Search Results

Search found 28486 results on 1140 pages for 'think floyd'.

Page 153/1140 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • H.264 / FLV best practices for HTML

    - by Steve Murch
    I run a website with about 700 videos (And no, it's not porn -- get your mind out of the gutter :-) ). The videos are currently in FLV format. We use the JWPlayer to render those videos. IIS6 hosted. Everything works just fine. As I understand it, H.264 (not FLV and likely not OGG) is the emerging preferred HTML5 video standard. Today, the iPad really only respects H.264 or YouTube. Presumably, soon many more important browsers will follow Apple's lead and respect only the HTML5 tag. OK, so I think I can figure out how to convert my existing videos into the proper H.264 format. There are various tools available, including ffmpeg.exe. I haven't tried it yet, but I don't think that's going to be a problem after fiddling with the codec settings. My question is more about the container itself -- that is, planning graceful transition for all users. What's the best-practice recommendation for rendering these videos? If I just use the HTML5 tag, then presumably any browser that doesn't yet support HTML5 won't see the videos. And if I render them in Flash format via the JWPlayer or some other player, then they won't be playable on the iPad. Do I have to do ugly UserAgent detection here to figure out what to render? I know the JWPlayer supports H.264 media, but isn't the player itself a Flash component and therefore not playable on the iPad? Sorry if I'm not being clear, but I'm scratching my head on a graceful transition plan that will work for current browsers, the iPad and the upcoming HTML5 wave. I'm not a video expert, so any advice would be most welcome, thanks.

    Read the article

  • Publishing my Website to my Local Disk Causes Exceptions to show Paths including my Local Disk

    - by coffeeaddict
    I've published my website many times. But didn't think about this though until I came across this issue. So I decided to publish my WAP project to a local folder on my C drive first. Then used FTP to upload it to my shared host on discountasp.net. I noticed during runtime that the stack trace was referencing that local folder still and erroring out. Anyone know what config settings are affected when publishing? Obviously something is still pointing to my local C drive and I've searched my entire solution and don't see why. Here's the runtime error I get when my code tries to run in discountasp.net's web server Cannot write into the public directory - check permissions Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: ScrewTurn.Wiki.PluginFramework.InvalidConfigurationException: Cannot write into the public directory - check permissions Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidConfigurationException: Cannot write into the public directory - check permissions] ScrewTurn.Wiki.SettingsStorageProvider.Init(IHostV30 host, String config) in C:\www\Wiki\Screwturn3_0_2_509\Core\SettingsStorageProvider.cs:90 ScrewTurn.Wiki.StartupTools.Startup() in C:\www\Wiki\Screwturn3_0_2_509\Core\StartupTools.cs:69 ScrewTurn.Wiki.Global.Application_BeginRequest(Object sender, EventArgs e) in C:\www\Wiki\Screwturn3_0_2_509\WebApplication\Global.asax.cs:29 System.Web.SyncEventExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() +68 System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) +75 Discountasp says it's not a permission issue but obviously it is. I think /Wiki should work...but it's not. Here's my site viewed in FTP on discountasp.net's server:

    Read the article

  • Conversion to Dalvik format failed error for Android Grid View

    - by Bub
    Hey Everyone, I'm on the android bandwagon and started going through google's "view" tutorials. Here is what I'm using: Eclipse Galileo Android SDK 2.1 Java SDK 6.Something I think. Everything was hunky-dory until I hit the grid view tutorial. I got errors all over the place when I started editing the "HelloGridview.java" File. I thought I'd fix it by following through with the next part of the tutorial, creating the ImageAdapter class, but it created more. I realized alot of my issues could be resolved by importing widgets which were not mentioned in the tutorial (i.e. android.widget.GridView, .ImageView, .BaseAdapter etc.) However, after all the reconciliation suggested by eclipse the files were finally showing no errors. I go to run it as an android app and bam, "Your project contains error(s)." window comes up. There are no errors showing on the files I've created. I cleared the error log and shut down eclipse and started again the error log now reads: Conversion to Dalvik format failed with error 1. I'm a little lost at this point. I think I've included the required information. If you need to know more let me know. Any help is appreciated.

    Read the article

  • Subsonic - How to use SQL Schema / Owner name as part of the namespace?

    - by CResults
    Hi there, I've just started using Subsonic 2.2 and so far very impressed - think it'll save me some serious coding time. Before I dive into using it full time though there is something bugging me that I'd like to sort out. In my current database (a SQL2008 db) I have split the tables, views, sps etc. up into separate chunks by schema/owner name, so all the customer tables are in the customer. schema, products in the product. schema etc., so a to select from the customers address table i'd do a select * from customer.address Unfortunately, Subsonic ignores the schema/owner name and just gives me the base table name. This is fine as I've no duplicates between schemas (e.g Customer.Address and Supplier.Address don't both exist) but I just feel the code could be clearer if I could split by schema. Ideally I'd like to be able to alter the namespace by schema/owner - I think this would have least impact on SubSonic yet make the resulting code easier to read. Problem is, I've crawled all over the Subsonic source and don't have a clue how to do this (doesn't help that I code in VB not C# = yes I know, blame the ZX Spectrum!!) If anyone has tackled this before or has an idea on how to solve it, I'd be really grateful, Thanks in advance. Ed

    Read the article

  • Updating Database from DataSet

    - by clawson
    I am having trouble updating my Database from my code using a DataSet. I'm using SQL Server 2008 and Visual Studio 2008. Here is what I've done so far. I have created a table in SQL Server called MyTable which has two columns: id nchar(10), and name nchar(50). I have then created a datasource in my VB.net project that consists of this table using the dataset wizard and called this dataset MyDataSet. I run the following code on a button click: Try Dim myDataSet As New MyDataSet Dim newRow As MyDataSet.MyTableRow = myDataSet.MyTable.NewMyTableRow newRow.id = "1" newRow.name = "Alpha" myDataSet.MyTable.AddMyTableRow(newRow) myDataSet.AcceptChanges() Catch ex As Exception MsgBox(ex.Message) End Try when I run this and check the rows in SQL Server it returns 0 rows What have I missed? How can I add these rows / save changes in a dataset to the database? I have seen other examples that use a TableAdapter but I don't think I want to do this, I think I should be able to achieve this just using a DataSet. Am I mistaken? Help is greatly appreciated!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Linking session state between servlets and EJBs?

    - by wilth
    Hello, I have servlets (in a web module) that access stateless EJB beans (in an EJB module). The EJB module is built using SEAM. Users can have different roles and the EJB services check this using Seam's Identity. I also use a customized Authenticator (although this might not be relevant here). I noticed problems with this approach and I'm suspecting that the session context in the servlets is not "linked" with the session context in the EJB beans. What I think happens is something like: User Joe access servlet A and is assigned Session W1. Servlet A calls a login function on an EJB, using the EJB session E1. Later, user Mary accesses servlet A and is assigned Session W2. When calling the EJBs, however, the EJB session E1 is used and therefore Mary is authenticated as Joe. What also happens is that when Joe is calling the servlet twice in rapid succession, the same session W1 is used, but two different sessions E1 and E2 in the business layer, causing errors. I might be wrong in my suspicion, but maybe I'm actually expecting these "sessions" to be linked together while they in fact are not. If this is true, is there any way of achieving this? I could - of course - use stateful beans and save the authentication information in the beans, but this would break the "Identity" concept of Seam (and in general, it would be preferable to be able to use the Session context in my EJB beans). Any help and pointers are very welcome - thanks! Technology: EJB3, Seam 2.1.2. The servlets are actually the server-side of a GWT app, although I don't think this matters much. I'm using JBoss 5.

    Read the article

  • How to effectively use WorkbookBeforeClose event correctly?

    - by Ahmad
    On a daily basis, a person needs to check that specific workbooks have been correctly updated with Bloomberg and Reuters market data ie. all data has pulled through and that the 'numbers look correct'. In the past, people were not checking the 'numbers' which led to inaccurate uploads to other systems etc. The idea is that 'something' needs to be developed to prevent the use from closing/saving the workbook unless he/she has checked that the updates are correct/accurate. The numbers look correct action is purely an intuitive exercise, thus will not be coded in any way. The simple solution was to prompt users prior to closing the specific workbook to verify that the data has been checked. Using VSTO SE for Excel 2007, an Add-in was created which hooks into the WorkbookBeforeClose event which is initialised in the add-in ThisAddIn_Startup private void wb_BeforeClose(Xl.Workbook wb, ref bool cancel) { //.... snip ... if (list.Contains(wb.Name)) { DailogResult result = MessageBox.Show("some message", "sometitle", MessageBoxButtons.YesNo); if (result != DialogResult.Yes) { cancel = true; // i think this prevents the whole application from closing } } } I have found the following ThisApplication.WorkbookBeforeSave vs ThisWorkbook.Application.WorkbookBeforeSave which recommends that one should use the ThisApplication.WorkbookBeforeClose event which I think is what I am doing since will span all files opened. The issue I have with the approach is that assuming that I have several files open, some of which are in my list, the event prevents Excel from closing all files sequentially. It now requires each file to be closed individually. Am I using the event correctly and is this effective & efficient use of the event? Should I use the Application level event or document level event? Is there a way to prevent the above behaviour? Any other suggestions are welcomed VS 2005 with VSTO SE

    Read the article

  • So can unique_ptr be used safely in stl collections?

    - by DanDan
    I am confused with unique_ptr and rvalue move philosophy. Let's say we have two collections: std::vector<std::auto_ptr<int>> autoCollection; std::vector<std::unique_ptr<int>> uniqueCollection; Now I would expect the following to fail, as there is no telling what the algorithm is doing internally and maybe making internal pivot copies and the like, thus ripping away ownership from the auto_ptr: std::sort(autoCollection.begin(), autoCollection.end()); I get this. And the compiler rightly disallows this happening. But then I do this: std::sort(uniqueCollection.begin(), uniqueCollection.end()); And this compiles. And I do not understand why. I did not think unique_ptrs could be copied. Does this mean a pivot value cannot be taken, so the sort is less efficient? Or is this pivot actually a move, which in fact is as dangerous as the collection of auto_ptrs, and should be disallowed by the compiler? I think I am missing some crucial piece of information, so I eagerly await someone to supply me with the aha! moment.

    Read the article

  • Oracle T4CPreparedStatement memory leaks?

    - by Jay
    A little background on the application that I am gonna talk about in the next few lines: XYZ is a data masking workbench eclipse RCP application: You give it a source table column, and a target table column, it would apply a trasformation (encryption/shuffling/etc) and copy the row data from source table to target table. Now, when I mask n tables at a time, n threads are launched by this app. Here is the issue: I have run into a production issue on first roll out of the above said app. Unfortunately, I don't have any logs to get to the root. However, I tried to run this app in test region and do a stress test. When I collected .hprof files and ran 'em through an analyzer (yourKit), I noticed that objects of oracle.jdbc.driver.T4CPreparedStatement was retaining heap. The analysis also tells me that one of my classes is holding a reference to this preparedstatement object and thereby, n threads have n such objects. T4CPreparedStatement seemed to have character arrays: lastBoundChars and bindChars each of size char[300000]. So, I researched a bit (google!), obtained ojdbc6.jar and tried decompiling T4CPreparedStatement. I see that T4CPreparedStatement extends OraclePreparedStatement, which dynamically manages array size of lastBoundChars and bindChars. So, my questions here are: Have you ever run into an issue like this? Do you know the significance of lastBoundChars / bindChars? I am new to profiling, so do you think I am not doing it correct? (I also ran the hprofs through MAT - and this was the main identified issue - so, I don't really think I could be wrong?) I have found something similar on the web here: http://forums.oracle.com/forums/thread.jspa?messageID=2860681 Appreciate your suggestions / advice.

    Read the article

  • Prevent illegal behavior to the registered user

    - by Al Kush
    I am building a website in which this website will be focused on the publishing of novels. Every writers who publish their novels with us will get a royalty from us. And this royalty comes from the user or the reader who read the novel online in our website. When a user search for a novel and want to read that, they will click a link to the page which its content is that novel. The html page for each novels will have a session function that first will force them to login or register to make a payment such as with a credit-card or paypal before accessing that html page. My problem now is if the user has succesfully login and access the html page, I am afraid if the user will copy the content of the novel. Some disccussion out here How to Disable Copy Paste (Browser) have a solution to create it in Flash so that it can't be coppied-paste. But the I think, if the user who access it is a web developer like us they will try to find the path of the file from the link in the page source, and then they can steal it. For now I think it is enough I am explaining this. I hope anyone fully accept this problem (question) with a good idea to solve it.

    Read the article

  • how to implement login and service features as in skype or msn chat in a wpf application

    - by black sensei
    Hello Good people! I'm building an WPF application that connect to web services for its operations.Things that i needed to be working are so far fine.Now i'll like to improve use experience by adding features like username editable combobox, sign me in when skype start and start when computer start. I have a fair idea about each feature but very small knowledge about their implementation. Question 1 username combobox : i use a combobox with isEditable set to true but i think it doesnt have the previous username, would that mean that i have to store every successful login username in a sqlite for example? Question 2 sign me in when skype start : i think about using sqlite after all to store the credentials and store the value (as in true or false) if autologin has to be performed. Question 3 start when computer start : i know it's about having is as service.but the process of using it as a service and removing its service when checkbox is checked or unckecked is a bit confusing to me. Question 4 Please wait(signing in) of skype if i want to do things like please wait at login(login is over webservice) in a WPF application should i use a animated gif in a grid that i can show when hiding the login combobox and passwordbox grid or i should use an animated object(for which i have no knowledge about for now) ? This post in mainly for you experts to either point me to the right resource and tell me what is done as best practice. things like dos and dons.Thanks for reading this and please let me have a clair idea about how to start implementing those features. thanks again

    Read the article

  • Monotouch or Titanium for rapid application development on IPhone?

    - by Ronnie
    As a .Net developer I always dreamed for the possibility to develop with my existing skills (c#) applications for the Iphone. Both programs require a Mac and the Iphone Sdk installed. Appcelerator Titanium was the first app I tried and it is based on exposing some Iphone native api to javascript so that they can be called using that language. Monotouch starts at $399 for beeing able to deploy on the Iphone and not on the Iphone simulator while Titanium is free. Monotouch (Monodevelop) has an Ide that is currently missing in Titanium (but you can use any editor like Textmate, Aptana...) I think both program generate at the end a native precompiled app (also if I am not sure about the size of the final app on the Iphone as I think the .Net framework calls are prelilnked at compilation time in Monotouch). I am also not sure about the full coverage of all the Iphone api and features. Titanium has also the advantage to enable Android app development but as a c# developer I still find Monotouch experience more like the Visual Studio one. Witch one would you choose and what are your experiences on Monotouch and Titanium?

    Read the article

  • Why is Swing Parser's handleText not handling nested tags?

    - by Jim P
    I need to transform some HTML text that has nested tags to decorate 'matches' with a css attribute to highlight it (like firefox search). I can't just do a simple replace (think if user searched for "img" for example), so I'm trying to just do the replace within the body text (not on tag attributes). I have a pretty straightforward HTML parser that I think should do this: final Pattern pat = Pattern.compile(srch, Pattern.CASE_INSENSITIVE); Matcher m = pat.matcher(output); if (m.find()) { final StringBuffer ret = new StringBuffer(output.length()+100); lastPos=0; try { new ParserDelegator().parse(new StringReader(output.toString()), new HTMLEditorKit.ParserCallback () { public void handleText(char[] data, int pos) { ret.append(output.subSequence(lastPos, pos)); Matcher m = pat.matcher(new String(data)); ret.append(m.replaceAll("<span class=\"search\">$0</span>")); lastPos=pos+data.length; } }, false); ret.append(output.subSequence(lastPos, output.length())); return ret; } catch (Exception e) { return output; } } return output; My problem is, when I debug this, the handleText is getting called with text that includes tags! It's like it's only going one level deep. Anyone know why? Is there some simple thing I need to do to HTMLParser (haven't used it much) to enable 'proper' behavior of nested tags? PS - I figured it out myself - see answer below. Short answer is, it works fine if you pass it HTML, not pre-escaped HTML. Doh! Hope this helps someone else. <span>example with <a href="#">nested</a> <p>more nesting</p> </span> <!-- all this gets thrown together -->

    Read the article

  • Bash Templating: How to build configuration files from templates with Bash?

    - by FractalizeR
    Hello. I'm writting a script to automate creating configuration files for Apache and PHP for my own webserver. I don't want to use any GUIs like CPanel or ISPConfig. I have some templates of Apache and PHP configuration files. Bash script needs to read templates, make variable substitution and output parsed templates into some folder. What is the best way to do that? I can think of several ways. Which one is the best or may be there are some better ways to do that? I want to do that in pure Bash (it's easy in PHP for example) 1)http://stackoverflow.com/questions/415677/how-to-repace-variables-in-a-nix-text-file template.txt: the number is ${i} the word is ${word} script.sh: #!/bin/sh #set variables i=1 word="dog" #read in template one line at the time, and replace variables #(more natural (and efficient) way, thanks to Jonathan Leffler) while read line do eval echo "$line" done < "./template.txt" BTW, how do I redirect output to external file here? Do I need to escape something if variables contain, say, quotes? 2) Using cat & sed for replacing each variable with it's value: Given template.txt: The number is ${i} The word is ${word} Command: cat template.txt | sed -e "s/\${i}/1/" | sed -e "s/\${word}/dog/" Seems bad to me because of the need to escape many different symbols and with many variables the line will be tooooo long. Can you think of some other elegant and safe solution?

    Read the article

  • GWT Html Layout Conventions

    - by brad
    I've just started working with GWT and I'm already recognizing the extraordinary power that it possesses. I'm coming from a frontend world so the Java is a big learning curve, but I think that will actually help me build a properly laid out app (html-wise) instead of just relying on the default GWT panels that often end up using tables for layout, or superfluous, absolutely positioned divs. The biggest thing slowing me down right now however is deciding how to properly lay out the design of my site. I've got a pretty standard 2-col header/foot site (fixed width) that I want to design, but I'm not a fan of all the extra divs/styling etc that come with the DockLayoutPanel for instance. I'm thinking that I should just write my own Layout widget extending Composite that has HTMLPanels for the general site layout (I think... still haven't fully figured that out yet, ie. how do I add ID's to these panel divs "#header", "#nav" etc...) then I can add other widgets into this layout But the other thing I'm seeing is that I could write a Layout class extending UiBuilder and have straight up divs in the ui.xml file. I'm just wondering, what is the preferred method for site layout with GWT? This isn't going to be re-used in the sense of other widgets, it will be used once and my controls etc will be placed inside. Any tips or tricks are greatly appreciated! And if I've completely missed the boat on how to do this, let me know

    Read the article

  • BDD on Rails - Is the community more behind Shoulda or RSpec?

    - by Wayne M
    For a new application I want to start dabbling in BDD and I'm trying to decide between using RSpec or Thoughtbot's Shoulda. I like the macros that Shoulda uses, and the fact that it doesn't seem to reinvent the way Ruby/Rails does testing, but simply provides an add-on. On the other hand, the macros seem like a bit too much "magic" instead of being explicit about what you're testing (however I know from dabbling that it's annoying to write a dozen "should be invalid without xxx" two-liners on a model). To be honest I find writing specifications/tests for models to be trivially and almost boringly easy, but I find writing them for controllers to be insanely difficult because I'm never sure exactly what I should be testing or how to write it. I'm iffy on the subject of mocking and stubbing since I think they give you false assumptions (since you can just tell it to think it has whatever data you need or to pretend that Method X was called) and I know that RSpec makes heavy use of both of them. I like the documentation that RSPec produces but I'm creating an application for sale, not to give to a client so the pretty documentation isn't that useful. I like Cucumber but it seems like overkill (and yes I know it can be used with Shoulda). At this point is the Rails community in favor of RSpec or Shoulda?

    Read the article

  • how to combine widget webapp framework with SEO-friendly CSS and JS files

    - by Ali
    Hi guys, I'm writing a webapp using Zend framework and a homebrew widget system. Every widget has a controller and can choose to render one of many views if it chooses. This really helps us modularize and reconfigure and reuse the widgets anywhere on the site. The Problem is that the views of each widget contain their own JS and CSS code, which leads to very messy HTML code when the whole page is put together. You get pockets of style and script tags everywhere. This is bad for a lot of different reasons as I'm sure you know, but it has a profound effect on our SEO as well. Several solutions that I've been able to come up with: Separate the CSS and JS of every view of every widget into its own file - this has serious drawbacks for load times (many more resources have to be loaded separately) and it makes coding very difficult as now you have to have 3-4 files open just to edit a widget. combine the all the widget CSS into a single file (same with JS) - would also lead to a massive load when someone enters the site, mixes up the CSS and the JS for all widgets so it's harder to keep track of them, and other problems that I'm sure you can think of. Create a system that uses method 1 (separate CSS and JS for every widget), when delivering the page, stitches all CSS and JS together. This obviously needs more processing time and of course the creation of such a system, etc. My Question is what you guys think of these solutions or if there are pre-existing solutions that you know of (or any tech that might help) solve this problem. I really appreciate all of your thoughts and comments!! Thanks guys, Ali

    Read the article

  • Setup.exe files downloading without cab files over poor connections

    - by Colin
    We have customers who are trying to download a setup.exe file over mobile connections that appear to be very slow. They have reported that when they click on the downloaded setup.exe, the install wizard starts up, but part way through the wizard they get an error message indicating that a cab file is corrupt or missing. They couriered a problem tablet to us, and we downloaded the file without a problem but I could replicate the problem by using https to download the file (https is normally used to access the rest of the site, although it is not necessary for the download). When I did this the downloaded file was 2.8MB. It should be 8MB. I don't think that https is the root cause of the problem because I can see the download link in the browser history using http, so I know the customer tried to download using http. I think that the issue is that the poor connection is preventing a complete download, but the browser is acting as if it is complete. Is there a way to ensure the file is downloaded fully, or not at all? Why does the browser not indicate that the download is incomplete?

    Read the article

  • Eclipse JUnit Plugin Test very slow to re-execute Test Suite on Windows

    - by soundasleepful
    I'm having an odd, and stressing, problem with running a large JUnit Plugin test suite in Eclipse. When I try to re-run a JUnit plugin suite that has just been executed, Eclipse hangs for quite some time before it eventually wakes up and launches. It can take up to 5 minutes sometimes, and increases with the size of the suite. Visually, it appears as a GC cleanup, except that I have plenty of GC space available (400 MB freely allocated). The size of the workspace that is has to delete is well under 1 GB, and there are not too many files - definitely less than 20,000. While I was waiting for a new run to start, I decided to manually kill explorer.exe to see if it had any effect. Surprisingly, Eclipse instantly fell out of its freeze and ran as normal. This makes me think that Windows is somehow interfering with the deletion of these workspace files. They're not being put into the Recycle Bin though. The workspace is in C: which I think is out of the range of any workspace/domain stuff. Any ideas?

    Read the article

  • Headless, scriptable Firefox/Webkit on linux?

    - by Parand
    I'm looking to automate some web interactions, namely periodic download of files from a secure website. This basically involves entering my username/password and navigating to the appropriate URL. I tried simple scripting in Python, followed by more sophisticated scripting, only to discover this particular website is using some obnoxious javascript and flash based mechanism for login, rendering my methods useless. I then tried HTMLUnit, but that doesn't seem to want to work either. I suspect use of Flash is the issue. I don't really want to think about it any more, so I'm leaning towards scripting an actual browser to log in and grab the file I need. Requirements are: Run on linux server (ie. no X running). If I really need to have X I can make that happen, but I won't be happy. Be reliable. I want to start this thing and never think about it again. Be scriptable. Nothing too sophisticated, but I should be able to tell the browser the various steps to take and pages to visit. Are there any good toolkits for a headless, X-less scriptable browser? Have you tried something like this and if so do you have any words of wisdom?

    Read the article

  • Android App Build system differences between Eclipse and Ant?

    - by Amy Winarske
    The Eclipse build for my 1.6 application project is succeeding and the Ant build is failing. I'm looking for help on why they aren't behaving the same way. We are developing on Mac OSX 10.5.8 with Eclipse 3.5 against SDK 1.6 + Google APIs. There are no setting changes in Eclipse, either at workspace or project level. Similarly, our ant is also a vanilla- flavored unmodified installation of 1.7.1. JDK is 1.5.0_22. The CLASSPATH environment variable is not set. JAVA_HOME is /Library/Java/ Home The application was initially created by a team member using the Eclipse plugins. The application references two jar files, one of which has a dependency on javax.xml.bind.annotation.XmlSeeAlso, which is not defined anywhere in our code or in android.jar. The other jar file has an explicit dependency on android.jar. I generated the Ant build file using android update. The Eclipse project builds an apk and runs the application in the emulator. I think this is incorrect behavior. The Android ant project fails to build. I think this is correct behavior. MyClass.java:98: cannot access javax.xml.bind.annotation.XmlSeeAlso [javac] file javax/xml/bind/annotation/XmlSeeAlso.class not found Any ideas as to why the two build methods are behaving differently? I would expect them both to fail. Thanks! -Amy

    Read the article

  • Unable to load huge XML document (incorrectly suppose it's due to the XSLT processing)

    - by krisvandenbergh
    I'm trying to match certain elements using XSLT. My input document is very large and the source XML fails to load after processing the following code (consider especially the first line). <xsl:template match="XMI/XMI.content/Model_Management.Model/Foundation.Core.Namespace.ownedElement/Model_Management.Package/Foundation.Core.Namespace.ownedElement"> <rdf:RDF> <rdf:Description rdf:about=""> <xsl:for-each select="Foundation.Core.Class"> <xsl:for-each select="Foundation.Core.ModelElement.name"> <owl:Class rdf:ID="@Foundation.Core.ModelElement.name" /> </xsl:for-each> </xsl:for-each> </rdf:Description> </rdf:RDF> </xsl:template> Apparently the XSLT fails to load after "Model_Management.Model". The PHP code is as follows: if ($xml->loadXML($source_xml) == false) { die('Failed to load source XML: ' . $http_file); } It then fails to perform loadXML and immediately dies. I think there are two options now. 1) I should set a maximum executing time. Frankly, I don't know how that I do this for the built-in PHP 5 XSLT processor. 2) Think about another way to match. What would be the best way to deal with this? The input document can be found at http://krisvandenbergh.be/uml_pricing.xml Any help would be appreciated! Thanks.

    Read the article

  • Big Nerd Ranch's Android Bootcamp - worth it?

    - by Matt Luongo
    At work, I've been told that I must, before the end of the year, get a certification. The shop is Microsoft heavy, and I'm not. That's why I was excited when I suggested something in support of Android development, and they agreed. Before I go any further, I should say that I don't know what I think about the whole certification question. Frankly, though, I need to do this, regardless of whether I think certification in general is particularly appealing to clients. I realize that the technology is fairly accessible without all this expensive process- but I'd rather focus on Android than, say, getting some MC* scrap of paper. I don't know of any actual Android certification. Instead, I was thinking that the best regarded Android training in the industry should suffice. I've looked into Big Nerd Ranch's Android Bootcamp, and it looks promising. I live in Atlanta, which is a boon. Given that my Java skills are good, does this seem like a decent course? Or is there a better known training program that I should look into?

    Read the article

  • What is the role/responsibility of a 'shell'?

    - by Rune
    Hi, I have been looking at the source code of the IronPython project and the Orchard CMS project. IronPython operates with a namespace called Microsoft.Scripting.Hosting.Shell (part of the DLR). The Orchard Project also operates with the concept of a 'shell' indirectly in various interfaces (IShellContainerFactory, IShellSettings). None of the projects mentioned above have elaborate documentation, so picking up the meaning of a type (class etc.) from its name is pretty valuable if you are trying to figure out the overall application structure/architecture by reading the source code. Now I am wondering: what do the authors of this source code have in mind when they refer to a 'shell'? When I hear the word 'shell', I think of something like a command line interpreter. This makes sense for IronPython, since it has an interactive interpreter. But to me, it doesn't make much sense with respect to a Web CMS. What should I think of, when I encounter something called a 'shell'? What is, in general terms, the role and responsibility of a 'shell'? Can that question even be answered? Is the meaning of 'shell' subjective (making the term useless)? Thanks.

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >