Search Results

Search found 10523 results on 421 pages for 'generator functions'.

Page 152/421 | < Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >

  • Using sigprocmask to implement locks

    - by EpsilonVector
    I'm implementing user threads in Linux kernel 2.4, and I'm using ualarm to invoke context switches between the threads. We have a requirement that our thread library's functions should be uninterruptable, so I looked into blocking signals and learned that using sigprocmask is the standard way to do this. However, it looks like I need to do quite a lot to implement this: sigset_t new_set, old_set; sigemptyset(&new_set); sigaddset(&new_set, SIGALRM); sigprocmask(SIG_BLOCK, &new_set, &old_set); This blocks SIGALARM but it does this with 3 function invocations! A lot can happen in the time it takes for these functions to run, including the signal being sent. The best idea I had to mitigate this was temporarily disabling ualarm, like this: sigset_t new_set, old_set; time=ualarm(0,0); sigemptyset(&new_set); sigaddset(&new_set, SIGALRM); sigprocmask(SIG_BLOCK, &new_set, &old_set); ualarm(time, 0); Which is fine except that this feels verbose. Isn't there a better way to do this?

    Read the article

  • Convert C function to Objective C or alternative way to include C library?

    - by Moshe
    Background: I'm new to Objective-C and I've never touched C before. I'm trying to include a C library in my iPhone/iPod Touch project and I could not successfully compile the library's source code using the included instructions, so I've resorted to including the .h and .c files in Xcode. The library is for Hebrew Dates and corresponding Jewish Holidays. It can be found here: http://sourceforge.net/projects/libhdate/ I cannot seem to import the .c files into my implementation files. I can import the .h files though. When I try to use #import "file.c", where file.c is a file that is in XCode, it doesn't work. Why not? I've considered just writing the functions over in Objective-C, albeit only my needed functions and not the whole library. How can I make the following C function work in Objective-C? Are there other things that need to be included/re-coded/compiled? How so? I am almost certain something is missing, but I'm not sure what. Code: int hdate_get_omer_day(hdate_struct const * h) { int omer_day; hdate_struct sixteen_nissan; hdate_set_hdate(&sixteen_nissan, 16, 7, h->hd_year); omer_day = h->hd_jd - sixteen_nissan.hd_jd + 1; if ((omer_day > 49) || (omer_day < 0)) omer_day = 0; return omer_day; } So... should I be converting it, or trying somehow to compile to an appropriate format and how so? (I don't know what format a static library should be in, by the way, or if it should be static... - I'm so lost here....) I appreciate the help!

    Read the article

  • C++ Pointer member function with templates assignment with a member function of another class

    - by Agusti
    Hi, I have this class: class IShaderParam{ public: std::string name_value; }; template<class TParam> class TShaderParam:public IShaderParam{ public: void (TShaderParam::*send_to_shader)( const TParam&,const std::string&); TShaderParam():send_to_shader(NULL){} TParam value; void up_to_shader(); }; typedef TShaderParam<float> FloatShaderParam; typedef TShaderParam<D3DXVECTOR3> Vec3ShaderParam; In another class, I have a vector of IShaderParams* and functions that i want to send to "send_to_shader". I'm trying assign the reference of these functions like this: Vec3ShaderParam *_param = new Vec3ShaderParam; _param-send_to_shader = &TShader::setVector3; This is the function: void TShader::setVector3(const D3DXVECTOR3 &vec, const std::string &name){ //... } And this is the class with IshaderParams*: class TShader{ std::vector params; public: Shader effect; std::string technique_name; TShader(std::string& afilename):effect(NULL){}; ~TShader(); void setVector3(const D3DXVECTOR3 &vec, const std::string &name); When I compile the project with Visual Studio C++ Express 2008 I recieve this error: Error 2 error C2440: '=' :can't make the conversion 'void (__thiscall TShader::* )(const D3DXVECTOR3 &,const std::string &)' a 'void (__thiscall TShaderParam::* )(const TParam &,const std::string &)' c:\users\isagoras\documents\mcv\afoc\shader.cpp 127 Can I do the assignment? No? I don't know how :-S Yes, I know that I can achieve the same objective with other techniques, but I want to know how can I do this..

    Read the article

  • Apples, oranges, and pointers to the most derived c++ class

    - by Matthew Lowe
    Suppose I have a bunch of fruit: class Fruit { ... }; class Apple : public Fruit { ... }; class Orange: public Fruit { ... }; And some polymorphic functions that operate on said fruit: void Eat(Fruit* f, Pesticide* p) { } void Eat(Apple* f, Pesticide* p) { ingest(f,p); } void Eat(Orange* f, Pesticide* p) { peel(f,p); ingest(f,p); } OK, wait. Stop right there. Note at this point that any sane person would make Eat() a virtual member function of the Fruit classes. But that's not an option, because I am not a sane person. Also, I don't want that Pesticide* in the header file for my fruit class. Sadly, what I want to be able to do next is exactly what member functions and dynamic binding allow: typedef list<Fruit*> Fruits; Fruits fs; ... for(Fruits::iterator i=fs.begin(), e=fs.end(); i!=e; ++i) Eat(*i); And obviously, the problem here is that the pointer we pass to Eat() will be a Fruit*, not an Apple* or an Orange*, therefore nothing will get eaten and we will all be very hungry. So what I really want to be able to do instead of this: Eat(*i); is this: Eat(MAGIC_CAST_TO_MOST_DERIVED_CLASS(*i)); But to my limited knowledge, such magic does not exist, except possibly in the form of a big nasty if-statement full of calls to dynamic_cast. So is there some run-time magic of which I am not aware? Or should I implement and maintain a big nasty if-statement full of dynamic_casts? Or should I suck it up, quit thinking about how I would implement this in Ruby, and allow a little Pesticide to make its way into my fruit header?

    Read the article

  • Modify existing struct alignment in Visual C++

    - by Crend King
    Is there a way to modify the member alignment of an existing struct in Visual C++? Here is the background: I use an 3rd-party library, which uses several structs. To fill up the structs, I pass the address of the struct instance to some functions. Unfortunately, the functions only returns unaligned buffer, so that data of some members are always wrong. /Zp is out of choice, since it breaks the other parts of the program. I know #pragma pack modifies the alignment of the following struct, but I do not want to copy the structs into my code, for the definitions in the library might change in the future. Sample code: test.h: struct am_aligned { BYTE data1[10]; ULONG data2; }; test.cpp: include "test.h" // typedef alignment(1) struct am_aligned am_unaligned int APIENTRY wWinMain(HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow) { char buffer[20] = {}; for (int i = 0; i < sizeof(unaligned_struct); i++) { buffer[i] = i; } am_aligned instance = *(am_aligned*) buffer; return 0; } instance.data2 is 0x0f0e0d0c, while 0x0d0c0b0a is desired. The commented line does not work of course. Thanks for help!

    Read the article

  • Unresolved external symbol error in c++

    - by Crystal
    I am trying to do a simple hw problem involving namespace, static data members and functions. I am getting an unresolved external symbol error Error 1 error LNK2001: unresolved external symbol "private: static double JWong::SavingsAccount::annualInterestRate" (?annualInterestRate@SavingsAccount@JWong@@0NA) SavingsAccount.obj SavingsAccount And I don't see why I am getting this error. Maybe I don't know something about static variables compared to regular data members that is causing this error. Here is my code: SavingsAccount.h file #ifndef JWONG_SAVINGSACCOUNT_H #define JWONG_SAVINGSACCOUNT_H namespace JWong { class SavingsAccount { public: // default constructor SavingsAccount(); // constructor SavingsAccount(double savingsBalance); double getSavingsBalance(); void setSavingsBalance(double savingsBalance); double calculateMonthlyInterest(); // static functions static void modifyInterestRate(double newInterestRate); static double getAnnualInterestRest(); private: double savingsBalance; // static members static double annualInterestRate; }; } #endif SavingsAccount.cpp file #include <iostream> #include "SavingsAccount.h" // default constructor, set savingsBalance to 0 JWong::SavingsAccount::SavingsAccount() : savingsBalance(0) {} // constructor JWong::SavingsAccount::SavingsAccount(double savingsBalance) : savingsBalance(savingsBalance) {} double JWong::SavingsAccount::getSavingsBalance() { return savingsBalance; } void JWong::SavingsAccount::setSavingsBalance(double savingsBalance) { this->savingsBalance = savingsBalance; } // returns monthly interest and sets savingsBalance to new amount double JWong::SavingsAccount::calculateMonthlyInterest() { double monthlyInterest = savingsBalance * SavingsAccount::annualInterestRate / 12; setSavingsBalance(savingsBalance + monthlyInterest); return monthlyInterest; } void JWong::SavingsAccount::modifyInterestRate(double newInterestRate) { SavingsAccount::annualInterestRate = newInterestRate; } double JWong::SavingsAccount::getAnnualInterestRest() { return SavingsAccount::annualInterestRate; }

    Read the article

  • How to write an intersects for Shapes in android

    - by Rafael T
    I have an written an Object called Shape which has a Point representing the topLeftCorner and a Dimension with represents its width and height. To get the topRightCorner I can simply add the width to the topLeftPoint.x. I use to rotate them on a certain degree around their center. The problem after the rotation is, that my intersects(Shape) method fails, because it does not honor the rotation of the Shapes. The rotation will be the same for each Shape. My current implementation looks like this inside my Shape Object: public boolean intersects(Shape s){ // functions returning a Point of shape s return intersects(s.topLeft()) || intersects(s.topRight()) || intersects(s.bottomLeft()) || intersects(s.bottomRight()) || intersects(s.leftCenter()) || intersects(s.rightCenter()) || intersects(s.center()); } public boolean intersects(Point p){ return p.x >= leftX() && p.x <= rightX() && p.y >= topY() && p.y <= bottomY(); } Basically I need functions like rotatedLeftX() or rotatedTopRight() to work properly. Also for that calculation I think it doesn't matter when the topLeft point before a rotation of ie 90 will turn into topRight... I already read this and this Question here, but do not understand it fully.

    Read the article

  • Different programming languages possibilities

    - by b-gen-jack-o-neill
    Hello. This should be very simple question. There are many programming languages out there, compiled into machine code or managed code. I first started with ASM back in high school. Assembler is very nice, since you know what exactly CPU does. Next, (as you can see from my other questions here) I decided to learn C and C++. I choosed C becouse from what I read it is the language with output most close to assembler-written programs. But, what I want to know is, can any other Windows programming language out there call win32 API? To be exact, like C has its special header and functions for win32 api interactions, is this assumed to be some important part of programming language? Or are there any languages that have no support for calling win32 API, or just use console to IO and some functions for basic file IO? Becouse, for Windows programming with graphic output, it is essential to have acess to win32 API. I know this question might seem silly, but still please, help me, I ask for study porposes. Thanks.

    Read the article

  • Low Level Console Input

    - by Soulseekah
    I'm trying to send commands to to the input of a cmd.exe application using the low level read/write console functions. I have no trouble reading the text (scraping) using the ReadConsole...() and WriteConsole() functions after having attached to the process console, but I've not figured out how to write for example "dir" and have the console interpret it as a sent command. Here's a bit of my code: CreateProcess(NULL, "cmd.exe", NULL, NULL, FALSE, CREATE_NEW_CONSOLE, NULL, NULL, &si, &pi); AttachConsole(pi.dwProcessId); strcpy(buffer, "dir"); WriteConsole(GetStdHandle(STD_INPUT_HANDLE), buffer, strlen(buffer), &charRead, NULL); STARTUPINFO attributes of the process are all set to zero, except, of course, the .cb attribute. Nothing changes on the screen, however I'm getting an Error 6: Invalid Handle returned from WriteConsole to STD_INPUT_HANDLE. If I write to (STD_OUTPUT_HANDLE) I do get my dir written on the screen, but nothing of course happens. I'm guessing SetConsoleMode() might be of help, but I've tried many mode combinations, nothing helped. I've also created a quick console application that waits for input (scanf()) and echoes back whatever goes in, didn't work. I've also tried typing into the scanf() promp and then peek into the input buffer using PeekConsoleInput(), returns 0, but the INPUT_RECORD array is empty. I'm aware that there is another way around this using WriteConsoleInput() to directly inject INPUT_RECORD structured events into the console, but this would be way too long, I'll have to send each keypress into it. I hope the question is clear. Please let me know if you need any further information. Thanks for your help.

    Read the article

  • Omit return type in C++0x

    - by Clinton
    I've recently found myself using the following macro with gcc 4.5 in C++0x mode: #define RETURN(x) -> decltype(x) { return x; } And writing functions like this: template <class T> auto f(T&& x) RETURN (( g(h(std::forward<T>(x))) )) I've been doing this to avoid the inconvenience having to effectively write the function body twice, and having keep changes in the body and the return type in sync (which in my opinion is a disaster waiting to happen). The problem is that this technique only works on one line functions. So when I have something like this (convoluted example): template <class T> auto f(T&& x) -> ... { auto y1 = f(x); auto y2 = h(y1, g1(x)); auto y3 = h(y1, g2(x)); if (y1) { ++y3; } return h2(y2, y3); } Then I have to put something horrible in the return type. Furthermore, whenever I update the function, I'll need to change the return type, and if I don't change it correctly, I'll get a compile error if I'm lucky, or a runtime bug in the worse case. Having to copy and paste changes to two locations and keep them in sync I feel is not good practice. And I can't think of a situation where I'd want an implicit cast on return instead of an explicit cast. Surely there is a way to ask the compiler to deduce this information. What is the point of the compiler keeping it a secret? I thought C++0x was designed so such duplication would not be required.

    Read the article

  • How can I send GET data to multiple URLs at the same time using cURL?

    - by Rob
    My apologies, I've actually asked this question multiple times, but never quite understood the answers. Here is my current code: while($resultSet = mysql_fetch_array($SQL)){ $ch = curl_init($resultSet['url'] . $fullcurl); //load the urls and send GET data curl_setopt($ch, CURLOPT_TIMEOUT, 2); //Only load it for two seconds (Long enough to send the data) curl_exec($ch); //Execute the cURL curl_close($ch); //Close it off } //end while loop What I'm doing here, is taking URLs from a MySQL Database ($resultSet['url']), appending some extra variables to it, just some GET data ($fullcurl), and simply requesting the pages. This starts the script running on those pages, and that's all that this script needs to do, is start those scripts. It doesn't need to return any output. Just the load the page long enough for the script to start. However, currently it's loading each URL (currently 11) one at a time. I need to load all of them simultaneously. I understand I need to use curl_multi_*, but I haven't the slightest idea on how cURL functions work, so I don't know how to change my code to use curl_multi_* in a while loop. So my questions are: How can I change this code to load all of the URLs simultaneously? Please explain it and not just give me code. I want to know what each individual function does exactly. Will curl_multi_exec even work in a while loop, since the while loop is just sending each row one at a time? And of course, any references, guides, tutorials about cURL functions would be nice, as well. Preferably not so much from php.net, as while it does a good job of giving me the syntax, its just a little dry and not so good with the explanations.

    Read the article

  • What is the rationale to not allow overloading of C++ conversions operator with non-member function

    - by Vicente Botet Escriba
    C++0x has added explicit conversion operators, but they must always be defined as members of the Source class. The same applies to the assignment operator, it must be defined on the Target class. When the Source and Target classes of the needed conversion are independent of each other, neither the Source can define a conversion operator, neither the Target can define a constructor from a Source. Usually we get it by defining a specific function such as Target ConvertToTarget(Source& v); If C++0x allowed to overload conversion operator by non member functions we could for example define the conversion implicitly or explicitly between unrelated types. template < typename To, typename From > operator To(const From& val); For example we could specialize the conversion from chrono::time_point to posix_time::ptime as follows template < class Clock, class Duration> operator boost::posix_time::ptime( const boost::chrono::time_point<Clock, Duration>& from) { using namespace boost; typedef chrono::time_point<Clock, Duration> time_point_t; typedef chrono::nanoseconds duration_t; typedef duration_t::rep rep_t; rep_t d = chrono::duration_cast<duration_t>( from.time_since_epoch()).count(); rep_t sec = d/1000000000; rep_t nsec = d%1000000000; return posix_time::from_time_t(0)+ posix_time::seconds(static_cast<long>(sec))+ posix_time::nanoseconds(nsec); } And use the conversion as any other conversion. For a more complete description of the problem, see here or on my Boost.Conversion library.. So the question is: What is the rationale to non allow overloading of C++ conversions operator with non-member functions?

    Read the article

  • How much is too much memory allocation in NDK?

    - by Maximus
    The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • memcmp,strcmp,strncmp in C

    - by el10780
    I wrote this small piece of code in C to test memcmp() strncmp() strcmp() functions in C. Here is the code that I wrote: #include <stdio.h> #include <stdlib.h> #include <string.h> int main(int argc, char** argv) { char *word1="apple",*word2="atoms"; if (strncmp(word1,word2,5)==0) printf("strncmp result.\n"); if (memcmp(word1,word2,5)==0) printf("memcmp result.\n"); if (strcmp(word1,word2)==0) printf("strcmp result.\n"); } Can somebody explain me the differences because I am confused with these three functions?My main problem is that I have a file in which I tokenize its line of it,the problem is that when I tokenize the word "atoms" in the file I have to stop the process of tokenizing.I first tried strcmp() but unfortunately when it reached to the point where the word "atoms" were placed in the file it didn't stop and it continued,but when I used either the memcmp() or the strncmp() it stopped and I was happy.But then I thought,what if there will be a case in which there is one string in which the first 5 letters are a,t,o,m,s and these are being followed by other letters.Unfortunately,my thoughts were right as I tested it using the above code by initializing word1 to "atomsaaaaa" and word2 to atoms and memcmp() and strncmp() in the if statements returned 0.On the other hand strcmp() it didn't.It seems that I must use strcmp(). I have done google searches but I got more confused as I have seen sites and other forums to define these three differently.If it is possible for someone to give me correct explanations/definitions so I can use them correctly in my source code,I would be really grateful.

    Read the article

  • Any utility to test expand C/C++ #define macros?

    - by Randy
    It seems I often spend way too much time trying to get a #define macro to do exactly what i want. I'll post my current delemia below and any help is appreciated. But really the bigger question is whether there is any utility someone could reccomend, to quickly display what a macro is actually doing? It seems like even the slow trial and error process would go much faster if I could see what is wrong. Currently, I'm dynamically loading a long list of functions from a DLL I made. The way I've set things up, the function pointers have the same nanes as the exported functions, and the typedef(s) used to prototyp them have the same names, but with a prepended underscor. So I want to use a define to simplfy assignments of a long long list of function pointers. For example, In the code statement below, 'hexdump' is the name of a typdef'd function point, and is also the name of the function, while _hexdump is the name of the typedef. If GetProcAddress() fails, a failure counter in incremented. if (!(hexdump = (_hexdump)GetProcAddress(h, "hexdump"))) --iFail; So lets say I'd like to rplace each line like the above with a macro, like this... GETADDR_FOR(hexdump ) Well this is the best I've come up with so far. It doesn't work (my // comment is just to prevent text formatting in the message)... // #define GETADDR_FOR(a) if (!(a = (#_#a)GetProcAddress(h, "/""#a"/""))) --iFail; And again, while I'd APPRECIATE an insight into what silly mistake I've made, it would make my day to have a utility that would show me the error of my ways, by simply plugging in my macro

    Read the article

  • python list/dict property best practice

    - by jterrace
    I have a class object that stores some properties that are lists of other objects. Each of the items in the list has an identifier that can be accessed with the id property. I'd like to be able to read and write from these lists but also be able to access a dictionary keyed by their identifier. Let me illustrate with an example: class Child(object): def __init__(self, id, name): self.id = id self.name = name class Teacher(object): def __init__(self, id, name): self.id = id self.name = name class Classroom(object): def __init__(self, children, teachers): self.children = children self.teachers = teachers classroom = Classroom([Child('389','pete')], [Teacher('829','bob')]) This is a silly example, but it illustrates what I'm trying to do. I'd like to be able to interact with the classroom object like this: #access like a list print classroom.children[0] #append like it's a list classroom.children.append(Child('2344','joe')) #delete from like it's a list classroom.children.pop(0) But I'd also like to be able to access it like it's a dictionary, and the dictionary should be automatically updated when I modify the list: #access like a dict print classroom.childrenById['389'] I realize I could just make it a dict, but I want to avoid code like this: classroom.childrendict[child.id] = child I also might have several of these properties, so I don't want to add functions like addChild, which feels very un-pythonic anyway. Is there a way to somehow subclass dict and/or list and provide all of these functions easily with my class's properties? I'd also like to avoid as much code as possible.

    Read the article

  • Best way to implement plugin framework - are DLLs the only way (C/C++ project)?

    - by Microkernel
    Introduction: I am currently developing a document classifier software in C/C++ and I will be using Naive-Bayesian model for classification. But I wanted the users to use any algorithm that they want(or I want in the future), hence I went to separate the algorithm part in the architecture as a plugin that will be attached to the main app @ app start-up. Hence any user can write his own algorithm as a plugin and use it with my app. Problem Statement: The way I am intending to develop this is to have each of the algorithms that user wants to use to be made into a DLL file and put into a specific directory. And at the start, my app will search for all the DLLs in that directory and load them. My Questions: (1) What if a malicious code is made as a DLL (and that will have same functions mandated by plugin framework) and put into my plugins directory? In that case, my app will think that its a plugin and picks it and calls its functions, so the malicious code can easily bring down my entire app down (In the worst case could make my app as a malicious code launcher!!!). (2) Is using DLLs the only way available to implement plugin design pattern? (Not only for the fear of malicious plugin, but its a generic question out of curiosity :) ) (3) I think a lot of softwares are written with plugin model for extendability, if so, how do they defend against such attacks? (4) In general what do you think about my decision to use plugin model for extendability (do you think I should look at any other alternatives?) Thank you -MicroKernel :)

    Read the article

  • Organising UI code in .NET forms

    - by sb3700
    Hi I'm someone who has taught myself programming, and haven't had any formal training in .NET programming. A while back, I started C# in order to develop a GUI program to control sensors, and the project has blossomed. I was just wondering how best to organise the code, particularly UI code, in my forms. My forms currently are a mess, or at least seem a mess to me. I have a constructor which initialises all the parameters and creates events. I have a giant State property, which updates the Enabled state of all my form control as users progress through the application (ie: disconnected, connected, setup, scanning) controlled by a States enum. I have 3-10 private variables accessed through properties, some of which have side-effects in changing the values of form elements. I have a lot of "UpdateXXX" functions to handle UI elements that depend on other UI elements - ie: if a sensor is changed, then change the baud rate drop down list. They are separated into regions I have a lot of events calling these Update functions I have a background worker which does all the scanning and analysis. My problem is this seems like a mess, particularly the State property, and is getting unmaintainable. Also, my application logic code and UI code are in the same file and to some degree, intermingled which seems wrong and means I need to do a lot of scrolling to find what I need. How do you structure your .net forms? Thanks

    Read the article

  • Fastest way to clamp a real (fixed/floating point) value?

    - by Niklas
    Hi, Is there a more efficient way to clamp real numbers than using if statements or ternary operators? I want to do this both for doubles and for a 32-bit fixpoint implementation (16.16). I'm not asking for code that can handle both cases; they will be handled in separate functions. Obviously, I can do something like: double clampedA; double a = calculate(); clampedA = a > MY_MAX ? MY_MAX : a; clampedA = a < MY_MIN ? MY_MIN : a; or double a = calculate(); double clampedA = a; if(clampedA > MY_MAX) clampedA = MY_MAX; else if(clampedA < MY_MIN) clampedA = MY_MIN; The fixpoint version would use functions/macros for comparisons. This is done in a performance-critical part of the code, so I'm looking for an as efficient way to do it as possible (which I suspect would involve bit-manipulation) EDIT: It has to be standard/portable C, platform-specific functionality is not of any interest here. Also, MY_MIN and MY_MAX are the same type as the value I want clamped (doubles in the examples above).

    Read the article

  • PHP modifying and combining array

    - by Industrial
    Hi everyone, I have a bit of an array headache going on. The function does what I want, but since I am not yet to well acquainted with PHP:s array/looping functions, so thereby my question is if there's any part of this function that could be improved from a performance-wise perspective? I tried to be as complete as possible in my descriptions in each stage of the functions which shortly described prefixes all keys in an array, fill up eventual empty/non-valid keys with '' and removes the prefixes before returning the array: $var = myFunction ( array('key1', 'key2', 'key3', '111') ); function myFunction ($keys) { $prefix = 'prefix_'; $keyCount = count($keys); // Prefix each key and remove old keys for($i=0;$i<$keyCount; $i++){ $keys[] = $prefix.$keys[$i]; unset($keys[$i]); } // output: array('prefix_key1', 'prefix_key2', 'prefix_key3', '111) // Get all keys from memcached. Only returns valid keys $items = $this->memcache->get($keys); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3) // note: key 111 was not found in memcache. // Fill upp eventual keys that are not valid/empty from memcache $return = $items + array_fill_keys($keys, ''); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3, 'prefix_111' => '') // Remove the prefixes for each result before returning array to application foreach ($return as $k => $v) { $expl = explode($prefix, $k); $return[$expl[1]] = $v; unset($return[$k]); } // output: array('key1' => 'value1', 'key2' => 'value2', 'key3'=>'value3, '111' => '') return $return; } Thanks a lot!

    Read the article

  • Specifying SOAP Headers for a Zend_Soap Service

    - by Stephen
    I have a generally straight forward web service that I've written (converting code to ZF from a Java implementation of the same service and trying to maintain the same wsdl structure as much as possible). The service loads a PHP class, rather than individual functions. The PHP class contains three different functions within it. Everything seems to be working just fine, except that I can't seem to figure out how to specify that a given function parameter should be passed as a SOAP header. I've not seen any mention of SOAP headers in the Server context, only how to pass header parameters with a client to a server. In addition to the standard parameters for the function that would be sent in the SOAP body and detailed in the docblock, I would like to specify two parameters (a username and password) that would be sent in a SOAP header. I have to assume this is possible, but haven't been able to find anything online, nor have I had any responses to a similar post on Zend's forum. Is there something that can be added in the docblock area to specify a parameter as a header (maybe in a similar fashion to using WebParam?)? Any suggestions/examples on how to get this accomplished would be greatly appreciated!

    Read the article

  • Finding What You Need in R: function arguments/parameters from outside the function's package

    - by doug
    Often in R, there are a dozen functions scattered across as many packages--all of which have the same purpose but of course differ in accuracy, performance, theoretical rigor, and so on. How do you gather all of these in one place before you start your task? So for instance: the generic plot function. Setting secondary ticks is much easier (IMHO) using a function outside of the base package, minor.tick(nx=n, ny=n, tick.ratio=n), found in Hmisc. Of course, that doesn't show up in plot's docstring. Likewise, the data-input arguments to 'plot' can be supplied by an object returned from the function 'hexbin', again, from a library outside of the base installation (where 'plot' resides). What would be great obviously is a programmatic way to gather these function arguments from the various libraries and put them in a single namespace. edit: (trying to re-state my example just above more clearly:) the arguments to plot supplied in the base package for, e.g., setting the axis tick frequency are xaxp/yaxp; however, one can also set a/t/f via a function outside of the base package, again, as in the minor.tick function from the Hmisc package--but you wouldn't know that just from looking at the plot method signature. Is there a meta function in R for this? So far, as i come across them, i've been manually gathering them in a TextMate 'snippet' (along with the attendant library imports). This isn't that difficult or time consuming, but i can only update my snippet as i find out about these additional arguments/parameters. Is there a canonical R way to do this, or at least an easier way? Just in case that wasn't clear, i am not talking about the case where multiple packages provide functions directed to the same statistic or view (e.g., 'boxplot' in the base package; 'boxplot.matrix' in gplots; and 'bplots' in Rlab). What i am talking is the case in which the function name is the same across two or more packages.

    Read the article

  • Sending one record from cursor to another function Postgres

    - by PylonsN00b
    FYI: I am completely new to using cursors... So I have one function that is a cursor: CREATE FUNCTION get_all_product_promos(refcursor, cursor_object_id integer) RETURNS refcursor AS ' BEGIN OPEN $1 FOR SELECT * FROM promos prom1 JOIN promo_objects ON (prom1.promo_id = promo_objects.promotion_id) WHERE prom1.active = true AND now() BETWEEN prom1.start_date AND prom1.end_date AND promo_objects.object_id = cursor_object_id UNION SELECT prom2.promo_id FROM promos prom2 JOIN promo_buy_objects ON (prom2.promo_id = promo_buy_objects.promo_id) LEFT JOIN promo_get_objects ON prom2.promo_id = promo_get_objects.promo_id WHERE (prom2.buy_quantity IS NOT NULL OR prom2.buy_quantity > 0) AND prom2.active = true AND now() BETWEEN prom2.start_date AND prom2.end_date AND promo_buy_objects.object_id = cursor_object_id; RETURN $1; END; ' LANGUAGE plpgsql; SO then in another function I call it and need to process it: ... --Get the promotions from the cursor SELECT get_all_product_promos('promo_cursor', this_object_id) updated := FALSE; IF FOUND THEN --Then loop through your results LOOP FETCH promo_cursor into this_promotion --Preform comparison logic -this is necessary as this logic is used in other contexts from other functions SELECT * INTO best_promo_results FROM get_best_product_promos(this_promotion, this_object_id, get_free_promotion, get_free_promotion_value, current_promotion_value, current_promotion); ... SO the idea here is to select from the cursor, loop using fetch (next is assumed correct?) and put the record fetched into this_promotion. Then send the record in this_promotion to another function. I can't figure out what to declare the type of this_promotion in get_best_product_promos. Here is what I have: CREATE OR REPLACE FUNCTION get_best_product_promos(this_promotion record, this_object_id integer, get_free_promotion integer, get_free_promotion_value numeric(10,2), current_promotion_value numeric(10,2), current_promotion integer) RETURNS... It tells me: ERROR: plpgsql functions cannot take type record OK first I tried: CREATE OR REPLACE FUNCTION get_best_product_promos(this_promotion get_all_product_promos, this_object_id integer, get_free_promotion integer, get_free_promotion_value numeric(10,2), current_promotion_value numeric(10,2), current_promotion integer) RETURNS... Because I saw some syntax in the Postgres docs showed a function being created w/ a input parameter that had a type 'tablename' this works, but it has to be a tablename not a function :( I know I am so close, I was told to use cursors to pass records around. So I studied up. Please help.

    Read the article

  • Calling function after .load (Jquery)

    - by Matt
    Having a little difficulty getting a function to call after a .load: $(function(){ $('a.pageFetcher').click(function(){ $('#main').load($(this).attr('rel')); }); }); The page loads, but the functions don't fire: $(function(){ var $container = $('#container'); $container.imagesLoaded(function(){ $container.masonry({ itemSelector: '.box', }); }); $container.infinitescroll({ navSelector : '#page-nav', nextSelector : '#page-nav a', itemSelector : '.box', loading: { finishedMsg: 'Nothing else to load.', img: 'http://i.imgur.com/6RMhx.gif' } }, function( newElements ) { $.superbox.settings = { closeTxt: "Close this", loadTxt: "Loading your selection", nextTxt: "Next item", prevTxt: "Previous item" }; $.superbox(); var $newElems = $( newElements ).css({ opacity: 0 }); $newElems.imagesLoaded(function(){ $newElems.animate({ opacity: 1 }); $container.masonry( 'appended', $newElems, true ); }); } ); }); I've attempted to combine them so that the 2nd functions are called after .load (after doing some searching on this site and looking at given answers/examples) but nothing seems to work properly. Suggestions?

    Read the article

< Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >