Search Results

Search found 65558 results on 2623 pages for 'large data'.

Page 155/2623 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • Core Data: Inverse relationship only mirrors when I edit the mutableset. Not sure why.

    - by zorn
    My model is setup so Business has many clients, Client has one business. Inverse relationship is setup in the mom file. I have a unit test like this: - (void)testNewClientFromBusiness { PTBusiness *business = [modelController newBusiness]; STAssertTrue([[business clients] count] == 0, @"is actually %d", [[business clients] count]); PTClient *client = [business newClient]; STAssertTrue([business isEqual:[client business]], nil); STAssertTrue([[business clients] count] == 1, @"is actually %d", [[business clients] count]); } I implement -newClient inside of PTBusiness like this: - (PTClient *)newClient { PTClient *client = [NSEntityDescription insertNewObjectForEntityForName:@"Client" inManagedObjectContext:[self managedObjectContext]]; [client setBusiness:self]; [client updateLocalDefaultsBasedOnBusiness]; return client; } The test fails because [[business clients] count] is still 0 after -newClient is called. If I impliment it like this: - (PTClient *)newClient { PTClient *client = [NSEntityDescription insertNewObjectForEntityForName:@"Client" inManagedObjectContext:[self managedObjectContext]]; NSMutableSet *group = [self mutableSetValueForKey:@"clients"]; [group addObject:client]; [client updateLocalDefaultsBasedOnBusiness]; return client; } The tests passes. My question(s): So am I right in thinking the inverse relationship is only updated when I interact with the mutable set? That seems to go against some other Core Data docs I've read. Is the fact that this is running in a unit test without a run loop have anything to do with it? Any other troubleshooting recommendations? I'd really like to figure out why I can't set up the relationship at the client end.

    Read the article

  • Firebird Data Access Designer (DDEX) installation

    - by persian Dev
    hi i want to use firebird library , and i followed its instruction as below , but i get "The referenced component 'FirebirdSql.Data.Firebird' could not be found." error. instruction : Prerequisites Make sure that you have Visual Studio .NET 2005 Standard or higher edition. Express editions are not supported. Registry update Remember to update the path in FirebirdDDEXProviderPackageLess32.reg or FirebirdDDEXProviderPackageLess64.reg, places where to update it are marked %Path%. Install the .reg file into the registry. Machine.config update Add the following two sections to machine.config (located usually at C:\WINDOWS\Microsoft.NET\Framework\v2.0.50727\CONFIG\machine.config and C:\WINDOWS\Microsoft.NET\Framework64\v2.0.50727\CONFIG\machine.config on 64-bit system). <configuration> ... <configSections> ... <section name="firebirdsql.data.firebirdclient" type="System.Data.Common.DbProviderConfigurationHandler, System.Data, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" /> ... </configSections> ... <system.data> <DbProviderFactories> ... <add name="FirebirdClient Data Provider" invariant="FirebirdSql.Data.FirebirdClient" description=".Net Framework Data Provider for Firebird" type="FirebirdSql.Data.FirebirdClient.FirebirdClientFactory, FirebirdSql.Data.FirebirdClient, Version=%Version%, Culture=%Culture%, PublicKeyToken=%PublicKeyToken%" /> ... </DbProviderFactories> </system.data> ... </configuration> And subst: %Version% With the version of the provider assembly that you have in the GAC. %Culture% With the culture of the provider assembly that you have in the GAC. %PublicKeyToken% With the PublicKeyToken of the provider assembly that you have in the GAC.

    Read the article

  • Is a red-black tree my ideal data structure?

    - by Hugo van der Sanden
    I have a collection of items (big rationals) that I'll be processing. In each case, processing will consist of removing the smallest item in the collection, doing some work, and then adding 0-2 new items (which will always be larger than the removed item). The collection will be initialised with one item, and work will continue until it is empty. I'm not sure what size the collection is likely to reach, but I'd expect in the range 1M-100M items. I will not need to locate any item other than the smallest. I'm currently planning to use a red-black tree, possibly tweaked to keep a pointer to the smallest item. However I've never used one before, and I'm unsure whether my pattern of use fits its characteristics well. 1) Is there a danger the pattern of deletion from the left + random insertion will affect performance, eg by requiring a significantly higher number of rotations than random deletion would? Or will delete and insert operations still be O(log n) with this pattern of use? 2) Would some other data structure give me better performance, either because of the deletion pattern or taking advantage of the fact I only ever need to find the smallest item? Update: glad I asked, the binary heap is clearly a better solution for this case, and as promised turned out to be very easy to implement. Hugo

    Read the article

  • Fetching Core Data for Tableview on iPhone - Tutorial leaves me with crashes when adding items to a

    - by Gordon Fontenot
    Been following the Core Data tutorial on Apple's developer site, and all is good until I have to add something to the fetched store. I am getting this error after a successful build and load when I try to add a new item to the list: Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (0) must be equal to the number of rows contained in that section before the update (0), plus or minus the number of rows inserted or deleted from that section (1 inserted, 0 deleted). Due to the fact that the fetch goes through fine, and that if I replace the fetching with eventList = [[NSMutableArray alloc] init] it works as expected (without persistance, of course), I am led to believe that the problem comes from not creating the Mutable Array correctly. Here's the problematic part of the code: NSFetchRequest *request = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"Event" inManagedObjectContext:managedObjectContext]; [request setEntity:entity]; NSSortDescriptor *sortDescriptor = [[NSSortDescriptor alloc] initWithKey:@"creationDate" ascending:NO]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortDescriptor, nil]; [request setSortDescriptors:sortDescriptors]; [sortDescriptors release]; [sortDescriptor release]; NSError *error; NSMutableArray *mutableFetchResults = [[managedObjectContext executeFetchRequest:request error:&error] mutableCopy]; if (mutableFetchResults = nil) { //Handle the error } [self setEventList:mutableFetchResults]; [mutableFetchResults release]; [request release]; I have tried switching the NSArrays in the second chunk out with NSMutableArrays, but I still get the same error. For reference, the section of code that is throwing the error when I try adding an entry is here: [eventList insertObject:event atIndex:0]; NSIndexPath *indexPath = [NSIndexPath indexPathForRow:0 inSection:0]; [self.tableView insertRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:UITableViewRowAnimationFade]; [self.tableView scrollToRowAtIndexPath:[NSIndexPath indexPathForRow:0 inSection:0] atScrollPosition:UITableViewScrollPositionTop animated:YES]; it errors out at the insertRowsAtIndexPaths call. Thanks in advance for any help

    Read the article

  • What is a data structure for quickly finding non-empty intersections of a list of sets?

    - by Andrey Fedorov
    I have a set of N items, which are sets of integers, let's assume it's ordered and call it I[1..N]. Given a candidate set, I need to find the subset of I which have non-empty intersections with the candidate. So, for example, if: I = [{1,2}, {2,3}, {4,5}] I'm looking to define valid_items(items, candidate), such that: valid_items(I, {1}) == {1} valid_items(I, {2}) == {1, 2} valid_items(I, {3,4}) == {2, 3} I'm trying to optimize for one given set I and a variable candidate sets. Currently I am doing this by caching items_containing[n] = {the sets which contain n}. In the above example, that would be: items_containing = [{}, {1}, {1,2}, {2}, {3}, {3}] That is, 0 is contained in no items, 1 is contained in item 1, 2 is contained in itmes 1 and 2, 2 is contained in item 2, 3 is contained in item 2, and 4 and 5 are contained in item 3. That way, I can define valid_items(I, candidate) = union(items_containing[n] for n in candidate). Is there any more efficient data structure (of a reasonable size) for caching the result of this union? The obvious example of space 2^N is not acceptable, but N or N*log(N) would be.

    Read the article

  • Sql Exception: Error converting data type numeric to numeric

    - by Lucifer
    Hello We have a very strange issue with a database that has been moved from staging to production. The first time the database was moved it was by detaching, copying and reattaching, the second time we tried restoring from a backup of the staging. Both SQL Servers are the same version of MS SQL 2008, running on 64 bit hardware. The code accessing the database is the same build, built using the .net 2.0 framework. Here is the error message and some of the stack trace: Exception Details: System.Data.SqlClient.SqlException: Error converting data type numeric to numeric. Stack Trace: [SqlException (0x80131904): Error converting data type numeric to numeric.] System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection) +1953274 System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) +4849707 System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) +194 System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) +2392 System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString) +204 System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async) +954 System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result) +162 System.Data.SqlClient.SqlCommand.InternalExecuteNonQuery(DbAsyncResult result, String methodName, Boolean sendToPipe) +175 System.Data.SqlClient.SqlCommand.ExecuteNonQuery() +137 Version Information: Microsoft .NET Framework Version:2.0.50727.4200; ASP.NET Version:2.0.50727.4016

    Read the article

  • How to stop Android GPS using "Mobile data"

    - by prepbgg
    My app requests location updates with "minTime" set to 2 seconds. When "Mobile data" is switched on (in the phone's settings) and GPS is enabled the app uses "mobile data" at between 5 and 10 megabytes per hour. This is recorded in the ICS "Data usage" screen as usage by "Android OS". In an attempt to prevent this I have unticked Settings-"Location services"-"Google's location service". Does this refer to Assisted GPS, or is it something more than that? Whatever it is, it seems to make no difference to my app's internet access. As further confirmation that it is the GPS usage by my app that is causing the mobile data access I have observed that the internet data activity indicator on the status bar shows activity when and only when the GPS indicator is present. The only way to prevent this mobile data usage seems to be to switch "Mobile data" off, and GPS accuracy seems to be almost as good without the support of mobile data. However, it is obviously unsatisfactory to have to switch mobile data off. The only permissions in the Manifest are "android.permission.ACCESS_FINE_LOCATION" (and "android.permission.WRITE_EXTERNAL_STORAGE"), so the app has no explicit permission to use internet data. The LocationManager code is ` criteria.setAccuracy(Criteria.ACCURACY_FINE); criteria.setSpeedRequired(false); criteria.setAltitudeRequired(false); criteria.setBearingRequired(true); criteria.setCostAllowed(false); criteria.setPowerRequirement(Criteria.NO_REQUIREMENT); bestProvider = lm.getBestProvider(criteria, true); if (bestProvider != null) { lm.requestLocationUpdates(bestProvider, gpsMinTime, gpsMinDistance, this); ` The reference for LocationManager.getBestProvider says If no provider meets the criteria, the criteria are loosened ... Note that the requirement on monetary cost is not removed in this process. However, despite setting setCostAllowed to false the app still incurs a potential monetary cost. What else can I do to prevent the app from using mobile data?

    Read the article

  • Store the cache data locally

    - by Lu Lu
    Hello, I develops a C# Winform application, it is a client and connect to web service to get data. The data returned by webservice is a DataTable. Client will display it on a DataGridView. My problem is that: Client will take more time to get all data from server (web service is not local with client). So I must to use a thread to get data. This is my model: Client create a thread to get data - thread complete and send event to client - client display data on datagridview on a form. However, when user closes the form, user can open this form in another time, and client must get data again. This solution will cause the client slowly. So, I think about a cached data: Client <---get/add/edit/delete--- Cached Data ---get/add/edit/delete---Server (web service) Please give me some suggestions. Example: cached data should be developed in another application which is same host with client? Or cached data is running in client. Please give me some techniques to implement this solution. If having any examples, please give me. Thanks.

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Hang during databinding of large amount of data to WPF DataGrid

    - by nihi_l_ist
    Im using WPFToolkit datagrid control and do the binding in such way: <WpfToolkit:DataGrid x:Name="dgGeneral" SelectionMode="Single" SelectionUnit="FullRow" AutoGenerateColumns="False" CanUserAddRows="False" CanUserDeleteRows="False" Grid.Row="1" ItemsSource="{Binding Path=Conversations}" > public List<CONVERSATION> Conversations { get { return conversations; } set { if (conversations != value) { conversations = value; NotifyPropertyChanged("Conversations"); } } } public event PropertyChangedEventHandler PropertyChanged; public void NotifyPropertyChanged(string propertyName) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } public void GenerateData() { BackgroundWorker bw = new BackgroundWorker(); bw.WorkerSupportsCancellation = bw.WorkerReportsProgress = true; List<CONVERSATION> list = new List<CONVERSATION>(); bw.DoWork += delegate { list = RefreshGeneralData(); }; bw.RunWorkerCompleted += delegate { try { Conversations = list; } catch (Exception ex) { CustomException.ExceptionLogCustomMessage(ex); } }; bw.RunWorkerAsync(); } And than in the main window i call GenerateData() after setting DataCotext of the window to instance of the class, containing GenerateData(). RefreshGeneralData() returns some list of data i want and it returns it fast. Overall there are near 2000 records and 6 columns(im not posting the code i used during grid's initialization, because i dont think it can be the reason) and the grid hangs for almost 10 secs!

    Read the article

  • How to manage large amounts of delegates and usercallbacks in C# async http library

    - by Tyler
    I'm coding a .NET library in C# for communicating with XBMC via its JSON RPC interface using HTTP. I coded and released a preliminary version but everything is done synchronously. I then recoded the library to be asynchronous for my own purposes as I was/am building an XBMC remote for WP7. I now want to release the new async library but want to make sure it's nice and tidy before I do. Due to the async nature a user initiates a request, supplies a callback method that matches my delegate and then handles the response once it's been received. The problem I have is that within the library I track a RequestState object for the lifetime of the request, it contains the http request/response as well as the user callback etc. as member variables, this would be fine if only one type of object was coming back but depending on what the user calls they may be returned a list of songs or a list of movies etc. My implementation at the moment uses a single delegate ResponseDataRecieved which has a single parameter which is a simple Object - As this has only be used by me I know which methods return what and when I handle the response I cast said object to the type I know it really is - List, List etc. A third party shouldn't have to do this though - The delegate signature should contain the correct type of object. So then I need a delegate for every type of response data that can be returned to the third party - The specific problem is, how do I handle this gracefully internally - Do I have a bunch of different RequestState objects that each have a different member variable for the different delegates? That doesn't "feel" right. I just don't know how to do this gracefully and cleanly.

    Read the article

  • Is there a more memory efficient way to search through a Core Data database?

    - by Kristian K
    I need to see if an object that I have obtained from a CSV file with a unique identifier exists in my Core Data Database, and this is the code I deemed suitable for this task: NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity; entity = [NSEntityDescription entityForName:@"ICD9" inManagedObjectContext:passedContext]; [fetchRequest setEntity:entity]; NSPredicate *pred = [NSPredicate predicateWithFormat:@"uniqueID like %@", uniqueIdentifier]; [fetchRequest setPredicate:pred]; NSError *err; NSArray* icd9s = [passedContext executeFetchRequest:fetchRequest error:&err]; [fetchRequest release]; if ([icd9s count] > 0) { for (int i = 0; i < [icd9s count]; i++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; NSString *name = [[icd9s objectAtIndex:i] valueForKey:@"uniqueID"]; if ([name caseInsensitiveCompare:uniqueIdentifier] == NSOrderedSame && name != nil) { [pool release]; return [icd9s objectAtIndex:i]; } [pool release]; } } return nil; After more thorough testing it appears that this code is responsible for a huge amount of leaking in the app I'm writing (it crashes on a 3GS before making it 20 percent through the 1459 items). I feel like this isn't the most efficient way to do this, any suggestions for a more memory efficient way? Thanks in advance!

    Read the article

  • jquery fail to retrieve accurate data from sibling field.

    - by i need help
    wonder what's wrong <table id=tblDomainVersion> <tr> <td>Version</td> <td>No of sites</td> </tr> <tr> <td class=clsversion>1.25</td> <td><a id=expanddomain>3 sites</a><span id=spanshowall></span></td> </tr> <tr> <td class=clsversion>1.37</td> <td><a id=expanddomain>7 sites</a><span id=spanshowall></span></td> </tr> </table> $('#expanddomain').click(function() { //the siblings result incorrect //select first row will work //select second row will no response var versionforselected= $('#expanddomain').parent().siblings("td.clsversion").text(); alert(versionforselected); $.ajax({ url: "ajaxquery.php", type: "POST", data: 'version='+versionforselected, timeout: 900000, success: function(output) { output= jQuery.trim(output); $('#spanshowall').html(output); }, }); });

    Read the article

  • How can I synchronize one set of data with another?

    - by RenderIn
    I have an old database and a new database. The old records were converted to the new database recently. All our old applications continue to point to the old database, but the new applications point to the new database. Currently the old database is the only one being updated, so throughout the day the new database becomes out of sync. It is acceptable for the new database to be out of sync for a day, so until all our applications are pointed to the new database I just need to write a nightly cron job that will bring it up to date. I do not want to purge the new database and run the complete conversion script each night, as that would reduce uptime and would create a mess in our auditing of that table. I'm thinking about selecting all the data from the old database, converting it to the new database structure in memory, and then checking for the existence of each record before inserting it in the new database. After that's done, I'd select everything from the new database and check if it exists in the old one, and if not delete it. Is this the simplest way to do this?

    Read the article

  • Silverlight 4 caching issue?

    - by DavidS
    I am currently experiencing a weird caching problem it would seem. When I load my data intially, I return all the data within given dates and my graph looks as follows: Then I filter the data to return a subset of the original data for the same date range (not that it matters) and I get the following view of my data: However, I intermittently get the following when I refresh the same filterd view of the data: One can see that not all the data gets cached but only some of it i.e. for 12 Dec 2010 and 5 dec 2010(not shown here). I've looked at my queries and the correct data is getting pulled out. It is only on the presentation layer i.e. on Mainpage.xaml.cs that this erroneous data seems to exist. I've stepped through the code and the data is corect through all the layers except on the presentation layer. Has anyone experienced this before? Is there some sort of caching going in the background that is keeping that data in the background as I've got browser caching off? I am using the LoadOperation in the callback method within the Load method of the DomainContext if that helps...

    Read the article

  • Best way to get distinct values from large table

    - by derivation
    I have a db table with about 10 or so columns, two of which are month and year. The table has about 250k rows now, and we expect it to grow by about 100-150k records a month. A lot of queries involve the month and year column (ex, all records from march 2010), and so we frequently need to get the available month and year combinations (ie do we have records for april 2010?). A coworker thinks that we should have a separate table from our main one that only contains the months and years we have data for. We only add records to our main table once a month, so it would just be a small update on the end of our scripts to add the new entry to this second table. This second table would be queried whenever we need to find the available month/year entries on the first table. This solution feels kludgy to me and a violation of DRY. What do you think is the correct way of solving this problem? Is there a better way than having two tables?

    Read the article

  • Dealing with large directories in a checkout

    - by Eric
    I am trying to come up with a version control process for a web app that I work on. Currently, my major stumbling blocks are two directories that are huge (both over 4GB). Only a few people need to work on things within the huge directories; most people don't even need to see what's in them. Our directory structure looks something like: / --file.aspx --anotherFile.aspx --/coolThings ----coolThing.aspx --/bigFolder ----someHugeMovie.mov ----someHugeSound.mp3 --/anotherBigFolder ----... I'm sure you get the picture. It's hard to justify a checkout that has to pull down 8GB of data that's likely useless to a developer. I know, it's only once, but even once could be really frustrating for someone (and will make it harder for me to convince everyone to use source control). (Plus, clean checkouts will be painfully slow.) These folders do have to be available in the web application. What can I do? I've thought about separate repositories for the big folders. That way, you only download if you need it; but then how do I manage checking these out onto our development server? I've also thought about not trying to version control those folders: just update them directly on the web server... but I am not enamored of this idea. Is there some magic way to simply exclude directories from a checkout that I haven't found? (Pretty sure there is not.) Of course, there's always the option to just give up, bite the bullet, and accept downloading 8 useless GB. What say you? Have you encountered this problem before? How did you solve it?

    Read the article

  • Can't Deploy or Upload Large SSRS 2008 Report from VS or IE

    - by Bratch
    So far in this project I have two reports in VS2008/BIDS. The first one contains 1 tablix and is about 100k. The second one contains 3 tablixes (tablices?) and is about 257k. I can successfully deploy the smaller report from VS and I can upload it from the Report Manager in IE. I can view/run it from Report Manager and I can get to the Report Server (web service) URL from my browser just fine. Everything is done over HTTPS and there is nothing wrong with the certificates. With the larger report, the error I get in VS is "The operation has timed out" after about 100 seconds. The error when I upload from IE is "The underlying connection was closed: An unexpected error occurred on a send" after about 130 seconds. In the RSReportServer.config file I tried changing Authentication/EnableAuthPersistence from true to false and restarting the service, but still get the error. I have the key "SecureConnectionLevel" set to 2. Changing this to 0 and turning off SSL is not going to be an option. I added a registry key named "MaxRequestBytes" to HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\HTTP\Parameters and set it to 5242880 (5MB) and restarted the HTTP and SRS services as suggested in a forum post by Jin Chen of MSFT. I still cannot upload the larger report. This is on MS SQL 2008 and WS 2003. Below is part of a log file entry from ...\Reporting Services\LogFiles when I attempted to upload from IE. library!WindowsService_0!89c!02/10/2010-07:57:57:: i INFO: Call to CleanBatch() ends ui!ReportManager_0-1!438!02/10/2010-07:59:33:: e ERROR: The underlying connection was closed: An unexpected error occurred on a send. ui!ReportManager_0-1!438!02/10/2010-07:59:34:: e ERROR: HTTP status code -- 500 -------Details-------- System.Net.WebException: The underlying connection was closed: An unexpected error occurred on a send. --- System.IO.IOException: Unable to write data to the transport connection: An established connection was aborted by the software in your host machine. --- System.Net.Sockets.SocketException: An established connection was aborted by the software in your host machine at System.Net.Sockets.Socket.MultipleSend(BufferOffsetSize[] buffers, SocketFlags socketFlags) at System.Net.Sockets.NetworkStream.MultipleWrite(BufferOffsetSize[] buffers) --- End of inner exception stack trace --- ...

    Read the article

  • ASP.NET: Large number of Session_Start with same session id

    - by Jaap
    I'm running a ASP.NET website on my development box (.NET 2.0 on Vista/IIS7). The Session_Start method in global.asax.cs logs every call to a file (log4net). The Session_End method also logs every call. I'm using InProc session state, and set the session timeout to 5 mins (to avoid waiting for 20 mins). I hit the website, wait for 5 minutes unit I see the Session_End logging. Then I F5 the website. The browsers still has the session cookie and sends it to the server. Session_Start is called and a new session is created using the same session id (btw: I need this to be the same session id, because it is used to store data in database). Result: Every time I hit F5 on a previously ended session, the Session_Start method is called. When I open a different browser, the Session_Start method is called just once. Then after 5 minutes the Session_End each F5 causes the Session_Start method to execute. Can anyone explain why this is happening? Update: After the Session timeout, all subsequent requests have a session start & session end. So in the end my question is: why are the sessions on these subsequent request closed immediatly? 2010-02-09 14:49:08,754 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,754 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET http://localhost:80/js/settings.js 2010-02-09 14:49:08,756 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,760 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,760 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=core 2010-02-09 14:49:08,761 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,762 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,762 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /js/package.aspx?name=all 2010-02-09 14:49:08,763 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,763 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,763 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=rest 2010-02-09 14:49:08,764 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,764 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,765 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=vacation 2010-02-09 14:49:08,765 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq web.config relevant section: <system.web> <compilation debug="true" /> <sessionState timeout="2" regenerateExpiredSessionId="false" /> </system.web>

    Read the article

  • Importing wikipedia database dumb - kills navicat - anyone got any ideas?

    - by Ali
    Ok guys I've downloaded the wikipedia xml dump and its a whopping 12 GB of data :\ for one table and I wanted to import it into mysql databse on my localhost - however its a humongous file 12GB and obviously navicats taking its sweet time in importing it or its more likely its hanged :(. Is there a way to include this dump or atleast partially at most you know bit by bit. Let me correct that its 21 GB of data - not that it helps :\ - does any one have any idea of importing humongous files like this into MySQL database.

    Read the article

  • Is there a fast way to jump to element using XMLReader?

    - by Derk
    I am using XMLReader to read a large XML file with about 1 million elements on the level I am reading from. However, I've calculated it will take over 10 seconds when I jump to -for instance- element 500.000 using XMLReader::next ([ string $localname ] ) or XMLReader::read ( void ) This is not very usable. Is there a faster way to do this?

    Read the article

  • What method should be used for searching this mysql dataset?

    - by GeoffreyF67
    I've got a mysql dataset that contains 86 million rows. I need to have a relatively fast search through this data. The data I'll be searching through is all strings. I also need to do partial matches. Now, if I have 'foobar' and search for '%oob%' I know it'll be really slow - it has to look at every row to see if there is a match. What methods can be used to speed queries like this up? G-Man

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >