. Whats the setting called?

    Read the article

< Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >