Search Results

Search found 43200 results on 1728 pages for 'large object pattern'.

Page 153/1728 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • refactor LINQ TO SQL custom properties that instantiate datacontext

    - by Thiago Silva
    I am working on an existing ASP.NET MVC app that started small and has grown with time to require a good re-architecture and refactoring. One thing that I am struggling with is that we've got partial classes of the L2S entities so we could add some extra properties, but these props create a new data context and query the DB for a subset of data. This would be the equivalent to doing the following in SQL, which is not a very good way to write this query as oppsed to joins: SELECT tbl1.stuff, (SELECT nestedValue FROM tbl2 WHERE tbl2.Foo = tbl1.Bar), tbl1.moreStuff FROM tbl1 so in short here's what we've got in some of our partial entity classes: public partial class Ticket { public StatusUpdate LastStatusUpdate { get { //this static method call returns a new DataContext but needs to be refactored var ctx = OurDataContext.GetContext(); var su = Compiled_Query_GetLastUpdate(ctx, this.TicketId); return su; } } } We've got some functions that create a compiled query, but the issue is that we also have some DataLoadOptions defined in the DataContext, and because we instantiate a new datacontext for getting these nested property, we get an exception "Compiled Queries across DataContexts with different LoadOptions not supported" . The first DataContext is coming from a DataContextFactory that we implemented with the refactorings, but this second one is just hanging off the entity property getter. We're implementing the Repository pattern in the refactoring process, so we must stop doing stuff like the above. Does anyone know of a good way to address this issue?

    Read the article

  • "User Friendly" .net compatible Regex/Text matching tools?

    - by Binary Worrier
    Currently in our software we provide a hook where we call a DLL built by our clients to parse information out of documents we are processing (the DLL takes in some text (or a file) and returns a list of name/value pairs). e.g. We're given a Word doc or Text file to Archive. We do various things to the file, and call a DLL that will return "pertinent" information about the file. Among other things we store that "pertinent" data for posterity. What is considered "pertinent" depends on the client and the type of the document, we don't care, we get it and store it. I've been asked to develop a user friendly "something" that will allow a non-programmer user to "configure" how to get this data from a plain text document (<humor>The user story ends with the helpful suggestion/query "We could use regex for this?"</humor>) It's safe to assume that a list of regex's isn't going to cut this, I've written some of these parsers for customers, the regex's to do these would be hedious and some of them can't be done by regex's. Also one of the requirements above is "user friendly" which negates anything that has users seeing or editing regex expressions. As you can guess, I don't have a fortune of time to do this, and am wondering is there anything out there that I can plug in to our app that has a nice front end and does exactly what I need? :) No? Whadda mean no! . . . sigh Ok then failing that, anything out there that "visually" builds regex's and/or other pattern matching expressions, and then allows one to run those expressions against some text? The MS BRE will do what I want, but I need something prettier that looks less like code. Thanks guys,

    Read the article

  • Facade Design Patterns and Subclassing

    - by Code Sherpa
    Hi. I am using a facade design pattern for a C# program. The program basically looks like this... public class Api { #region Constants private const int version = 1; #endregion #region Private Data private XProfile _profile; private XMembership _membership; private XRoles _role; #endregion Private Data public Api() { _membership = new XMembership(); _profile = new XProfile(); _role = new XRoles(); } public int GetUserId(string name) { return _membership.GetIdByName(name); } } Now, as I would like subclass my methods into three categories: Role, Profile, and Member. This will be easier on the developers eye because both Profile and Membership expose a lot of methods that look similar (and a few by Role). For example, getting a user's ID would look like: int _id = Namespace.Api.Member.GetUserId("Henry222"); Can somebody "illustrate" how subclassing should work in this case to achieve the effect I am looking for? Thanks in advance.

    Read the article

  • Factory Method Implementation

    - by cedar715
    I was going through the 'Factory method' pages in SO and had come across this link. And this comment. The example looked as a variant and thought to implement in its original way: to defer instantiation to subclasses... Here is my attempt. Does the following code implements the Factory pattern of the example specified in the link? Please validate and suggest if this has to undergo any re-factoring. public class ScheduleTypeFactoryImpl implements ScheduleTypeFactory { @Override public IScheduleItem createLinearScheduleItem() { return new LinearScheduleItem(); } @Override public IScheduleItem createVODScheduleItem() { return new VODScheduleItem(); } } public class UseScheduleTypeFactory { public enum ScheduleTypeEnum { CableOnDemandScheduleTypeID, BroadbandScheduleTypeID, LinearCableScheduleTypeID, MobileLinearScheduleTypeID } public static IScheduleItem getScheduleItem(ScheduleTypeEnum scheduleType) { IScheduleItem scheduleItem = null; ScheduleTypeFactory scheduleTypeFactory = new ScheduleTypeFactoryImpl(); switch (scheduleType) { case CableOnDemandScheduleTypeID: scheduleItem = scheduleTypeFactory.createVODScheduleItem(); break; case BroadbandScheduleTypeID: scheduleItem = scheduleTypeFactory.createVODScheduleItem(); break; case LinearCableScheduleTypeID: scheduleItem = scheduleTypeFactory.createLinearScheduleItem(); break; case MobileLinearScheduleTypeID: scheduleItem = scheduleTypeFactory.createLinearScheduleItem(); break; default: break; } return scheduleItem; } }

    Read the article

  • Regular expression to match empty HTML tags that may contain embedded JSTL?

    - by Keith Bentrup
    I'm trying to construct a regular expression to look for empty html tags that may have embedded JSTL. I'm using Perl for my matching. So far I can match any empty html tag that does not contain JSTL with the following? /<\w+\b(?!:)[^<]*?>\s*<\/\w+/si The \b(?!:) will avoid matching an opening JTSL tag but that doesn't address the whether JSTL may be within the HTML tag itself (which is allowable). I only want to know if this HTML tag has no children (only whitespace or empty). So I'm looking for a pattern that would match both the following: <div id="my-id"> </div> <div class="<c:out var="${my.property}" />"></div> Currently the first div matches. The second does not. Is it doable? I tried several variations using lookahead assertions, and I'm starting to think it's not. However, I can't say for certain or articulate why it's not. Edit: I'm not writing something to interpret the code, and I'm not interested in using a parser. I'm writing a script to point out potential issues/oversights. And at this point, I'm curious, too, to see if there is something clever with lookaheads or lookbehinds that I may be missing. If it bothers you that I'm trying to "solve" a problem this way, don't think of it as looking for a solution. To me it's more of a challenge now, and an opportunity to learn more about regular expressions. Also, if it helps, you can assume that the html is xhtml strict.

    Read the article

  • How should I handle this Optimistic Concurrency error in this Entity Framework code, I have?

    - by Pure.Krome
    Hi folks, I have the following pseduo code in some Repository Pattern project that uses EF4. public void Delete(int someId) { // 1. Load the entity for that Id. If there is none, then null. // 2. If entity != null, then DeleteObject(..); } Pretty simple but I'm getting a run-time error:- ConcurrencyException: Store, Update, Insert or Delete statement affected an unexpected number of rows (0). Now, this is what is happening :- Two instances of EF4 are running inthe app at the same time. Instance A calls delete. Instance B calls delete a nano second later. Instance A loads the entity. Instance B also loads the entity. Instance A now deletes that entity - cool bananas. Instance B tries to delete the entity, but it's already gone. As such, the no-count or what not is 0, when it expected 1 .. or something like that. Basically, it figured out that the item it is suppose to delete, didn't delete (because it happened a split sec ago). I'm not sure if this is like a race-condition or something. Anyways, is there any tricks I can do here so the 2nd call doesn't crash? I could make it into a stored procedure.. but I'm hoping to avoid that right now. Any ideas? I'm wondering If it's possible to lock that row (and that row only) when the select is called ... forcing Instance B to wait until the row lock has been relased. By that time, the row is deleted, so when Instance B does it's select, the data is not there .. so it will never delete.

    Read the article

  • How to use the LINQ where expression?

    - by NullReference
    I'm implementing the service \ repository pattern in a new project. I've got a base interface that looks like this. Everything works great until I need to use the GetMany method. I'm just not sure how to pass a LINQ expression into the GetMany method. For example how would I simply sort a list of objects of type name? nameRepository.GetMany( ? ) public interface IRepository<T> where T : class { void Add(T entity); void Update(T entity); void Delete(T entity); void Delete(Expression<Func<T, bool>> where); T GetById(long Id); T GetById(string Id); T Get(Expression<Func<T, bool>> where); IEnumerable<T> GetAll(); IEnumerable<T> GetMany(Expression<Func<T, bool>> where); } public virtual IEnumerable<T> GetMany(Expression<Func<T, bool>> where) { return dbset.Where(where).ToList(); }

    Read the article

  • Double hashing passwords - client & server

    - by J. Stoever
    Hey, first, let me say, I'm not asking about things like md5(md5(..., there are already topics about it. My question is this: We allow our clients to store their passwords locally. Naturally, we don't want them stored in plan text, so we hmac them locally, before storing and/or sending. Now, this is fine, but if this is all we did, then the server would have the stored hmac, and since the client only needs to send the hmac, not the plain text password, an attacker could use the stored hashes from the server to access anyone's account (in the catastrophic scenario where someone would get such an access to the database, of course). So, our idea was to encode the password on the client once via hmac, send it to the server, and there encode it a second time via hmac and match it against the stored, two times hmac'ed password. This would ensure that: The client can store the password locally without having to store it as plain text The client can send the password without having to worry (too much) about other network parties The server can store the password without having to worry about someone stealing it from the server and using it to log in. Naturally, all the other things (strong passwords, double salt, etc) apply as well, but aren't really relevant to the question. The actual question is: does this sound like a solid security design ? Did we overlook any flaws with doing things this way ? Is there maybe a security pattern for something like this ?

    Read the article

  • F# How to tokenise user input: separating numbers, units, words?

    - by David White
    I am fairly new to F#, but have spent the last few weeks reading reference materials. I wish to process a user-supplied input string, identifying and separating the constituent elements. For example, for this input: XYZ Hotel: 6 nights at 220EUR / night plus 17.5% tax the output should resemble something like a list of tuples: [ ("XYZ", Word); ("Hotel:", Word); ("6", Number); ("nights", Word); ("at", Operator); ("220", Number); ("EUR", CurrencyCode); ("/", Operator); ("night", Word); ("plus", Operator); ("17.5", Number); ("%", PerCent); ("tax", Word) ] Since I'm dealing with user input, it could be anything. Thus, expecting users to comply with a grammar is out of the question. I want to identify the numbers (could be integers, floats, negative...), the units of measure (optional, but could include SI or Imperial physical units, currency codes, counts such as "night/s" in my example), mathematical operators (as math symbols or as words including "at" "per", "of", "discount", etc), and all other words. I have the impression that I should use active pattern matching -- is that correct? -- but I'm not exactly sure how to start. Any pointers to appropriate reference material or similar examples would be great.

    Read the article

  • Project Naming Convention Feedback Please

    - by Sam Striano
    I am creating a ASP.NET MVC 3 application using Entity Framework 4. I am using the Repository/Service Pattern and was looking for feedback. I currently have the following: MVC Application (GTG.dll) GTG GTG.Controllers GTG.ViewModels Business POCO's (GTG.Business.dll) This contains all business objects (Customer, Order, Invoice, etc...) EF Model/Repositories (GTG.Data.dll) GTG.Business (GTG.Context.tt) I used the Entity POCO Generator Templates. GTG.Data.Repositories Service Layer (GTG.Data.Services.dll) GTG.Data.Services - Contains all of the service objects, one per aggregate root. The following is a little sample code: Controller Namespace Controllers Public Class HomeController Inherits System.Web.Mvc.Controller Function Index() As ActionResult Return View(New Models.HomeViewModel) End Function End Class End Namespace Model Namespace Models Public Class HomeViewModel Private _Service As CustomerService Public Property Customers As List(Of Customer) Public Sub New() _Service = New CustomerService _Customers = _Service.GetCustomersByBusinessName("Striano") End Sub End Class End Namespace Service Public Class CustomerService Private _Repository As ICustomerRepository Public Sub New() _Repository = New CustomerRepository End Sub Function GetCustomerByID(ByVal ID As Integer) As Customer Return _Repository.GetByID(ID) End Function Function GetCustomersByBusinessName(ByVal Name As String) As List(Of Customer) Return _Repository.Query(Function(x) x.CompanyName.StartsWith(Name)).ToList End Function End Class Repository Namespace Data.Repositories Public Class CustomerRepository Implements ICustomerRepository Public Sub Add(ByVal Entity As Business.Customer) Implements IRepository(Of Business.Customer).Add End Sub Public Sub Delete(ByVal Entity As Business.Customer) Implements IRepository(Of Business.Customer).Delete End Sub Public Function GetByID(ByVal ID As Integer) As Business.Customer Implements IRepository(Of Business.Customer).GetByID Using db As New GTGContainer Return db.Customers.FirstOrDefault(Function(x) x.ID = ID) End Using End Function Public Function Query(ByVal Predicate As System.Linq.Expressions.Expression(Of System.Func(Of Business.Customer, Boolean))) As System.Linq.IQueryable(Of Business.Customer) Implements IRepository(Of Business.Customer).Query Using db As New GTGContainer Return db.Customers.Where(Predicate) End Using End Function Public Sub Save(ByVal Entity As Business.Customer) Implements IRepository(Of Business.Customer).Save End Sub End Class End Namespace

    Read the article

  • Store Business Rules in XML Document, Validate afterwards in Java, how?

    - by JavaPete
    Example XML Rules document: <user> <username> <not-null/> <capitals value="false"/> <max-length value="15"/> </username> <email> <not-null/> <isEmail/> <max-length value="40"/> </email> </user> How do I implement this? I'm starting from scratch, what I currently have is a User-class, and a UserController which saves the User object in de DB (through a Service-layer and Dao-layer), basic Spring MVC. I can't use Spring MVC Validation however in our Model-classes, I have to use an XML document so an Admin can change the rules I think I need a pattern which dynamically builds an algorithm based on what is provided by the XML Rules document, but I can't seem to think of anything other than a massive amount of if-statements. I also have nothing for the parsing yet and I'm not sure how I'm gonna (de)couple it from the actual implementation of the validation-process.

    Read the article

  • Should Service Depend on Many Repositories, or Break Them Up?

    - by Josh Pollard
    I'm using a repository pattern for my data access. So I basically have a repository per table/class. My UI currently uses service classes to actually get things done, and these service classes wrap, and therefore depend on repositories. In many cases my services are only dependent upon one or two repositories, so things aren't too crazy. Unfortunately, one of my forms in the UI expects the user to enter data that will span five different tables. For this form I made a single service class that depends upon five repositories. Then the methods within the service for saving and loading the data call the appropriate methods on all of the corresponding repositories. As you can imagine, the save and load methods in this service are really big. Also, unit testing this service is getting really difficult because I have to setup so many fake repositories. Would it have been a better choice to break this single service apart into a few smaller services? It would put more code at the UI layer, but would make the services smaller and more testable.

    Read the article

  • Given the presentation model pattern, is the view, presentation model, or model responsible for adding child views to an existing view at runtime?

    - by Ryan Taylor
    I am building a Flex 4 based application using the presentation model design pattern. This application will have several different components to it as shown in the image below. The MainView and DashboardView will always be visible and they each have corresponding presentation models and models as necessary. These views are easily created by declaring their MXML in the application root. <s:HGroup width="100%" height="100%"> <MainView width="75% height="100%"/> <DashboardView width="25%" height="100%"/> </s:HGroup> There will also be many WidgetViewN views that can be added to the DashboardView by the user at runtime through a simple drop down list. This will need to be accomplished via ActionScript. The drop down list should always show what WidgetViewN has already been added to the DashboardView. Therefore some state about which WidgetViewN's have been created needs to be stored. Since the list of available WidgetViewN and which ones are added to the DashboardView also need to be accessible from other components in the system I think this needs to be stored in a Model object. My understanding of the presentation model design pattern is that the view is very lean. It contains as close to zero logic as is practical. The view communicates/binds to the presentation model which contains all the necessary view logic. The presentation model is effectively an abstract representation of the view which supports low coupling and eases testability. The presentation model may have one or more models injected in in order to display the necessary information. The models themselves contain no view logic whatsoever. So I have a several questions around this design. Who should be responsible for creating the WidgetViewN components and adding these to the DashboardView? Is this the responsibility of the DashboardView, DashboardPresentationModel, DashboardModel or something else entirely? It seems like the DashboardPresentationModel would be responsible for creating/adding/removing any child views from it's display but how do you do this without passing in the DashboardView to the DashboardPresentationModel? The list of available and visible WidgetViewN components needs to be accessible to a few other components as well. Is it okay for a reference to a WidgetViewN to be stored/referenced in a model? Are there any good examples of the presentation model pattern online in Flex that also include creating child views at runtime?

    Read the article

  • Is there a name for this functional programming construct/pattern?

    - by dietbuddha
    I wrote a function and I'd like to find out if it is an implementation of some functional programming pattern or construct. I'd like to find out the name of this pattern or construct (if it exists)? I have a function which takes a list of functions and does this to them: wrap(fn1, fn2, fn3, fn4) # returns partial(fn4, partial(fn3, partial(fn2, fn1))) There are strong similarities to compose, reduce, and other fp metaprogramming constructs, since the functions are being arranged together and returned as one function. It also has strong similarities to decorators and Python context managers since it provides a way to encapsulate pre and post execution behaviors in one function. Which was the impetus for writing this function. I wanted the ability that context managers provide, but I wanted to be able to have it defined in one function, and to be able to layer function after function on top.

    Read the article

  • Does this factory method pattern example violate open-close?

    - by William
    In Head-First Design Patterns, they use a pizza shop example to demonstrate the factory method pattern. public abstract class PizzaStore { public Pizza orderPizza(String type) { Pizza pizza; pizza = createPizza(type); pizza.prepare(); pizza.bake(); pizza.cut(); pizza.box(); return pizza; } abstract Pizza createPizza(String type) } public class NYPizzaStore extends PizzaStore { Pizza createPizza(String item) { if (item.equals("cheese") { return new NYStyleCheesePizza(); } else if (item.equals("veggie")) { return new NYStyleVeggiePizza(); } else if (item.equals("clam")) { return new NYStyleClamPizza(); } else if (item.equals("pepperoni")) { return new NYStylePepperioniPizza(); } else return null; } } I don't understand how this pattern is not violating open-close. What if we require a beef Pizza, then we must edit the if statement in the NYPizzaStore class.

    Read the article

  • Is there a 'design pattern' type listing of common algorithms?

    - by KevinM1
    Is there a 'design pattern' styled listing of common/popular algorithms anywhere? Specifically, something that has a similar format along the lines of: Algorithm Name: e.g., Quick Sort, Bubble Sort, etc. Problem: A description of the stereotypical problem the algorithm is supposed to address Description: Description of the solution Implementation: Code examples of the solution Big O Rating: Self-explanatory Similar Algorithms: Algorithms that address the same problem in different ways, or similar problems I really like the GoF design pattern listing style, and I think it would help me learn various algorithms better/easier if I could find a resource that was similar in terms of organization.

    Read the article

  • [C#] Not enough memory or not enough handles?

    - by Nayan
    I am working on a large scale project where a custom (pretty good and robust) framework has been provided and we have to use that for showing up forms and views. There is abstract class StrategyEditor (derived from some class in framework) which is instantiated whenever a new StrategyForm is opened. StrategyForm (a customized window frame) contains StrategyEditor. StrategyEditor contains StrategyTab. StrategyTab contains StrategyCanvas. This is a small portion of the big classes to clarify that there are many objects that will be created if one StrategyForm object is allocated in memory at run-time. My component owns all these classes mentioned above except StrategyForm whose code is not in my control. Now, at run-time, user opens up many strategy objects (which trigger creation of new StrategyForm object.) After creating approx. 44 strategy objects, we see that the USER OBJECT HANDLES (I'll use UOH from here onwards) created by the application reaches to about 20k+, while in registry the default amount for handles is 10k. Read more about User Objects here. Testing on different machines made it clear that the number of strategy objects opened is different for message to pop-up - on one m/c if it is 44, then it can be 40 on another. When we see the message pop-up, it means that the application is going to respond slowly. It gets worse with few more objects and then creation of window frames and subsequent objects fail. We first thought that it was not-enough-memory issue. But then reading more about new in C# helped in understanding that an exception would be thrown if app ran out of memory. This is not a memory issue then, I feel (task manager also showed 1.5GB+ available memory.) M/C specs Core 2 Duo 2GHz+ 4GB RAM 80GB+ free disk space for page file Virtual Memory set: 4000 - 6000 My questions Q1. Does this look like a memory issue and I am wrong that it is not? Q2. Does this point to exhaustion of free UOHs (as I'm thinking) and which is resulting in failure of creation of window handles? Q3. How can we avoid loading up of an StrategyEditor object (beyond a threshold, keeping an eye on the current usage of UOHs)? (we already know how to fetch number of UOHs in use, so don't go there.) Keep in mind that the call to new StrategyForm() is outside the control of my component. Q4. I am bit confused - what are Handles to user objects exactly? Is MSDN talking about any object that we create or only some specific objects like window handles, cursor handles, icon handles? Q5. What exactly cause to use up a UOH? (almost same as Q4) I would be really thankful to anyone who can give me some knowledgeable answers. Thanks much! :)

    Read the article

  • BlockingQueue decorator that logs removed objects

    - by scompt.com
    I have a BlockingQueue that's being used in a producer-consumer situation. I would like to decorate this queue so that every object that's taken from it is logged. I know what the straightforward implementation would look like: simply implement BlockingQueue and accept a BlockingQueue in the constructor to which all of the methods would delegate. Is there another way that I'm missing? A library perhaps? Something with a callback interface?

    Read the article

  • How do I select all parenting items based on a given node's attribute in php's xPath?

    - by bakkelun
    I have an XML feed that looks something like this (excerpt): <channel> <title>Channel Name</title> <link>Link to the channel</link> <item> <title>Heading 1</title> <link>http://www.somelink.com?id=100</link> <description><![CDATA[ Text here ]]></description> <publishDate>Fri, 03 Apr 2009 10:00:00</publishDate> <guid>http://www.somelink.com/read-story-100</guid> <category domain="http://www.somelink.com/?category=4">Category 1</category> </item> <item> <title>Heading 2</title> <link>http://www.somelink.com?id=110</link> <description><![CDATA[ Text here ]]></description> <publishDate>Fri, 03 Apr 2009 11:00:00</publishDate> <guid>http://www.somelink.com/read-story-110</guid> <category domain="http://www.somelink.com/?category=4">Category 1</category> </item> <channel> That's the rough of it. I'm using this piece of PHP (excerpt): $xml = simple_xml_load_file($xmlFile); $xml->xpath($pattern); Now I want to get all ITEM-nodes (with their children) based on that pesky "domain" attribute in the category node, but no matter what I try it does-not-work. The closest I got was "//category[@domain= 'http://www.somelink.com/?category=4']" The expression I tried gave me this result: [0] => SimpleXMLElement Object ( [@attributes] => Array ( [domain] => http://www.somelink.com/?category=4 ) [0] => Category 1 [1] => SimpleXMLElement Object ( [@attributes] => Array ( [domain] => http://www.somelink.com/?category=4 ) [0] => Category 1 The expression should contain all childrens of the two items in the example, but as you can see only the info in the category node is present, I want all the item nodes. Any help would be highly appreciated.

    Read the article

  • Handling incremental Data Modeling Changes in Functional Programming

    - by Adam Gent
    Most of the problems I have to solve in my job as a developer have to do with data modeling. For example in a OOP Web Application world I often have to change the data properties that are in a object to meet new requirements. If I'm lucky I don't even need to programmatically add new "behavior" code (functions,methods). Instead I can declarative add validation and even UI options by annotating the property (Java). In Functional Programming it seems that adding new data properties requires lots of code changes because of pattern matching and data constructors (Haskell, ML). How do I minimize this problem? This seems to be a recognized problem as Xavier Leroy states nicely on page 24 of "Objects and Classes vs. Modules" - To summarize for those that don't have a PostScript viewer it basically says FP languages are better than OOP languages for adding new behavior over data objects but OOP languages are better for adding new data objects/properties. Are there any design pattern used in FP languages to help mitigate this problem? I have read Phillip Wadler's recommendation of using Monads to help this modularity problem but I'm not sure I understand how?

    Read the article

  • WCF Streaming not working at server

    - by Radhi
    hi, i have used WCF service to transfer large files in chunks to the server for that i have reference this article http://kjellsj.blogspot.com/2007/02/wcf-streaming-upload-files-over-http.html i have configured my application on IIS on my machine. its work fine here. it allows upto 64mb file upload but when we have published the site. it allows only maximum 30Mb file if i try to upload more than that i got error 404 - resource not found. here is the binding config i have used. <basicHttpBinding> <!-- buffer: 64KB; max size: 64MB --> <binding name="FileTransferServicesBinding" closeTimeout="00:01:00" openTimeout="00:01:00" receiveTimeout="00:10:00" sendTimeout="00:01:00" transferMode="Streamed" messageEncoding="Mtom" maxBufferSize="65536" maxReceivedMessageSize="67108864"> <security mode="None"> <transport clientCredentialType="None"/> </security> </binding> </basicHttpBinding> please suggest me where i am missing anything. and if required more code please let me know -thanks in advance

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • XML streaming with XProc.

    - by Pierre
    Hi all, I'm playing with xproc, the XML pipeline language and http://xmlcalabash.com/. I'd like to find an example for streaming large xml documents. for example, given the following huge xml document: <Books> <Book> <title>Book-1</title> </Book> <Book> <title>Book-2</title> </Book> <Book> <title>Book-3</title> </Book> <!-- many many.... --> <Book> <title>Book-N</title> </Book> </Books> How should I proceed to loop (streaming) over x-N documents like <Books> <Book> <title>Book-x</title> </Book> </Books> and treat each document with a xslt ? is it possible with xproc ?

    Read the article

  • Unable to load huge XML document (incorrectly suppose it's due to the XSLT processing)

    - by krisvandenbergh
    I'm trying to match certain elements using XSLT. My input document is very large and the source XML fails to load after processing the following code (consider especially the first line). <xsl:template match="XMI/XMI.content/Model_Management.Model/Foundation.Core.Namespace.ownedElement/Model_Management.Package/Foundation.Core.Namespace.ownedElement"> <rdf:RDF> <rdf:Description rdf:about=""> <xsl:for-each select="Foundation.Core.Class"> <xsl:for-each select="Foundation.Core.ModelElement.name"> <owl:Class rdf:ID="@Foundation.Core.ModelElement.name" /> </xsl:for-each> </xsl:for-each> </rdf:Description> </rdf:RDF> </xsl:template> Apparently the XSLT fails to load after "Model_Management.Model". The PHP code is as follows: if ($xml->loadXML($source_xml) == false) { die('Failed to load source XML: ' . $http_file); } It then fails to perform loadXML and immediately dies. I think there are two options now. 1) I should set a maximum executing time. Frankly, I don't know how that I do this for the built-in PHP 5 XSLT processor. 2) Think about another way to match. What would be the best way to deal with this? The input document can be found at http://krisvandenbergh.be/uml_pricing.xml Any help would be appreciated! Thanks.

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >