Search Results

Search found 103782 results on 4152 pages for 'tath am'.

Page 154/4152 | < Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >

  • Simple regex split

    - by user1383058
    I have the following string: string = "Peter Pan, Pete Sampras; Little Pete" And I need to split it up by name: split_string = ["Peter Pan", "Pete Sampras", "Little Pete"] I am trying to use re.findall but am having a bit of trouble with it: print re.findall(r'[,;]', string) [";", ";", ";"] What am I doing wrong here and how would I properly use re.findall here or an equivalent to split up the string?

    Read the article

  • Java input method for Virtual Keyboad

    - by shekhar
    Hi, I am facing problem in implementing Input method for Virtual Keyboard, currently I am using robot class for sending input to any application from virtual keyboard. but for that I need to create mapping of key-code and unicode, which is not consistent on different keyboard layout, can I directly pass the UNICODE to any application using Input method without worry about mapping between keycode and unicode. any useful link or sample code will be useful. It is simple Java program which is always on top of any application and work as onscreen keyboard. using a mouse while you press any button (key) of the keyboard, the corresponding character will be typed in the application running below. This is working perfectly for English Alphabets. I am facing problem while I am doing for unicode.

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • WCF RIA Services Silverlight 3.0

    - by John
    Hi, I have downloaded WCF RIA Services Beta from the following website: WCF RIA Services Beta for Visual Studio 2008 SP1 http://www.microsoft.com/downloads/details.aspx?FamilyID=76bb3a07-3846-4564-b0c3-27972bcaabce&displaylang=en#filelist But I am unable to add a reference to the following assembly : system.Windows.Ria.Data I searched at the downloaded location c:\Program files\Microsoft SDK's\RIA Services but i am unable to find this dll. Would appreciate if you could point me what I am missing here.

    Read the article

  • How to use variables with regex?

    - by dontoo
    This is the input string: 23x^45*y or 2x^2 or y^4*x^3. I am matching ^[0-9]+ after letter x. In other words I am matching x followed by ^ followed by numbers. Problem is that I don't know that I am matching x, it could be any letter that I stored as variable in my char array. For example: foreach (char cEle in myarray) // cEle is letter in char array x, y, z, ... { match CEle in regex(input) //PSEUDOCODE } I am new to regex and I new that this can be done if I define regex variables, but I don't know how.

    Read the article

  • FileUtils.mv adding linebreaks in Windows

    - by Lowgain
    I am streaming wav data from a flash application. If I get the data and do the following: f = File.open('c:/test.wav') f << wav_data.pack('c'*wav_data.length) f.close The wav file works perfectly. If I do this: f = Tempfile.new('test.wav') f << wav_data.pack('c'*wav_data.length) f.close FileUtils.mv(f.path, 'c:/') The file is there, but sounds all garbled. Checking in a hex editor shows that everywhere the working file had an 0A (or \n), the garbled version had 0D0A (or \r\n) I am using this in conjuction with rails+paperclip, and am going to be using a combination of Heroku and S3 for the live app, so I am hoping this problem will solve itself, but I'd like to get this working on my local machine for the time being. Does anybody know of any reason FileUtils.mv would be doing this, and if there is a way to change its behaviour?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Zend: How to authenticate using OpenId on local server.

    - by NAVEED
    I am using zend framework. Now I want to authenticate users with other already registered accounts using RPX. I am following the 3 steps as described at RPX site: 1- Get the Widget 2- Receive Tokens 3- Choose Providers I created a controller(person) and action(signin) to show widget and my own signin form. When following action (http://test.dev/#person/personsignin) is called then my own login form and widget is shown successfully. # is used in above URL for AJAX indication. public function personsigninAction() { $this->view->jsonEncoded = true; // Person Signin Form $PersonSigninForm = new Form_PersonSignin(); $this->view->PersonSigninForm = $PersonSigninForm; $this->view->PersonSigninForm->setAction( $this->view->url() ); $request = $this->getRequest(); if ( $request->isPost() ) { } } There are two problems while login using openid widget: When I am authenticated from outside(for example: Yahoo) then I am redirected to http://test.dev, therefor indexAction in called in indexController and home page is shown. I want to redirect to http://test.dev/#person/personsignin after authentication and want to set session in isPost() condition of personsigninAction() (described above). For now I consider indexAction to be called when outside authentication is done. Now I posted the code from http://gist.github.com/291396 in indexAction to follow step 3 mentioned above. But it is giving me following error: An error occured: Invalid parameter: apiKey Am I using the right way to use this. This is my very first attempt to this stuff. Can someone tell me the exact steps using my above actions? Thanks.

    Read the article

  • Managing Lotus Notes Mail Format using C#

    - by Pari
    Hi, I am accessing mail body and fetching it in another mail. But i am not getting original format of previous mail in new mail. Problem i am facing in this situation are: Not getting images in destination mail. Font is also varying. I am accessing mail body as follows: NotesRichTextItem rtItem = (NotesRichTextItem)docInbox.GetFirstItem("Body"); String Body = rtItem.GetFormattedText(false , 0); String bodyFormat = rtItem.type.ToString(); also tried this code: NotesItem itemBody = docInbox.GetFirstItem("Body"); String bodyFormat = itemBody.type.ToString(); String Body = itemBody.Text; But not getting solution in both case.

    Read the article

  • Rails + MongoMapper + EmbeddedDocument form help

    - by Bob Martens
    I am working on a pretty simple web application (famous last words) and am working with Rails 2.3.5 + MongoMapper 0.7.2 and using embedded documents. I have two questions to ask: First, are there any example applications out there using Rails + MongoMapper + EmbeddedDocument? Preferably on GitHub or some other similar site so that I can take a look at the source and see where I am supposed to head? If not ... ... what is the best way to approach this task? How would I go about creating a form to handle an embedded document. What I am attempting to do is add addresses to users. I can toss up the two models in question if you would like. Thanks for the help!

    Read the article

  • SQL Query with ORDER BY Part 2

    - by Brett
    Hi SQL'ers, This is a followup question to: SQL Query with ORDER BY But I think the SQL logic is going to be quite different, so I am posting it as separate question. I am trying to extend my sql SELECT query it and having some trouble: I have the table: id type radius ------------------------- 1 type1 0.25 2 type2 0.59 3 type1 0.26 4 type1 0.78 5 type3 0.12 6 type2 0.45 7 type3 0.22 8 type3 0.98 and I am trying to learn how to SELECT the second smallest radius for each given type. So the returned recordset should look like: id type radius ------------------------- 3 type1 0.26 2 type2 0.59 7 type3 0.22 (Note: in the referenced question, I was looking for the lowest radius, not the second lowest radius). I am assuming I have to use LIMIT and OFFSET, but if I use the MIN() won't that return a distinct record containing the minimum radius? Does anyone have any thoughts on how to attack this? Many thanks, Brett

    Read the article

  • Index out of bounds error

    - by sprasad12
    Hello, I am working on a program where i am recreating the saved widgets back on to the boundary panel. When i am creating them i am also trying to put the values into the ArrayList so that if i want to update and save the opened project i should be able to do so by getting the values from the ArrayList. Here is how the code looks like: for(int i = 0; i < result.length; i++){ if(ename.contains(result[i].getParticipateEntityName())){ ername.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); etotalpartial.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getTotalPartial()); }else if(wename.contains(result[i].getParticipateEntityName())){ wrname.add(wename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); } } Here ename, ername, etotalpartial, wename and wrname are all ArrayList. This piece of code is included in an asynchronous class method. When i run the code i get error at "ername.add(ename......". Here is the error stack: java.lang.IndexOutOfBoundsException: Index: 1, Size: 0 at java.util.ArrayList.add(ArrayList.java:367) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:898) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:1) at com.google.gwt.user.client.rpc.impl.RequestCallbackAdapter.onResponseReceived(RequestCallbackAdapter.java:216) at com.google.gwt.http.client.Request.fireOnResponseReceived(Request.java:287) at com.google.gwt.http.client.RequestBuilder$1.onReadyStateChange(RequestBuilder.java:393) at sun.reflect.GeneratedMethodAccessor16.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessagesWhileWaitingForReturn(BrowserChannel.java:1713) at com.google.gwt.dev.shell.BrowserChannelServer.invokeJavascript(BrowserChannelServer.java:165) at com.google.gwt.dev.shell.ModuleSpaceOOPHM.doInvoke(ModuleSpaceOOPHM.java:120) at com.google.gwt.dev.shell.ModuleSpace.invokeNative(ModuleSpace.java:507) at com.google.gwt.dev.shell.ModuleSpace.invokeNativeObject(ModuleSpace.java:264) at com.google.gwt.dev.shell.JavaScriptHost.invokeNativeObject(JavaScriptHost.java:91) at com.google.gwt.core.client.impl.Impl.apply(Impl.java) at com.google.gwt.core.client.impl.Impl.entry0(Impl.java:188) at sun.reflect.GeneratedMethodAccessor9.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessages(BrowserChannel.java:1668) at com.google.gwt.dev.shell.BrowserChannelServer.processConnection(BrowserChannelServer.java:401) at com.google.gwt.dev.shell.BrowserChannelServer.run(BrowserChannelServer.java:222) at java.lang.Thread.run(Thread.java:619) I am not sure what i am doing wrong. Any input will be of great help. Thank you.

    Read the article

  • Scala type conversion error, need help!

    - by Mansoor Ashraf
    Hello I am getting a weird error when trying to use a Java map in Scala. This is the snippet of code val value:Double = map.get(name) if (value eq null) map.put(name, time) else map.put(name, value + time) the map is defined as val map=new ConcurrentHashMap[String,Double] and this is the error I am getting error: type mismatch; found : Double required: ?{val eq: ?} Note that implicit conversions are not applicable because they are ambiguous: both method double2Double in object Predef of type (Double)java.lang.Double and method doubleWrapper in object Predef of type (Double)scala.runtime.RichDouble are possible conversion functions from Double to ?{val eq: ?} if (value eq null) map.put(name, time) I am new to Scala so I am having a hard time parsing the stacktrace. Any help would be appreciated

    Read the article

  • Skip sanitization for videos in html5lib

    - by pug
    I am using a wmd-editor in django, much like this one in which I am typing. I would like to allow the users to embed videos in it. For that I am using the Markdown video extension here. The problem is that I am also sanitizing user input using html5lib sanitization and it doesn't allow object tags which are required to embed the videos. One solution could be to check the input for urls of well-known video sites and skip the sanitization in those cases. Is there a better solution?

    Read the article

  • How to use sprintf instead of hardcoded values

    - by astha goyal
    I am developing a firewall for Linux as my project. I am able to capture packets and to block them. I am using IPTABLES. How can I use variables with sprintf instead of hardcoded values? sprintf(comm, "iptables -A INPUT -s $str -j DROP") // inplace of: sprintf(comm, "iptables -A INPUT -s 192.168.0.43 -j DROP")

    Read the article

  • Uploading to TwitVid using x_verify_credentials_authorization

    - by deepa
    Hi, I am developing an iPhone application that uploads videos to TwitVid using the library TwitVid-iPhone-OAuth3. I have selected this library since Twitter is shifting to OAuth mechanism of authentication. 1) Does this new library allows to upload without user-name and password parameters? 2) I am using the following steps for uploading videos (assumed that new library allows to upload without user-name and password parameters). But, I am getting the error 'Incorrect Signature'. I am not able to identify the mistake that I am doing here. Could you please help me out to solve this problem. Authenticate the app using OAuth (MGTwitterEngine etc) which redirects the user to the web-page asking for log-in and app authentication. If the user authenticates the app, access token will obtained as final step. Upload the video to TwitVid using the following code snippet: OAuth *authorizer = [[OAuth alloc] initWithConsumerKey: @"my_consumer_key" andConsumerSecret: @"my_consumer_secret"]; authorizer.oauth_token = //The key-part of the access token obtained in step 2 authorizer.oauth_token_secret = //The secret-part of the access token obtained in step 2 authorizer.oauth_token_authorized = YES; //Since authenticated in steps 1 and 2 NSString *authHeader = [authorizer oAuthHeaderForMethod: @"POST" andUrl: @"https://api.twitter.com/1/account/verify_credentials.xml" andParams: nil]; twitVid = [[TwitVid alloc] init]; [mTwitVid setDelegate: self]; [mTwitVid authenticateWithXVerifyCredentialsAuthorization: authHeader xAuthServiceProvider: nil]; Thanks and Regards, Deepa

    Read the article

  • How to get the sending email address from outlook 2007

    - by Naresh
    I am working on outlook add-in project using Visual studio 2008 for MS Outlook 2007 in C#. Here I am explaining my problem... I got multiple accounts (3 Accounts) with my outlook 2007. I need to get accounts form Account box in New Mail Message window. When we click New Mail Message, a new window will appear from which we can send a new mail. Here (On this window) we can see Account Dropdown (Left side) under the Send Button. If we have multiple accounts with outlook, we can see all the accounts in Account Drop Down if we click on Account Box. If we click on the particular email, a right mark will appear to that Email Account and a message can bee seen on the top of the Send button is "This message will be sent via [email protected]". So, I want to get these email accounts into a string and that particular email account (which has right mark) into another string. I got these 3 email accounts into a string. But, I am not getting the particular email account(which has the right mark when we send a new email). I am using this code.... using Outlook = Microsoft.Office.Interop.Outlook; using Office = Microsoft.Office.Core; using Microsoft.Office.Interop.Outlook; Outlook._Application myOutlookApp = new Outlook.Application(); Outlook.Accounts myAccounts = myOutlookApp.Session.Accounts; foreach (Outlook.Account account in myAccounts) { string emailAddress = account.SmtpAddress; } I am able to get all the accounts from the above code..But, I just want to get the email address which we will use for sending an email at that particular moment..

    Read the article

  • Unable to import nltk in NetBeans

    - by afs
    Hello all, I am trying to import NLTK in my python code and I get this error: Traceback (most recent call last): File "/home/afs/NetBeansProjects/NER/getNE_followers.py", line 7, in import nltk ImportError: No module named nltk I am using NetBeans: 6.7.1, Python 2.6 NLTK. My NLTK module is installed in /usr/local/lib/python2.6/dist-packages/nltk/ and I have added this in Python paths in Netbeans. What am I missing here? Thanks in advance.

    Read the article

  • How to hide specific header item in grid

    - by Vara Prasad.M
    Hi, I am using RadGrid and i am displaying the header item with months if the month data is null then i have to make invisible the entire column including the header text i am using Telerik version Grid. Please reply it fast Waiting for the reply, Thanks in Advance Vara Prasad.M

    Read the article

  • localization in iphone

    - by shishir.bobby
    HI all, i m working on an app,which need localization. I am using a tab bars, having five tabs, and navigation controller. i am able to change title according to locales,but the navigation controllers rightbarbutton which navigates to previuos view, showing English(united states), when i change local to english. What i am doing wrong. plz suggest me some solution. regard shishir

    Read the article

  • Running Magento for multiple clients - single Installaton vs. multiple installations

    - by Chris Hopkins
    Hi There I am looking to set-up a Magento (Community Edition) installation for multiple clients and have researched the matter for a few days now. I can see that the Enterprise Edition has what I need in it, but surprisingly I am not willing to shell out the $12,000 odd yearly subscription. It seems there are a few options available to be but I am worried about the performance I will get out of the various options. Option 1) Single install using AITOC advanced permissions module So this is really what I am after; one installation so that I can update my core files all at the same time and also manage all my store users from one place. The problems here are that I don't know anything about the reliability of this extra product and that I have to pay a bit extra. I am also worried that if I have 10 stores running off this one installation it might all slow down so much and keel over as I have heard allot about Magento's slowness. Module Link: http://www.aitoc.com/en/magentomods_advanced_permissions.html Option 2) Multiple installations of Magento on one server for each shop So here I have 10 Magento installations on one server all running happily away not using any extra money, but I now have 10 separate stores to update and maintain which could be annoying. Also I haven't been able to find a whole lot of other people using this method and when I have they are usually asking how to stop their servers from dying. So this route seems like it could be even worse on my server as I will have more going on on my server but if my server could take it each Magento installation would be simpler and less likely to slow down due to each one having to run 10 shops on its own? Option 3) Use lots of servers and lots of Magento installations I just so do not want to do this. Option 4) Buy Magento Enterprise I do not have the money to do this. So which route is less likely to blow up my server? And does anyone have experience with this holy grail of a module? Thanks for reading and thanks in advance for any help - Chris Hopkins

    Read the article

  • How to send an IM in C or C++ on Windows

    - by dave9909
    Specifically I am talking about using AIM and sending instant messages to an existing AIM screename. How would I accomplish this? I am trying to do it the simplest way possible -efficiency is not that important. I thought maybe all I would have to do is open a socket connections some how but I am probably wrong.

    Read the article

  • Conditional CSS file doesn't override regular CSS

    - by dmr
    I am using conditional comments to link to a css file (let's call it "IEonly.css") if the IE version is less than 8. I am trying to override some properties in the regular css file. Strangely enough, IEonly.css will set new css properties correctly, but it won't override the properties in the regular CSS file! (I am trying to make this work for IE7). Help!

    Read the article

  • Trying to debug a 'Assertion failure in -[UIActionSheet showInView:]' error....

    - by dsobol
    I am working through "Beginning iPad Application Development" and am getting hung up in Chapter 3 where I have created a project that works with an Action Sheet. As it stands now, my application loads into the simulator just fine with no errors that I am aware of, but as it runs, it crashes with the following errors showing up in the debugger window: 2010-05-31 19:44:39.703 UsingViewsActionSheet[49538:207] * Assertion failure in -[UIActionSheet showInView:], /SourceCache/UIKit_Sim/UIKit-1145.66/UIAlert.m:7073 2010-05-31 19:44:39.705 UsingViewsActionSheet[49538:207] * Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Invalid parameter not satisfying: view != nil' I am sure that this is the block where the app breaks based upon my use of breakpoints. //Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { UIActionSheet *action = [[UIActionSheet alloc] initWithTitle:@"This is my Action Sheet!" delegate:self cancelButtonTitle:@"OK" destructiveButtonTitle:@"Delete Message!" otherButtonTitles:@"Option 1", @"Option 2", @"Option 3", nil]; [action showInView:self.view]; // <-- This line seems to trigger the crash.... [action release]; [super viewDidLoad]; } Am I missing something obvious, or is there more to the problem than is shown here? I have looked at the abstract for showInView and cannot divine anything there yet. I appreciate any and all asssitance. Regards, Steve O'Sullivan

    Read the article

< Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >