Search Results

Search found 24734 results on 990 pages for 'floating point conversion'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 165/990 | < Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >

  • How can I set up an editor to work with Git on Windows?

    - by Patrick McElhaney
    I'm trying out Git on Windows. I got to the point of trying "git commit" and I got this error: Terminal is dumb but no VISUAL nor EDITOR defined. Please supply the message using either -m or -F option. So I figured out I need to have an environment variable called EDITOR. No problem. I set it to point to Notepad. That worked, almost. The default commit message opens in Notepad. But Notepad doesn't support bare line feeds. I went out and got Notepad++. But I can't figure out how to get Notepad++ set up as the %EDITOR% in such a way that it works with Git as expected. I'm not married to Notepad++. At this point I couldn't care less what editor I use. I just want to be able to type my commit messages without using -m. So, for those of you using Git on Windows: What (free) tool do you use to edit your commit message, and what do you get when you type echo %EDITOR% at the command prompt?

    Read the article

  • Stop playback of my voice when using mic during a call with twinkle voip

    - by ageis23
    Hi When I'm making voip calls with twinkle I can hear myself via the speakers. It's not like an echo you might get in empty room for example. While this is useful if you're trying to check if your mic is working, it's annoying when you're trying to have a conversion. Constantly trying to filter out your own voice. I'm using twinkle as my client. Is it my client or is it a setting on my ATA/ mic configuration?

    Read the article

  • timezone setting per virtual host

    - by garry
    I am trying to test functionality related to timezone handling/conversion during synchronization between two of my test servers (currently they are running on same mashine). Is it possible to set up hosts so one will be running, say, by London time, and the other by Moscow? Web applications running on both servers are written on Perl.

    Read the article

  • Removing "Transfer To..." and "Show Converted Files" from uTorrent's context menu

    - by kotekzot
    Under uTorrent version 3.1.3 (and possibly earlier), the context menu has taken on 2 new options, "Transfer To...", for moving a download to a mobile device, and "Show Converted Files", for built-in conversion. I prefer to do all my file management and conversions manually, and the options are, at best, annoying space wasters. In fact, I'm not sure these features are even available outside of uTorrent Plus, which is not something I run. Is it possible to remove them from the context menu?

    Read the article

  • A weird crash...

    - by Nima
    Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

    Read the article

  • Auto-implemented getters and setters vs. public fields

    - by tclem
    I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

    Read the article

  • Signable, streamable, "readable" archive format?

    - by alexvoda
    Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • SQL Server not liking dates in YYYY-MM-DD format

    - by greenfingers
    Is there a setting in SQL Server which will persuade it to accept 'yyyy-mm-dd' style dates in a query. Got queries which are running fine on most of our SQL servers one box running Microsoft SQL Server 2005 Developer doesn't like them. This is the error: The conversion of a char data type to a datetime data type resulted in an out-of-range datetime value. YYYYMMDD works fine

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Set Final Cut Express Sequence Options to 970p30

    - by Maccaius
    Hi I have an project in FCE which was recorded in MPEG-4 video in 1280 x 960 (1,4MB/s) and whenever I import those mov files to FCE thez show just fine. but when i add the clips to the timeline (sequence) the quality is cropped - instead of HD i can onlz export the timeline with quicktime conversion and a resolution of 720 x 480. can anybody help me out and tell me how i can export the timeline in full HD quality (as the raw material itself is)?

    Read the article

  • Powershell: Conditionally changing objects in the pipeline

    - by axk
    I'm converting a CSV to SQL inserts and there's a null-able text column which I need to quote in case it is not NULL. I would write something like the following for the conversion: Import-Csv data.csv | foreach { "INSERT INTO TABLE_NAME (COL1,COL2) VALUES ($($_.COL1),$($_.COL2));" >> inserts.sql } But I can't figure out how to add an additional tier into the pipeline to look if COL2 is not equal to 'NULL' and to quote it in such cases. How do I achieve such behavior?

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • AVI to DVD playable

    - by kefalari
    Using DVDFLick I tried to convert several AVI movies to a DVD playable disc and got nothing but error messages- toward the end of the conversion. I tried another program with the same result. What is wrong?

    Read the article

  • Does informing your destination hardware impact on ebook convertion on Calibre?

    - by Roberto
    If I connect my Kindle Fire to the computer, Calibre gives me an option to convert to Kindle Fire mobi format. Is this different from just asking to convert to mobi? I don't want to connect my Kindle anymore, I want to send to the cloud, but I'm not willing to lose conversion quality because of lack of ebook reader information. Of course, I couldn't find the convert to Kindle option without it being connected.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >