Search Results

Search found 2761 results on 111 pages for 'sequence generators'.

Page 15/111 | < Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >

  • iPhone: Cocos2d how to make a sequence

    - by Johannes Jensen
    I have two logos, which I want to come in after each other. I'd like to use CCFadeIn and CCFadeOut. I have Logo1, and then I want it to CCFadeIn, then I want it to stay for 2 seconds, then make it fade out using CCFadeOut, and then make Logo2 CCFadeIn for 1 second, stay for 2 seconds and then go away during 1 second with CCFadeOut. How I would make this I'm not completely sure. I can't seem to find a way to make a CCAction fire a method (let's say -finishedFadingInLogo1:), so I don't know how to do this. Any ideas?

    Read the article

  • LINQ: How to skip one then take the rest of a sequence

    - by Marcel
    Hi All, i would like to iterate over the items of a List<T>, except the first, preserving the order. Is there an elegant way to do it with LINQ using a statement like: foreach (var item in list.Skip(1).TakeTheRest()) {.... I played around with TakeWhile , but was not successful. Probably there is also another, simple way of doing it?

    Read the article

  • Arrange points in sequence.

    - by Himadri
    I have some points in 3D which are in a single plane. I want to arrange them in clock wise or counter clockwise order. The points can create a concave or convex polygon in a single plane. Can any body give any suggestions?

    Read the article

  • Objective - C, fastest way to show sequence of images in UIImageView

    - by Almas Adilbek
    I have hundreds of images, which are frame images of one animation (24 images per second). Each image size is 1024x690. My problem is, I need to make smooth animation iterating each image frame in UIImageView. I know I can use animationImages of UIImageView. But it crashes, because of memory problem. Also, I can use imageView.image = [UIImage imageNamed:@""] that would cache each image, so that the next repeat animation will be smooth. But, caching a lot of images crashed app. Now I use imageView.image = [UIImage imageWithContentsOfFile:@""], which does not crash app, but doesn't make animation so smooth. Maybe there is a better way to make good animation of frame images? Maybe I need to make some preparations, in order to somehow achieve better result. I need your advices. Thank you!

    Read the article

  • WPF Animate and change Opacity of Image in sequence

    - by user1103757
    I have three images, two of these images animate as follow and third image should blink: <Window.Resources> <Storyboard x:Key="AnimateTarget" RepeatBehavior="Forever"> <DoubleAnimationUsingKeyFrames BeginTime="0:0:0" Duration="0:00:03" Storyboard.TargetName="img1" Storyboard.TargetProperty="Y"> <EasingDoubleKeyFrame KeyTime="0:0:0" Value="0" /> <EasingDoubleKeyFrame KeyTime="0:0:1" Value="200" /> <EasingDoubleKeyFrame KeyTime="0:0:2" Value="0" /> </DoubleAnimationUsingKeyFrames> <DoubleAnimationUsingKeyFrames BeginTime="0:0:2" Duration="0:00:03" Storyboard.TargetName="img2" Storyboard.TargetProperty="x"> <EasingDoubleKeyFrame KeyTime="0:0:0" Value="0" /> <EasingDoubleKeyFrame KeyTime="0:0:1" Value="200" /> <EasingDoubleKeyFrame KeyTime="0:0:2" Value="0" /> </DoubleAnimationUsingKeyFrames> <DoubleAnimation BeginTime="0:0:4" Duration="0:0:0.5" Storyboard.TargetProperty="(Image.Opacity)" Storyboard.TargetName="img3" From="1.0" To="0.0" RepeatBehavior="Forever" AutoReverse="True" /> </Storyboard> </Window.Resources> The first two images are animating fine but the third image doesn’t blink, it will do nothing and just stay there as you can see I have used the following code for blinking the third image: <DoubleAnimation BeginTime="0:0:4" Duration="0:0:0.5" Storyboard.TargetProperty="(Image.Opacity)" Storyboard.TargetName="img3" From="1.0" To="0.0" RepeatBehavior="Forever" AutoReverse="True" /> Also this is a code for the third image: <Image Height="65" Name="image1" Stretch="Fill" Width="67" Source="/PicTakeWPF;component/Images/422505_110594629067212_100003500265268_37406_1212153553_n.jpg"> <Image.RenderTransform> <TranslateTransform x:Name="img3"></TranslateTransform> </Image.RenderTransform> </Image> I would appreciate if someone helps me on this Thanks,

    Read the article

  • Lazy sequence or recur for mathematical power function?

    - by StackedCrooked
    As an exercise I implemented the mathematical power function. Once using recur: (defn power [a n] (let [multiply (fn [x factor i] (if (zero? i) x (recur (* x factor) factor (dec i))))] (multiply a a (dec n)))) And once with lazy-seq: (defn power [a n] (letfn [(multiply [a factor] (lazy-seq (cons a (multiply (* a factor) factor))))] (nth (multiply a a) (dec n)))) Which implementation do you think is superior? I truly have no idea.. (I'd use recur because it's easier to understand.) I read that lazy-seq is fast because is uses internal caching. But I don't see any opportunities for caching in my sample. Am I overlooking something?

    Read the article

  • PHP sleep() excution sequence while echoeing.

    - by Babiker
    I have the following: echo time()."<br>"; sleep(1); echo time()."<br>"; sleep(1); echo time()."<br>"; I wrote the preceding code with intention to echo time()."<br>" ln 1,echo time()."<br>" ln 4, wait a final second and then echo the final time()."<br>". Altough the time bieng echoed is correct when it comes to the intervals between time(), all echo functions are echoeing after the total of the waiting period/parameters in each sleep function. This is how the script runs: Excutes. Waits 2 secons. echoes 1275540664 1275540665 1275540666 Notice the correct incrementation in time() being echoed. My question is why is it not behaving like expected to where it echoes, waits a second, echoes again, waits one final second and then echos the last parameter? I know my question is a little confusing due to my wording, but i will try my hardest to answer any comments regarding this, thanks.

    Read the article

  • Incorrect output on changing sequence of declarations

    - by max
    Writing C++ code to implement Sutherland-Hodgeman polygon clipping. This order of declaration of these 2 statements gives correct output, reverse does not. int numberOfVertices = 5; Point pointList[] = { {50,50}, {200,300}, {310,110}, {130,90}, {70,40} }; I am passing the polygon vertex set to clippers in order - LEFT, RIGHT, TOP, BOTTOM. The exact error which comes when the declarations are reversed is that the bottom clipper, produces an empty set of vertices so no polygon is displayed after clipping. Correct: Incorrent: Confirmed by outputting the number of vertices produced after each pass: Correct: Incorrect: What is the reason for this error? Code: #include <iostream> #include <GL/glut.h> #define MAXVERTICES 10 #define LEFT 0 #define RIGHT 1 #define TOP 2 #define BOTTOM 3 using namespace std; /* Clipping window */ struct Window { double xmin; double xmax; double ymin; double ymax; }; struct Point { double x; double y; }; /* If I interchange these two lines, the code doesn't work. */ /**************/ int numberOfVertices = 5; Point pointList[] = { {50,50}, {200,300}, {310,110}, {130,90}, {70,40} }; /**************/ const Window w = { 100, 400, 60, 200 }; /* Checks whether a point is inside or outside a window side */ int isInside(Point p, int side) { switch(side) { case LEFT: return p.x >= w.xmin; case RIGHT: return p.x <= w.xmax; case TOP: return p.y <= w.ymax; case BOTTOM: return p.y >= w.ymin; } } /* Calculates intersection of a segment and a window side */ Point intersection(Point p1, Point p2, int side) { Point temp; double slope, intercept; bool infinite; /* Find slope and intercept of segment, taking care of inf slope */ if(p2.x - p1.x != 0) { slope = (p2.y - p1.y) / (p2.x - p1.x); infinite = false; } else { infinite = true; } intercept = p1.y - p1.x * slope; /* Calculate intersections */ switch(side) { case LEFT: temp.x = w.xmin; temp.y = temp.x * slope + intercept; break; case RIGHT: temp.x = w.xmax; temp.y = temp.x * slope + intercept; break; case TOP: temp.y = w.ymax; temp.x = infinite ? p1.x : (temp.y - intercept) / slope; break; case BOTTOM: temp.y = w.ymin; temp.x = infinite ? p1.x : (temp.y - intercept) / slope; break; } return temp; } /* Clips polygon against a side, updating the point list (called once for each side) */ void clipAgainstSide(int sideToClip) { int i, j=0; Point s,p; Point outputList[MAXVERTICES]; /* Main algorithm */ s = pointList[numberOfVertices-1]; for(i=0 ; i<numberOfVertices ; i++) { p = pointList[i]; if(isInside(p, sideToClip)) { /* p inside */ if(!isInside(s, sideToClip)) { /* p inside, s outside */ outputList[j] = intersection(p, s, sideToClip); j++; } outputList[j] = p; j++; } else if(isInside(s, sideToClip)) { /* s inside, p outside */ outputList[j] = intersection(s, p, sideToClip); j++; } s = p; } /* Updating number of points and point list */ numberOfVertices = j; /* ERROR: In last call with BOTTOM argument, numberOfVertices becomes 0 */ /* all earlier 3 calls have correct output */ cout<<numberOfVertices<<endl; for(i=0 ; i<numberOfVertices ; i++) { pointList[i] = outputList[i]; } } void SutherlandHodgemanPolygonClip() { clipAgainstSide(LEFT); clipAgainstSide(RIGHT); clipAgainstSide(TOP); clipAgainstSide(BOTTOM); } void init() { glClearColor(1,1,1,0); glMatrixMode(GL_PROJECTION); gluOrtho2D(0,1000,0,500); } void display() { glClear(GL_COLOR_BUFFER_BIT); /* Displaying ORIGINAL box and polygon */ glColor3f(0,0,1); glBegin(GL_LINE_LOOP); glVertex2i(w.xmin, w.ymin); glVertex2i(w.xmin, w.ymax); glVertex2i(w.xmax, w.ymax); glVertex2i(w.xmax, w.ymin); glEnd(); glColor3f(1,0,0); glBegin(GL_LINE_LOOP); for(int i=0 ; i<numberOfVertices ; i++) { glVertex2i(pointList[i].x, pointList[i].y); } glEnd(); /* Clipping */ SutherlandHodgemanPolygonClip(); /* Displaying CLIPPED box and polygon, 500px right */ glColor3f(0,0,1); glBegin(GL_LINE_LOOP); glVertex2i(w.xmin+500, w.ymin); glVertex2i(w.xmin+500, w.ymax); glVertex2i(w.xmax+500, w.ymax); glVertex2i(w.xmax+500, w.ymin); glEnd(); glColor3f(1,0,0); glBegin(GL_LINE_LOOP); for(int i=0 ; i<numberOfVertices ; i++) { glVertex2i(pointList[i].x+500, pointList[i].y); } glEnd(); glFlush(); } int main(int argc, char** argv) { glutInit(&argc, argv); glutInitDisplayMode(GLUT_SINGLE | GLUT_RGB); glutInitWindowSize(1000,500); glutCreateWindow("Sutherland-Hodgeman polygon clipping"); init(); glutDisplayFunc(display); glutMainLoop(); return 0; }

    Read the article

  • sequence of events in ACCESS

    - by I__
    what is the proper way of doing the following: getting DATE as user input running a query generating a report that uses the query this is the solution i was thinking: have a form that takes user input run the query open the report what is the correct way of doing this?

    Read the article

  • Fibonnaci Sequence fast implementation

    - by user2947615
    I have written this function in Scala to calculate the fibonacci number given a particular index n: def fibonacci(n: Long): Long = { if(n <= 1) n else fibonacci(n - 1) + fibonacci(n - 2) } However it is not efficient when calculating with large indexes. Therefore I need to implement a function using a tuple and this function should return two consecutive values as the result. Can somebody give me any hints about this? I have never used Scala before. Thanks!

    Read the article

  • Execution sequence inside a jquery event handler

    - by user576358
    I have a big issue with the execution squence inside this jquery handler : Was wondering if anyone has come accross this before: I have a simple form: <form action='foo.cgi' id='myForm' > <input type=text name='name' /> <input type=submit value='Find it!'/> </form> when user clicks on Find it! would like to change the cursor to 'progress' before the data is returned through an ajax call: $(document).ready(function(){ $("#myForm ").submit(function(){ $("body").css("cursor", "progress") ; htmlobj=$.ajax({url:server_url,..........); } } However: The cursor [line 2 above ] does not change until data is returned through ajax - Seems like line 3. gets executed before 2. Any help is greatly appreciated

    Read the article

  • Javascript search and replace sequence of characters that contain square brackets

    - by Ruth
    Hello all I'm trying to search for '[EN]' in the string 'Nationality [EN] [ESP]', I want to remove this from the string so I'm using a replace method, code examaple below var str = 'Nationality [EN] [ESP]'; var find = "[EN]"; var regex = new RegExp(find, "g"); alert(str.replace(regex, '')); Since [EN] is identified as a character set this will output the string 'Nationality [] [ESP]' but I want to remove the square brackets aswell. I thought that I could escape them using \ but it didn't work Any advice would be much appreciated

    Read the article

  • find if list 1 is a sequence of list 2 in haskell

    - by Isaak Wahb
    im trying to check if a given list is a subsequence of another list: here are example of lists which gives true: subseq "" "w" subseq "w" "w" subseq "ab" "cab" subseq "cb" "cab" subseq "aa" "xaxa" not (subseq "aa" "xax") not (subseq "ab" "ba") i just come to this but in some cases it gives a wrong result subseq :: Eq a => [a] -> [a] -> Bool subseq [] [] = True subseq [] ys = True subseq xs [] = False subseq (x:xs) (y:ys) = x == y || subseq xs ( 1 `drop` ys )

    Read the article

  • Selecting a sequence of elements from the IList

    - by KhanS
    I have a IList. where the object PersonDetails consists of the persons name, address and phone number. The list consists of more than 1000 person details. I would like to display 50 PersonDetails per page. Is there a way to select only 50 elements from the list, and return them. For example. myList.select(1,50) myList.select(51, 100) I am able to select only first 50 by using. myList.Take(50); The entire list is at the wcf service, and i would like to get only fifty elements at a time.

    Read the article

  • Object initialization sequence in Objective-C

    - by Alex
    Hello everyone. The Cocoa framework has a convention to always call self = [super init] in the init method of an inherited class, because [super init] may return a new instance. What will happen if I do this? @interface MyClass : NSObject /* or any other class */ { int ivar_; } @end @implementation MyClass - (id)init { ivar_ = 12345; if ((self = [super init])) { NSLog(@"ivar_'s value is %d", ivar_); } return self; } @end In the case when [super init] returns a new instance, what will I see in the console? ivar_'s value is 0? I can't think of a way to check this myself, because I don't know which class may return a new instance from its init method. Also, can't seem to find explicit clarification for this scenario in the docs. Could anyone help me out? Thanks!

    Read the article

  • Can i execute the events in sequence in jquery

    - by Mirage
    I am using accordians. I want that if someone click on hyperlink inside the accordion , then that accordion should slide up slowly and only after that the nect accordion falls down or open $(".accord").live('click', function(){ $('#rr1').next().slideUp('slow'); $('#rr3').next().slideDown('slow'); But i have seen that the other accordion starts opening up at the same time when the other is closing. It it something related to asynchronous thing. I don't know });

    Read the article

  • Translate sequence in macro parameters to separate macros

    - by Alex Tiger
    How to acces each element in macro if the definition is like MACRO(name, seq) and the code is like: MACRO("TheName", (Elem1) (Elem2) (Elem3) ) I want to generate the next code: MACRO("TheName", ELEMMACRO(Elem1) ELEMMACRO(Elem2) ELEMMACRO(Elem3) ) Or something like that. In other words, I want to process every parameter separately (I don't care of definition, even if it will be something like MACRO("TheName", Elem1, Elem2, Elem3 ) There could be more elements, there could be less. I have tried V_ARGS (I need it only for gcc), but I can only copy all the elements by that, not to process them separately. What can I do? P.S. Because of some reasons, I can't use Boost.

    Read the article

  • jQuery sequence

    - by Happy
    $(".item").each(function(){ var item_link = $(this).find("a").attr("href"); $(this).prepend('<div class="img_url"></div>'); var img_url = $('div.img_url', this); $.get(item_link, function(data) { var src = $('.poster img', data).attr('src'); img_url.html(src); }); }); Each .get should be started after the previous is finished. Now all the .get start in one time. Any idea?

    Read the article

  • Python: Determine whether list of lists contains a defined sequence

    - by duhaime
    I have a list of sublists, and I want to see if any of the integer values from the first sublist plus one are contained in the second sublist. For all such values, I want to see if that value plus one is contained in the third sublist, and so on, proceeding in this fashion across all sublists. If there is a way of proceeding in this fashion from the first sublist to the last sublist, I wish to return True; otherwise I wish to return False. In other words, for each value in sublist one, for each "step" in a "walk" across all sublists read left to right, if that value + n (where n = number of steps taken) is contained in the current sublist, the function should return True; otherwise it should return False. (Sorry for the clumsy phrasing--I'm not sure how to clean up my language without using many more words.) Here's what I wrote. a = [ [1,3],[2,4],[3,5],[6],[7] ] def find_list_traversing_walk(l): for i in l[0]: index_position = 0 first_pass = 1 walking_current_path = 1 while walking_current_path == 1: if first_pass == 1: first_pass = 0 walking_value = i if walking_value+1 in l[index_position + 1]: index_position += 1 walking_value += 1 if index_position+1 == len(l): print "There is a walk across the sublists for initial value ", walking_value - index_position return True else: walking_current_path = 0 return False print find_list_traversing_walk(a) My question is: Have I overlooked something simple here, or will this function return True for all true positives and False for all true negatives? Are there easier ways to accomplish the intended task? I would be grateful for any feedback others can offer!

    Read the article

  • Unescape _xHHHH_ XML escape sequences using Python

    - by John Machin
    I'm using Python 2.x [not negotiable] to read XML documents [created by others] that allow the content of many elements to contain characters that are not valid XML characters by escaping them using the _xHHHH_ convention e.g. ASCII BEL aka U+0007 is represented by the 7-character sequence u"_x0007_". Neither the functionality that allows representation of any old character in the document nor the manner of escaping is negotiable. I'm parsing the documents using cElementTree or lxml [semi-negotiable]. Here is my best attempt at unescapeing the parser output as efficiently as possible: import re def unescape(s, subber=re.compile(r'_x[0-9A-Fa-f]{4,4}_').sub, repl=lambda mobj: unichr(int(mobj.group(0)[2:6], 16)), ): if "_" in s: return subber(repl, s) return s The above is biassed by observing a very low frequency of "_" in typical text and a better-than-doubling of speed by avoiding the regex apparatus where possible. The question: Any better ideas out there?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Replacing unversioned files in WiX major upgrade.

    - by Joshua
    I am still having this problem. This is the closest I have come to a solution that works, and yet it doesn't quite work. Here is (most of) the code: <Product Id='$(var.ProductCode)' UpgradeCode='$(var.UpgradeCode)' Name="Pathways" Version='$(var.ProductVersion)' Manufacturer='$(var.Manufacturer)' Language='1033'> Maximum="$(var.ProductVersion)" IncludeMaximum="no" Language="1033" Property="OLDAPPFOUND" / -- -- -- There is a later version of this program installed. The problem I am having is that I need the two files in the Database component to replace the previous copies. Since these files are unversioned, I have attempted to use the CompanionFile tag set to the PathwaysExe since that is the main executable of the application, and it IS being updated, even if the log says it isn't! The strangest thing about this is that the PathwaysLdf file IS BEING UPDATED CORRECTLY, and the PathwaysMdf file IS NOT. The log seems to indicate that the "Existing file is of an equal version (Checked using version of companion)". This is very strange because that file is being replaced just fine. The only idea I have left is that this problem has to do with the install sequence, and I'm not sure how to proceed! I have the InstallExecuteSequence set like I do because of the SettingsXml file, and my need to NOT overwrite that file, which is actually working now, so whatever solution works for the database files can't break the working settings file! ;) The full log is located at: http://pastebin.com/HFiGKuKN PLEASE AND THANK YOU!

    Read the article

< Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >