Search Results

Search found 13534 results on 542 pages for 'python 3 3'.

Page 158/542 | < Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >

  • supply inputs to python unittests

    - by zubin71
    I`m relatively new to the concept of unit-testing and have very little experience in the same. I have been looking at lots of articles on how to write unit-tests; however, I still have difficulty in writing tests where conditions like the following arise:- Test user Input. Test input read from a file. Test input read from an environment variable. Itd be great if someone could show me how to approach the above mentioned scenarios; itd still be awesome if you could point me to a few docs/articles/blog posts which I could read.

    Read the article

  • Python module being reloaded for each request with django and mod_wsgi

    - by Vishal
    I have a variable in init of a module which get loaded from the database and takes about 15 seconds. For django development server everything is working fine but looks like with apache2 and mod_wsgi the module is loaded with every request (taking 15 seconds). Any idea about this behavior? Update: I have enabled daemon mode in mod wsgi, looks like its not reloading the modules now! needs more testing and I will update.

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

  • Sorting Python list based on the length of the string

    - by prosseek
    I want to sort a list of strings based on the string length. I tried to use sort as follows, but it doesn't seem to give me correct result. xs = ['dddd','a','bb','ccc'] print xs xs.sort(lambda x,y: len(x) < len(y)) print xs ['dddd', 'a', 'bb', 'ccc'] ['dddd', 'a', 'bb', 'ccc'] What might be wrong?

    Read the article

  • Optimizing python link matching regular expression

    - by Matt
    I have a regular expression, links = re.compile('<a(.+?)href=(?:"|\')?((?:https?://|/)[^\'"]+)(?:"|\')?(.*?)>(.+?)</a>',re.I).findall(data) to find links in some html, it is taking a long time on certain html, any optimization advice? One that it chokes on is http://freeyourmindonline.net/Blog/

    Read the article

  • [Python/Tkinter] Grid within a frame?

    - by Sam
    Is it possible to place a grid of buttons in Tkinter inside another frame? I'm wanting to create a tic-tac-toe like game and want to use the grid feature to put gamesquares (that will be buttons). However, I'd like to have other stuff in the GUI other than just the game board so it's not ideal to just have everything in the one grid. To illustrate: O | X | X | ---------- | O | O | X | Player 2 wins! ---------- | X | O | X | The tic tac toe board is in a grid that is made up of all buttons and the 'player 2 wins' is a label inside a frame. This is an oversimplification of what I'm trying to do so bear with me, for the way I've designed the program so far (the board is dynamically created) a grid makes the most sense.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python: Unpack arbitary length bits for database storage

    - by sberry2A
    I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Python metaprogramming help

    - by Timmy
    im looking into mongoengine, and i wanted to make a class an "EmbeddedDocument" dynamically, so i do this def custom(cls): cls = type( cls.__name__, (EmbeddedDocument,), cls.__dict__.copy() ) cls.a = FloatField(required=True) cls.b = FloatField(required=True) return cls A = custom( A ) and tried it on some classes, but its not doing some of the base class's init or sumthing in BaseDocument def __init__(self, **values): self._data = {} # Assign initial values to instance for attr_name, attr_value in self._fields.items(): if attr_name in values: setattr(self, attr_name, values.pop(attr_name)) else: # Use default value if present value = getattr(self, attr_name, None) setattr(self, attr_name, value) but this never gets used, thus never setting ._data, and giving me errors. how do i do this?

    Read the article

  • Python combinations no repeat by constraint

    - by user2758113
    I have a tuple of tuples (Name, val 1, val 2, Class) tuple = (("Jackson",10,12,"A"), ("Ryan",10,20,"A"), ("Michael",10,12,"B"), ("Andrew",10,20,"B"), ("McKensie",10,12,"C"), ("Alex",10,20,"D")) I need to return all combinations using itertools combinations that do not repeat classes. How can I return combinations that dont repeat classes. For example, the first returned statement would be: tuple0, tuple2, tuple4, tuple5 and so on.

    Read the article

  • How to print a dictionary in python c api function

    - by dizgam
    PyObject* dict = PyDict_New(); PyDict_SetItem(dict, key, value); PyDict_GetItem(dict, key); Bus error if i use getitem function otherwise not. So Want to confirm that the dictionary has the same values which i have set. Other than using PyDict_GetItem function, Is there any other method to print the values of the dictionary?

    Read the article

  • python: problem with dictionary get method default value

    - by goutham
    I'm having a new problem here .. CODE 1: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name']))) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) CODE 2: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']])) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name']) code 2 fails but code 1 works the data serverInfo_D:{'user': 'usr', 'pass': 'pass'} data: {'par1': 9995, 'extraparam1': 22} val: {'par1','user','pass','extraparam1'} exception are raised for for data dict .. and all code in for loop which iterates over val

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Python 4 steps setup with progressBars

    - by Samuel Taylor
    I'm having a problem with the code below. When I run it the progress bar will pulse for around 10 secs as meant to and then move on to downloading and will show the progress but when finished it will not move on to the next step it just locks up. import sys import time import pygtk import gtk import gobject import threading import urllib import urlparse class WorkerThread(threading.Thread): def __init__ (self, function, parent, arg = None): threading.Thread.__init__(self) self.function = function self.parent = parent self.arg = arg self.parent.still_working = True def run(self): # when does "run" get executed? self.parent.still_working = True if self.arg == None: self.function() else: self.function(self.arg) self.parent.still_working = False def stop(self): self = None class MainWindow: def __init__(self): gtk.gdk.threads_init() self.wTree = gtk.Builder() self.wTree.add_from_file("gui.glade") self.mainWindows() def mainWindows(self): self.mainWindow = self.wTree.get_object("frmMain") dic = { "on_btnNext_clicked" : self.mainWindowNext, } self.wTree.connect_signals(dic) self.mainWindow.show() self.installerStep = 0 # 0 = none, 1 = preinstall, 2 = download, 3 = install info, 4 = install #gtk.main() self.mainWindowNext() def pulse(self): self.wTree.get_object("progress").pulse() if self.still_working == False: self.mainWindowNext() return self.still_working def preinstallStep(self): self.wTree.get_object("progress").set_fraction(0) self.wTree.get_object("btnNext").set_sensitive(0) self.wTree.get_object("notebook1").set_current_page(0) self.installerStep = 1 WT = WorkerThread(self.heavyWork, self) #Would do a heavy function here like setup some thing WT.start() gobject.timeout_add(75, self.pulse) def downloadStep(self): self.wTree.get_object("progress").set_fraction(0) self.wTree.get_object("btnNext").set_sensitive(0) self.wTree.get_object("notebook1").set_current_page(0) self.installerStep = 2 urllib.urlretrieve('http://mozilla.mirrors.evolva.ro//firefox/releases/3.6.3/win32/en-US/Firefox%20Setup%203.6.3.exe', '/tmp/firefox.exe', self.updateHook) self.mainWindowNext() def updateHook(self, blocks, blockSize, totalSize): percentage = float ( blocks * blockSize ) / totalSize if percentage > 1: percentage = 1 self.wTree.get_object("progress").set_fraction(percentage) while gtk.events_pending(): gtk.main_iteration() def installInfoStep(self): self.wTree.get_object("btnNext").set_sensitive(1) self.wTree.get_object("notebook1").set_current_page(1) self.installerStep = 3 def installStep(self): self.wTree.get_object("progress").set_fraction(0) self.wTree.get_object("btnNext").set_sensitive(0) self.wTree.get_object("notebook1").set_current_page(0) self.installerStep = 4 WT = WorkerThread(self.heavyWork, self) #Would do a heavy function here like setup some thing WT.start() gobject.timeout_add(75, self.pulse) def mainWindowNext(self, widget = None): if self.installerStep == 0: self.preinstallStep() elif self.installerStep == 1: self.downloadStep() elif self.installerStep == 2: self.installInfoStep() elif self.installerStep == 3: self.installStep() elif self.installerStep == 4: sys.exit(0) def heavyWork(self): time.sleep(10) if __name__ == '__main__': MainWindow() gtk.main() I have a feeling that its something to do with: while gtk.events_pending(): gtk.main_iteration() Is there a better way of doing this?

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • Organizing a random list of objects in Python.

    - by Saebin
    So I have a list that I want to convert to a list that contains a list for each group of objects. ie ['objA.attr1', 'objC', 'objA.attr55', 'objB.attr4'] would return [['objA.attr1', 'objA.attr55'], ['objC'], ['objB.attr4']] currently this is what I use: givenList = ['a.attr1', 'b', 'a.attr55', 'c.attr4'] trgList = [] objNames = [] for val in givenList: obj = val.split('.')[0] if obj in objNames: id = objNames.index(obj) trgList[id].append(val) else: objNames.append(obj) trgList.append([val]) #print trgList It seems to run a decent speed when the original list has around 100,000 ids... but I am curious if there is a better way to do this. Order of the objects or attributes does not matter. Any ideas?

    Read the article

  • Rectangle Rotation in Python/Pygame

    - by mramazingguy
    Hey I'm trying to rotate a rectangle around its center and when I try to rotate the rectangle, it moves up and to the left at the same time. Does anyone have any ideas on how to fix this? def rotatePoint(self, angle, point, origin): sinT = sin(radians(angle)) cosT = cos(radians(angle)) return (origin[0] + (cosT * (point[0] - origin[0]) - sinT * (point[1] - origin[1])), origin[1] + (sinT * (point[0] - origin[0]) + cosT * (point[1] - origin[1]))) def rotateRect(self, degrees): center = (self.collideRect.centerx, self.collideRect.centery) self.collideRect.topleft = self.rotatePoint(degrees, self.collideRect.topleft, center) self.collideRect.topright = self.rotatePoint(degrees, self.collideRect.topright, center) self.collideRect.bottomleft = self.rotatePoint(degrees, self.collideRect.bottomleft, center) self.collideRect.bottomright = self.rotatePoint(degrees, self.collideRect.bottomright, center)

    Read the article

  • Python hash() can't handle long integer?

    - by Xie
    I defined a class: class A: ''' hash test class a = A(9, 1196833379, 1, 1773396906) hash(a) -340004569 This is weird, 12544897317L expected. ''' def __init__(self, a, b, c, d): self.a = a self.b = b self.c = c self.d = d def __hash__(self): return self.a * self.b + self.c * self.d Why, in the doctest, hash() function gives a negative integer?

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

< Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >