Search Results

Search found 11959 results on 479 pages for 'multi module'.

Page 156/479 | < Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >

  • Is there a way to control two instantiated systemd services as a single unit?

    - by rascalking
    I've got a couple python web services I'm trying to run on a Fedora 15 box. They're being run by paster, and the only difference in starting them is the config file they read. This seems like a good fit for systemd's instantiated services, but I'd like to be able to control them as a single unit. A systemd target that requires both services seems like the way to approach that. Starting the target does start both services, but stopping the target leaves them running. Here's the service file: [Unit] Description=AUI Instance on Port %i After=syslog.target [Service] WorkingDirectory=/usr/local/share/aui ExecStart=/opt/cogo/bin/paster serve --log-file=/var/log/aui/%i deploy-%i.ini Restart=always RestartSec=2 User=aui Group=aui [Install] WantedBy=multi-user.target And here's the target file: [Unit] Description=AUI [email protected] [email protected] After=syslog.target [Install] WantedBy=multi-user.target Is this kind of grouping even possible with systemd?

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • web (server) based password manager

    - by laurens
    Hi all! I know there have been a few topics here about password managers but I read them all and did not really find what I'm looking for. What I'd need is a free or cheap (most password mgr software is $500 for 20+ users, exaggerated!) multi-user password manager, highly preferable web-based so that we can host it on one of our local server, of Hyper-V VM's. So: -free or cheap ( <100$) -multi-user of groups -web based -not very hard to install I tried a few, one very expensive, one I did not get to work- Web Keepass Manager This works with tomcat and probably conflicts with our IIS 7.0 or 7.5 PS: thus, nothing online (!) it has to stay local Thanks in advance!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Two keyboards - one qwerty one dvorak. Can windows use both simultaneously?

    - by Alain
    Similar to this question: Is it possible to use multi keyboards with multi keyboard layouts simultaneously? - I have two keyboards plugged in simultaneously. Both are querty keyboards, but I've rearranged the keys on one to be a dvorak layout. I'd like to find some way to configure windows (XP) such that while both keyboards are plugged in, typing on each results in it's respective layout. I'd prefer if there was someway to have the system automatically use the desired layout based on which USB keyboard it is receiving input from. If no such solution is possible, I would settle for a fast way of switching between US English and US English Dvorak languages so that in a pinch I can easily go from one to the other. Thanks.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • Opencart SEO URL

    - by user2483877
    My question is, I have installed the SEO component successfully, and its working well but; On homepage, the Latest Products module shows the url like http://www.domain.com/product-21.html On category page, the product shows the url like http://www.domain.com/category/product-21.html I want to put the category URL in the latest products module so it will be the same as on category page. Does anybody have any ideas about this?

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • How can I read a file's contents directly with Perl's Net::FTP?

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file. But I want the file contents instead of the file. I know that using the read method we can read the file contents. But how do I call the read function and how do I get the file contents?

    Read the article

< Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >