Search Results

Search found 45441 results on 1818 pages for 'string to date'.

Page 164/1818 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • how to push a string address to stack with assembly, machine code

    - by Yigit
    Hi all, I am changing minesweeper.exe in order to have an understanding of how code injection works. Simply, I want the minesweeper to show a message box before starting. So, I find a "cave" in the executable and then define the string to show in messagebox and call the messagebox. Additionally of course, I have to change the value at module entry point of the executable and first direct it to my additional code, then continue its own code. So at the cave what I do; "hello starbuck",0 push 0 //arg4 of MessageBoxW function push the address of my string //arg3, must be title push the address of my string //arg2, must be the message push 0 //arg1 call MessageBoxW ... Now since the memory addresses of codes in the executable change everytime it is loaded in the memory, for calling the MessageBoxW function, I give the offset of the address where MessageBoxW is defined in Import Address Table. For instance, if MessageBoxW is defined at address1 in the IAT and the instruction just after call MessageBoxW is at address2 instead of writing call MessageBoxW, I write call address2 - address1. So my question is, how do I do it for pushing the string's address to the stack? For example, if I do these changes via ollydbg, I give the immediate address of "hello starbuck" for pushing and it works. But after reloading the executable or starting it outside of ollydbg, it naturally fails, since the immediate addresses change. Thanks in advance, Yigit.

    Read the article

  • Sort and limit queryset by comment count and date using queryset.extra() (django)

    - by thornomad
    I am trying to sort/narrow a queryset of objects based on the number of comments each object has as well as by the timeframe during which the comments were posted. Am using a queryset.extra() method (using django_comments which utilizes generic foreign keys). I got the idea for using queryset.extra() (and the code) from here. This is a follow-up question to my initial question yesterday (which shows I am making some progress). Current Code: What I have so far works in that it will sort by the number of comments; however, I want to extend the functionality and also be able to pass a time frame argument (eg, 7 days) and return an ordered list of the most commented posts in that time frame. Here is what my view looks like with the basic functionality in tact: import datetime from django.contrib.comments.models import Comment from django.contrib.contenttypes.models import ContentType from django.db.models import Count, Sum from django.views.generic.list_detail import object_list def custom_object_list(request, queryset, *args, **kwargs): '''Extending the list_detail.object_list to allow some sorting. Example: http://example.com/video?sort_by=comments&days=7 Would get a list of the videos sorted by most comments in the last seven days. ''' try: # this is where I started working on the date business ... days = int(request.GET.get('days', None)) period = datetime.datetime.utcnow() - datetime.timedelta(days=int(days)) except (ValueError, TypeError): days = None period = None sort_by = request.GET.get('sort_by', None) ctype = ContentType.objects.get_for_model(queryset.model) if sort_by == 'comments': queryset = queryset.extra(select={ 'count' : """ SELECT COUNT(*) AS comment_count FROM django_comments WHERE content_type_id=%s AND object_pk=%s.%s """ % ( ctype.pk, queryset.model._meta.db_table, queryset.model._meta.pk.name ), }, order_by=['-count']).order_by('-count', '-created') return object_list(request, queryset, *args, **kwargs) What I've Tried: I am not well versed in SQL but I did try just to add another WHERE criteria by hand to see if I could make some progress: SELECT COUNT(*) AS comment_count FROM django_comments WHERE content_type_id=%s AND object_pk=%s.%s AND submit_date='2010-05-01 12:00:00' But that didn't do anything except mess around with my sort order. Any ideas on how I can add this extra layer of functionality? Thanks for any help or insight.

    Read the article

  • How to decode a html string using xslt

    - by John ClearZ
    I am trying to style an rss feed using xslt. I want to display an image that is stored in the tag on the feed. The problem is it is encoded to display as text on the page instead of being rendered. The following is an example of part of the string. 1). <description>&lt;img src="http&amp;#58;&amp;#47;&amp;#47;buavhw.blu.livefilestore.com&amp;#47;y1ppCokLxFJSG2cmyPdvg... I had to add extra coding to the string above to get it to appear properly here. The string below is how it appears when I paste it directly into the text box. 2). <description><img src="http&#58;&#47;&#47;buavhw.blu.livefilestore.com&#47;y1ppCokLxFJSG2cmyPdvg... If I copy and paste it again from the preview window it only then becomes the following string. 3). <description><img src="http://buavhw.blu.livefilestore.com/y1ppCokLxFJSG2cmyPdvg...

    Read the article

  • Literal ampersands in System.Uri query string

    - by Nathan Baulch
    I'm working on a client app that uses a restful service to look up companies by name. It's important that I'm able to include literal ampersands in my queries since this character is quite common in company names. However whenever I pass %26 (the URI escaped ampersand character) to System.Uri, it converts it back to a regular ampersand character! On closer inspection, the only two characters that aren't converted back are hash (%23) and percent (%25). Lets say I want to search for a company named "Pierce & Pierce": var endPoint = "http://localhost/companies?where=Name eq '{0}'"; var name = "Pierce & Pierce"; Console.WriteLine(new Uri(string.Format(endPoint, name))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeUriString(name)))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeDataString(name)))); All three of the above combinations return: http://localhost/companies?where=Name eq 'Pierce & Pierce' This causes errors on the server side since the ampersand is (correctly) interpreted as a query arg delimiter. What I really need it to return is the original string: http://localhost/companies?where=Name eq 'Pierce %26 Pierce' How can I work around this behavior without discarding System.Uri entirely? I can't replace all ampersands with %26 at the last moment because there will usually be multiple query args involved and I don't want to destroy their delimiters. Note: A similar problem was discussed in this question but I'm specifically referring to System.Uri.

    Read the article

  • bash: listing files in date order, with spaces in filenames

    - by Jason Judge
    I am starting with a file containing a list of hundreds of files (full paths) in a random order. I would like to list the details of the ten latest files in that list. This is my naive attempt: ls -las -t `cat list-of-files.txt` | head -10 That works, so long as none of the files have spaces in, but fails if they do as those files are split up at the spaces and treated as separate files. I have tried quoting the files in the original list-of-files file, but the here-document still splits the files up at the spaces in the filenames. The only way I can think of doing this, is to ls each file individually (using xargs perhaps) and create an intermediate file with the file listings and the date in a sortable order as the first field in each line, then sort that intermediate file. However, that feels a bit cumbersome and inefficient (hundreds of ls commands rather than one or two). But that may be the only way to do it? Is there any way to pass "ls" a list of files to process, where those files could contain spaces - it seems like it should be simple, but I'm stumped.

    Read the article

  • JSF/Facelets: set `action` attribute to a dynamically evaluated string

    - by harto
    In my JSF/Facelets application, I want to dynamically generate a breadcrumb trail from a list of page IDs using a custom tag: <foo:breadcrumbs trail="foo,bar,baz"/> This should generate something like: <h:commandLink action="foo" ... /> <h:commandLink action="bar" ... /> <!-- (etc.) --> My code looks something like this: <ui:repeat value="#{fn:split(trail, ',')}" var="key"> <h:commandLink action="#{key}" ... /> </ui:repeat> The problem with this code is that #{key} is interpreted as a method binding. However, I just want the string value of #{key} to be returned as the navigation outcome. How can I achieve this? The only thing I could think of was creating a dummy managed-bean that has an outcome field and an action handler, and invoke it like so: <h:commandLink action="#{dummy.click}" ...> <f:setPropertyActionListener target="#{dummy.outcome}" value="#{key}" /> </h:commandLink> with the dummy class defined like so: public class Dummy { private String outcome; public String click() { return outcome; } public void setOutcome(String outcome) { this.outcome = outcome; } public void getOutcome() { return outcome; } } That seems ugly though, and I don't know if it would work.

    Read the article

  • Adding a date every few days

    - by Luke
    I have some code that generates fixtures, I am looking to add a fixture date to the code. $totalRounds = $teams - 1; $matchesPerRound = $teams / 2; $rounds = array(); for ($i = 0; $i < $totalRounds; $i++) { $rounds[$i] = array(); } for ($round = 0; $round < $totalRounds; $round++) { for ($match = 0; $match < $matchesPerRound; $match++) { $home = ($round + $match) % ($teams - 1); $away = ($teams - 1 - $match + $round) % ($teams - 1); // Last team stays in the same place while the others // rotate around it. if ($match == 0) { $away = $teams - 1; } $rounds[$round][$match] = "$user[$home]~$team[$home]@$user[$away]~$team[$away]"; } } $team is the amount of teams in the league. I want to add a variable for every 4 days, and for every round of fixtures generated, I want to add 4 days onto the previous round. For example, if today is 3rd may, i want 3rd may for first fixture, 7th may for second fixture, 11th may for third fixture. By fixture i mean round which includes a set of fixtures!

    Read the article

  • Merging sql queries to get different results by date

    - by pedalpete
    I am trying to build a 'recent events' feed and can't seem to get either my query correct, or figure out how to possible merge the results from two queries to sort them by date. One table holds games/, and another table holds the actions of these games/. I am trying to get the recent events to show users 1) the actions taken on games that are publicly visible (published) 2) when a new game is created and published. So, my actions table has actionId, gameid, userid, actiontype, lastupdate My games table has gameid, startDate, createdby, published, lastupdate I currently have a query like this (simplified for easy understanding I hope). SELECT actionId, actions.gameid, userid, actiontype, actions.lastupdate FROM actions JOIN ( SELECT games.gameid, startDate, createdby, published, games.lastupdate FROM games WHERE published=1 AND lastupdate>today-2 ) publishedGames on actions.gameid=games.gameid WHERE actions.type IN (0,4,5,6,7) AND actions.lastupdate>games.lastupdate and published=1 OR games.lastupdate>today-2 AND published=1 This query is looking for actions from published games where the action took place after the game was published. That pretty much takes care of the first thing that needs to be shown. However, I also need to get the results of the SELECT games.gameid, startDate, createdby, published, games.lastupdate FROM games WHERE published=1 AND startDate>today-2 so I can include in the actions list, when a new game has been published. When I run the query as I've got it written, I get all the actionids, and their gameids, but I don't get a row which shows the gameid when it was published. I understand that it may be possible that I need to run two seperate queries, and then somehow merge the results afterword with php, but I'm completely lost on where to start with that as well.

    Read the article

  • How to sort a date array in PHP

    - by Click Upvote
    I have an array in this format: Array ( [0] => Array ( [28th February, 2009] => 'bla' ) [1] => Array ( [19th March, 2009] => 'bla' ) [2] => Array ( [5th April, 2009] => 'bla' ) [3] => Array ( [19th April, 2009] => 'bla' ) [4] => Array ( [2nd May, 2009] => 'bla' ) ) I want to sort them out in the ascending order of the dates (based on the month, day, and year). What's the best way to do that? Originally the emails are being fetched in the MySQL date format, so its possible for me to get the array in this state: Array [ ['2008-02-28']='some text', ['2008-03-06']='some text' ] Perhaps when its in this format, I can loop through them, remove all the '-' (hyphen) marks so they are left as integars, sort them using array_sort() and loop through them yet again to sort them? Would prefer if there was another way as I'd be doing 3 loops with this per user. Thanks. Edit: I could also do this: $array[$index]=array('human'=>'28 Feb, 2009', 'db'=>'20080228', 'description'=>'Some text here'); But using this, would there be any way to sort the array based on the 'db' element alone? Edit 2: Updated initial var_dump

    Read the article

  • Django aggregation on a date range

    - by klaut
    Hi all, I have been lurking and learning in here for a while. Now i have a problem that somehow i cannot see an easy solution. In order to learn django i am bulding an app that basically keeps track of booked items. What I would like to do is to show how many days per month for a selected year one item has been booked. i have the following models: Asset(Model) BookedAsset(Model): asset = models.ForeignKey(Asset) startdate = models.DateField() enddate = models.DateField() So having the following entries: asset 1, 2010-02-11, 2010-02-13 asset 2, 2010-03-12, 2010-03-14 asset 1, 2010-04-30, 2010-05-01 I would like to get returned the following: asset 1 asset 2 ------- ------- Jan = 0 Jan = 0 Feb = 2 Feb = 0 Mar = 0 Mar = 2 Apr = 1 Apr = 0 May = 1 May = 0 Jun = 0 Jun = 0 Jul = 0 Jul = 0 Aug = 0 Aug = 0 Sep = 0 Sep = 0 Oct = 0 Oct = 0 Nov = 0 Nov = 0 Dec = 0 Dec = 0 I know i need to first get the number of days in a date range (and keep track if they fall out of the current month and into the next month) and then do an agregate on the number of days. I am just stuck on how to do it elegantly in Django. Any help (or hint in the right direction) is greatly appreciated.

    Read the article

  • Sort by date in XSL

    - by bethhilson
    I am trying to sort by date for XML output. Here is my XSL: http://www.dnncreative.com -- <!-- Test to limit number of items displayed. Here only 5 items will be transformed --> <br></br> <!-- to open links in a new window, change target="_main" to target="_blank" --> <strong><a href="{link}" target="_blank"><xsl:value-of select="title"/></a></strong> <br> <!-- <xsl:value-of select="pubDate"/> --> </br> <!-- only display 100 characters of the description, and allow html --> <xsl:value-of disable-output-escaping="yes" select="description"/> I am trying to sort descending using the entereddate in my XML: Media Director 4/2/2009 01646359 Cleveland OH United States of America $0.00 - $0.00 / $0.00/hr - $0.00/hr http://employment.topechelon.com/web77391/jobseeker/sSetup.asp?runsearch=1&spJobAdId=01646359 http://employment.topechelon.com/web77391/jobseeker/sSetup.asp?runsearch=1&spJobAdId=01646359 Any help would be appreciated! Thanks Beth Hilson

    Read the article

  • Covert uiiamge into string

    - by Warrior
    I am new iphone development.Is there any possibility to covert the uiimage into string and then once again back to image. - (void)imagePickerController:(UIImagePickerController *)picker didFinishPickingImage:(UIImage *)img1 editingInfo:(NSDictionary *)editInfo { [[picker parentViewController] dismissModalViewControllerAnimated:YES]; NSData *data = UIImagePNGRepresentation(img1); NSString *str1; str1 = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; MyAppAppDelegate *appDelegate = (MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; [appDelegate setCurrentLink:str1]; EmailPictureViewController *email = [[EmailPictureViewController alloc] initWithNibName:@"EmailPictureViewController" bundle:nil]; [self.navigationController pushViewController:email animated:YES]; } so i can use delegate methods to tranfer the image from one view to another view. so i should convert the string once again to image and display it in another view. In Another view - (void)viewDidLoad { MyAppAppDelegate *appDelegate =(MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; str1 = [appDelegate getCurrentLink]; NSLog(@"The String %@",str1); NSData *aData; aData = [str1 dataUsingEncoding: NSASCIIStringEncoding]; NSLog(@"The String Data %@",aData); NSLog(@"Inside Didload3"); [imgview setImage:[UIImage imageWithData:aData]]; } But this doesn't work for me.Where do i go wrong.Is there any way to solve it?.Please help me out.Thanks.

    Read the article

  • How to sort an XML file by date in XLST

    - by AdRock
    I am trying to sort by date and get an error message about the stylesheet can't be loaded I found an answer on how others have suggested but it doesn't work for me Here is where it is supposed to sort. The commented out line is where the sort should occur <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0"> <xsl:template name="hoo" match="/"> <html> <head> <title>Registered Festival Organisers and Festivals</title> <link rel="stylesheet" type="text/css" href="userfestival.css" /> </head> <body> <h1>Registered Festival Organisers and Festivals</h1> <xsl:for-each select="folktask/member"> <xsl:if test="user/account/userlevel='3'"> <!--<xsl:sort select="concat(substring(festival/event/datefrom,1,4),substring(festival/event/datefrom, 6,2),substring(festival/event/datefrom, 9,2))" data-type="number" order="ascending"/>--> Sample node from XML <festival id="1"> <event> <eventname>Oxford Folk Festival</eventname> <url>http://www.oxfordfolkfestival.com/</url> <datefrom>2010-04-07</datefrom> <dateto>2010-04-09</dateto> <location>Oxford</location> <eventpostcode>OX1 9BE</eventpostcode> <coords> <lat>51.735640</lat> <lng>-1.276136</lng> </coords> </event> </festival>

    Read the article

  • Serializing and deserializing a map with key as string

    - by Grace K
    Hi! I am intending to serialize and deserialize a hashmap whose key is a string. From Josh Bloch's Effective Java, I understand the following. P.222 "For example, consider the case of a harsh table. The physical representation is a sequence of hash buckets containing key-value entries. Which bucket an entry is placed in is a function of the hash code of the key, which is not, in general guaranteed to be the same from JVM implementation to JVM implementation. In fact, it isn't even guranteed to be the same from run to run on the same JVM implementation. Therefore accepting the default serialized form for a hash table would constitute a serious bug. Serializing and deserializing the hash table could yield an object whose invariants were seriously corrupt." My questions are: 1) In general, would overriding the equals and hashcode of the key class of the map resolve this issue and the map can be correctly restored? 2) If my key is a String and the String class is already overriding the hashCode() method, would I still have problem described above. (I am seeing a bug which makes me think this is probably still a problem even though the key is String with overriding hashCode.) 3)Previously, I get around this issue by serializing an array of entries (key, value) and when deserializing I would reconstruct the map. I am wondering if there is a better approach. 4) If the answers to question 1 and 2 are that I still can't be guaranteed. Could someone explain why? If the hashCodes are the same would they go to the same buckets across JVMs? Thanks, Grace

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • Setting String as Image Source in C#

    - by Dan
    UPDATE: Okay I've changed my code to this: if (appSettings.Contains("image")) { Uri uri = new Uri( (string)appSettings["image"] + ".jpg", UriKind.Absolute); ImageSource imgSource = new BitmapImage(uri); myImage.Source = imgSource; } else { Uri uriDefault = new Uri("default.jpg", UriKind.Absolute); ImageSource imgSourceDefault = new BitmapImage(uriDefault); myImage.Source = imgSourceDefault; } But now I get "Invalid URI: The format of the URI could not be determined". Well I've looked up several methods to fix this in my Windows Phone 7 app but I can't seem to find anything that works. What confuses me is that I've done something just like this before with no problem, so I'm not sure why it's not working. The code causing me the problem is this: if (appSettings.Contains("image")) { myImage.Source = (string)appSettings["image"]; } else { myImage.Source = "default.jpg"; } The error I get is this "Cannot implicitly convert type 'string' to 'System.Windows.Media.ImageSource". The reason this confuses me is because I did this Twitter app tutorial: http://weblogs.asp.net/scottgu/archive/2010/03/18/building-a-windows-phone-7-twitter-application-using-silverlight.aspx , in which you bind the image source directly to a string. So what can I do to remedy this?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Cross-platform iteration of Unicode string

    - by kizzx2
    I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

    Read the article

  • Setting Nullable Integer to String Containing Nothing yields 0

    - by Brian MacKay
    I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

    Read the article

  • Aggregating a list of dates to start and end date

    - by Joe Mako
    I have a list of dates and IDs, and I would like to roll them up into periods of consucitutive dates, within each ID. For a table with the columns "testid" and "pulldate" in a table called "data": | A79 | 2010-06-02 | | A79 | 2010-06-03 | | A79 | 2010-06-04 | | B72 | 2010-04-22 | | B72 | 2010-06-03 | | B72 | 2010-06-04 | | C94 | 2010-04-09 | | C94 | 2010-04-10 | | C94 | 2010-04-11 | | C94 | 2010-04-12 | | C94 | 2010-04-13 | | C94 | 2010-04-14 | | C94 | 2010-06-02 | | C94 | 2010-06-03 | | C94 | 2010-06-04 | I want to generate a table with the columns "testid", "group", "start_date", "end_date": | A79 | 1 | 2010-06-02 | 2010-06-04 | | B72 | 2 | 2010-04-22 | 2010-04-22 | | B72 | 3 | 2010-06-03 | 2010-06-04 | | C94 | 4 | 2010-04-09 | 2010-04-14 | | C94 | 5 | 2010-06-02 | 2010-06-04 | This is the the code I came up with: SELECT t2.testid, t2.group, MIN(t2.pulldate) AS start_date, MAX(t2.pulldate) AS end_date FROM(SELECT t1.pulldate, t1.testid, SUM(t1.check) OVER (ORDER BY t1.testid,t1.pulldate) AS group FROM(SELECT data.pulldate, data.testid, CASE WHEN data.testid=LAG(data.testid,1) OVER (ORDER BY data.testid,data.pulldate) AND data.pulldate=date (LAG(data.pulldate,1) OVER (PARTITION BY data.testid ORDER BY data.pulldate)) + integer '1' THEN 0 ELSE 1 END AS check FROM data ORDER BY data.testid, data.pulldate) AS t1) AS t2 GROUP BY t2.testid,t2.group ORDER BY t2.group; I use the use the LAG windowing function to compare each row to the previous, putting a 1 if I need to increment to start a new group, I then do a running sum of that column, and then aggregate to the combinations of "group" and "testid". Is there a better way to accomplish my goal, or does this operation have a name? I am using PostgreSQL 8.4

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • Getting the full-name of the current user, returns an empty string (C#/C++)

    - by Nir
    I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

    Read the article

  • Sort string array by analysing date details in those strings

    - by Jason Evans
    I have a requirement for the project I'm working on right now which is proving a bit tricky for me. Basically I have to sort an array of items based on the Text property of those items: Here are my items: var answers = [], answer1 = { Id: 1, Text: '3-4 weeks ago' }, answer2 = { Id: 2, Text: '1-2 weeks ago' }, answer3 = { Id: 3, Text: '7-8 weeks ago' }, answer4 = { Id: 4, Text: '5-6 weeks ago' }, answer5 = { Id: 5, Text: '1-2 days ago' }, answer6 = { Id: 6, Text: 'More than 1 month ago' }; answers.push(answer1); answers.push(answer2); answers.push(answer3); answers.push(answer4); answers.push(answer5); answers.push(answer6); I need to analyse the Text property of each item so that, after the sorting, the array looks like this: answers[0] = { Id: 6, Text: 'More than 1 month ago' } answers[1] = { Id: 3, Text: '7-8 weeks ago' } answers[2] = { Id: 4, Text: '5-6 weeks ago' } answers[3] = { Id: 1, Text: '3-4 weeks ago' } answers[4] = { Id: 2, Text: '1-2 weeks ago' } answers[5] = { Id: 5, Text: '1-2 days ago' } The logic is that, the furthest away the date, the more high priority it is, so it should appear first in the array. So "1-2 days" is less of a priority then "7-8 weeks". So the logic is that, I need to extract the number values, and then the units (e.g. days, weeks) and somehow sort the array based on those details. Quite honestly I'm finding it very difficult to come up with a solution, and I'd appreciate any help.

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >