Search Results

Search found 7740 results on 310 pages for 'split sound'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 153/310 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • MySQL create view from concat value

    - by cnotethegr8
    Lets say I have a table as follows, +----+-------------+ | id | value | +----+-------------+ | 1 | aa,bb,cc,dd | | 2 | ee,ff,gg,hh | +----+-------------+ I want to be able to search this table to see if id = 1 AND value = 'cc'. Im assuming a good way of doing this is to grab the id = 1 row and split its values into separate rows in a new view. Something like, +-----+ | val | +-----+ | aa | | bb | | cc | | dd | +-----+ I would like to do all of this in MySQL. How can i do this, and is there possibly a better way to do it?

    Read the article

  • If conditon showing alert even when the condition is false

    - by Adrian
    I have problem with if condition. I write a script who should showing alert when value from field #customer-age is less than 21 (the calculated age of person). The problem is - the alert is showing every time - when the value is less and greater than 21. My html code is: <div class="type-text"> <label for="birthday">Date1:</label> <input type="text" size="20" id="birthday" name="birthday" value="" readonly="readonly" /> </div> <div class="type-text"> <span id="customer-age" readonly="readonly"></span> </div> <span id="date_from_start">23/11/2012</span> and script looks like: function getAge() { var sday = $('#date_from_start').html(); var split_date1 = sday.split("/"); var todayDate = new Date(split_date1[2],split_date1[1] - 1,split_date1[0]); var bday = $('#birthday').val(); var split_date2 = bday.split("/"); var birthDate = new Date(split_date2[2],split_date2[1] - 1,split_date2[0]); var age = todayDate.getFullYear() - birthDate.getFullYear(); var m = todayDate.getMonth() - birthDate.getMonth(); if (m < 0 || (m === 0 && todayDate.getDate() < birthDate.getDate())) { age--; } return age; } var startDate = new Date("1935,01,01"); $('#birthday').datepicker({ dateFormat: 'dd/mm/yy', dayNamesMin: ['Nie', 'Pon', 'Wt', 'Sr', 'Czw', 'Pt', 'Sob'], dayNames: ['Niedziela','Poniedzialek','Wtorek','Sroda','Czwartek','Piatek','Sobota'], monthNamesShort: ['Sty', 'Lut', 'Mar', 'Kwi', 'Maj', 'Cze', 'Lip', 'Sie', 'Wrz', 'Paz', 'Lis', 'Gru'], changeMonth: true, changeYear: true, numberOfMonths: 1, constrainInput: true, firstDay: 1, dateFormat: 'dd/mm/yy', yearRange: '-77:-18', defaultDate: startDate, onSelect: function(dateText, inst) { $('#customer-age').html(getAge(new Date(dateText))); var cage = $('#customer-age').val(); if (cage < 21) { alert('< 21 year'); } else { } }, maxDate: +0 }); The workin code you can check on http://jsfiddle.net/amarcinkowski/DmYBt/

    Read the article

  • CoInternetIsFeatureEnabled in Delphi2010

    - by Elias
    Hello, I am trying to deactivate the annoying sound when clicking a link in WebBrowser control, WITHOUT changing the user registry. I've found documentation that this can be done through CoInternetIsFeatureEnabled, also explained here. But i have no idea how to implement it on Delphi 2010, since i am getting "Undeclared Identifier" error after including URLMon unit into the project and not much documentation out there. Any ideas?

    Read the article

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • What is a good way of Enhancing contrast of color images?

    - by erjik
    I split color image for 3 channels and made a contrast enhancement of each channel. Then merged them together, I like the image at the result, but it has different colors. Black objects became yellow and so on... EDIT: The algorithm I used is to calculate the 5th percentile and the 95th percentile as min and max values, and then expand the values of image so that it will have min and max values as 0 and 255. If there is a better approach please tell me.

    Read the article

  • Looking for interesting formula

    - by Thinker
    I'm creating a game where players can make an alloy. To make it less predictable and more interesting, I thought that the durability and hardness of an alloy should not be calculated by a simple formula, because it will be extremely easy to find extrema, where alloy have best statistics. So the questions is, is there any formula for a function where extrema can be found only by investigating all points? Input values will be in percents: 0.0%-100.0%. I think it should look like this: half sound wave

    Read the article

  • Path for a beginning web developer

    - by Trickerie
    I'm an experienced iOS programmer and have recently began to dabble in web development to expand my horizons. I've found it quite interesting and was wondering what learning path I should take through all the numerous languages. Here's what I planned on doing: HTML+CSS- PHP/Jquery Does that sound reasonable? Currently I'm nearly confident with my html/css abilities, and am planning to move ahead. Any good suggestions you guys could throw my way?

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • Proper two-level iPad UITableView

    - by Knodel
    I have an iPad app with split view. In the root view I need to make a two-level UITableView, so the UIWebView in the DetailView shows corresponding content. What I need is to make a two-level UITableView without editing, moving etc, so it can send the name of the selected row in the second level of the table to the DetailViewController. What is the best way to do it? Thanks in advance!

    Read the article

  • In App Purchase Resources Security.

    - by jAmi
    Hi I am setting up in app purchase where user can buy different Sounds. Once bought, he can play those sounds in the App. The Sound files are all present in my Resources Folder and I just keep a record(in a plist) of the files that have been purchased. No If I right click on the IAP file and see its content I can see the Resources, hence any one can have those sounds without actually buying them. Is there a protected Bundle or something?

    Read the article

  • Javascript wont change value in TextBox

    - by mattgcon
    Here is my javascript function AppendValues(e) { var lghtcnt = 0; var vars = e.id.split(';'); var highcnt = false; var lghtid = ""; var maxltcnt = 100; for (var x = 0; x < vars.length; x++) { var tokens = vars[x].split('|'); var pram = tokens if (tokens[0] == "ID"){ lghtid = tokens[1]; } if (tokens[0] == "LTC"){ var itemcnt = 0; var currentcnt = 0; currentcnt = parseInt(tokens[1].toString()); var txtid = document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]); if (e.checked) { totallightcnt += currentcnt; if (totallightcnt > maxltcnt) { document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; alert('This puts you over the limit of 100 total lights, please make adjustments.'); break; } document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = currentcnt.toString(); } else { totallightcnt -= currentcnt; document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; break; } } if (highcnt) { break; } } } Here is the issue, when I check the value it DOES say theupdated value but it does not display to the user on the webpage. What could be the issue?

    Read the article

  • Check if row exists, if not add it [MySQL]

    - by Steven
    I need to add a row to a MySQL database table but only if the row doesn't already exist. My database server just went down so I can't test this, but will this work as expected? INSERT INTO `blocks` (`block_file`,`settings_group`) VALUES ('announcements','announcement_settings') WHERE NOT EXISTS (SELECT `block_file`,`settings_group` FROM `blocks` WHERE `block_file`='announcements' AND `settings_group`='announcement_settings') It seems like sound logic. Is this a valid query or is there a better way of doing this?

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Detect activity level of microphone in flex

    - by Gaurav
    Hi, I have to detect avtivityLevel of microphone in Flex. I am using the activityLevel property of Microphone class but as I found out it always return -1 even if I have done Microphone.getMicrophone(). To detect activity level we have to set microphone.setLoopback = true; Does anybody know how to do this without using loop back as I do not want to hear my sound back just monitor the activity level Thanks

    Read the article

  • how to start with a voip/public announcement project?

    - by Metiu
    The main requirements are: open source solution on Linux support P2P VoIP calls support presence support multicast VoIP announcements (and maybe some way of setting up such a "conference") preferably serverless (maybe the network can get split and I'd need to keep the functionality for all clients that still see each other) I tried looking at telepathy, in particular telepathy-salut, but it seems to be quite a new technology, so it lacks clear/good documentation and/or working examples. I'm also evaluating SIP (e.g. SofiaSIP), but it's working only if connected to a server.

    Read the article

  • How can you use jQuery to make sIFR-replaced elements fade in?

    - by Sam Goldman
    This is what I currently have: // #content is visibility=hidden sIFR.replace(mix_bold, { selector: '#content p', onReplacement: function(fi) { $('#content').fadeIn("slow"); } }); The fade in happens, but for a split second the replaced flash movie appears before being hidden. Has anyone gotten this to work? I am using jQuery 1.2.6 and sIFR 3 r436. Tested in Safari 4 and FF 3. Thanks!

    Read the article

  • Access Creates new file every time I Compact & Repair

    - by NickSentowski
    It didn't always do this, but ever since I split my database and made the front-end an ACCDE file, any time I try to compact and repair either file, a new file called "Database 1" is generated and my original file size doesn't change. Is this normal? My ACCDB is roughly 20MB, and my ACCDE is just over 1M after being used the first time. Before opening, the ACCDE was only 600k (I have lots of forms and queries, and regularly store PDF attachments.

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >