Search Results

Search found 15224 results on 609 pages for 'parallel python'.

Page 167/609 | < Previous Page | 163 164 165 166 167 168 169 170 171 172 173 174  | Next Page >

  • Proper structure for many test cases in Python with unittest

    - by mellort
    I am looking into the unittest package, and I'm not sure of the proper way to structure my test cases when writing a lot of them for the same method. Say I have a fact function which calculates the factorial of a number; would this testing file be OK? import unittest class functions_tester(unittest.TestCase): def test_fact_1(self): self.assertEqual(1, fact(1)) def test_fact_2(self): self.assertEqual(2, fact(2)) def test_fact_3(self): self.assertEqual(6, fact(3)) def test_fact_4(self): self.assertEqual(24, fact(4)) def test_fact_5(self): self.assertFalse(1==fact(5)) def test_fact_6(self): self.assertRaises(RuntimeError, fact, -1) #fact(-1) if __name__ == "__main__": unittest.main() It seems sloppy to have so many test methods for one method. I'd like to just have one testing method and put a ton of basic test cases (ie 4! ==24, 3!==6, 5!==120, and so on), but unittest doesn't let you do that. What is the best way to structure a testing file in this scenario? Thanks in advance for the help.

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Python hash() can't handle long integer?

    - by Xie
    I defined a class: class A: ''' hash test class a = A(9, 1196833379, 1, 1773396906) hash(a) -340004569 This is weird, 12544897317L expected. ''' def __init__(self, a, b, c, d): self.a = a self.b = b self.c = c self.d = d def __hash__(self): return self.a * self.b + self.c * self.d Why, in the doctest, hash() function gives a negative integer?

    Read the article

  • OpenMeetings + Python + Suds

    - by user366774
    Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor: (here :// replaced with __ 'cause spam protection) print url http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl imp = Import('http__schemas.xmlsoap.org/soap/encoding/') imp.filter.add('http__services.axis.openmeetings.org') imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd') imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd') imp.filter.add('http__services.axis.openmeetings.org') d = ImportDoctor(imp) client = Client(url, doctor = d) client.service.getSession() Traceback (most recent call last): File "", line 1, in File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call return client.invoke(args, kwargs) File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke result = self.send(msg) File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send result = self.succeeded(binding, reply.message) File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded r, p = binding.get_reply(self.method, reply) File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply resolved = rtypes[0].resolve(nobuiltin=True) File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve raise TypeNotFound(qref) suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )' what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :( need webinars at morning (2.26 am now)

    Read the article

  • supply inputs to python unittests

    - by zubin71
    I`m relatively new to the concept of unit-testing and have very little experience in the same. I have been looking at lots of articles on how to write unit-tests; however, I still have difficulty in writing tests where conditions like the following arise:- Test user Input. Test input read from a file. Test input read from an environment variable. Itd be great if someone could show me how to approach the above mentioned scenarios; itd still be awesome if you could point me to a few docs/articles/blog posts which I could read.

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Python: Unpack arbitary length bits for database storage

    - by sberry2A
    I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

  • how can i randomly print an element from a list in python

    - by lm
    So far i have this, which prints out every word in my list, but i am trying to print only one word at random. Any suggestions? def main(): # open a file wordsf = open('words.txt', 'r') word=random.choice('wordsf') words_count=0 for line in wordsf: word= line.rstrip('\n') print(word) words_count+=1 # close the file wordsf.close()

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

  • Sorting Python list based on the length of the string

    - by prosseek
    I want to sort a list of strings based on the string length. I tried to use sort as follows, but it doesn't seem to give me correct result. xs = ['dddd','a','bb','ccc'] print xs xs.sort(lambda x,y: len(x) < len(y)) print xs ['dddd', 'a', 'bb', 'ccc'] ['dddd', 'a', 'bb', 'ccc'] What might be wrong?

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • Rectangle Rotation in Python/Pygame

    - by mramazingguy
    Hey I'm trying to rotate a rectangle around its center and when I try to rotate the rectangle, it moves up and to the left at the same time. Does anyone have any ideas on how to fix this? def rotatePoint(self, angle, point, origin): sinT = sin(radians(angle)) cosT = cos(radians(angle)) return (origin[0] + (cosT * (point[0] - origin[0]) - sinT * (point[1] - origin[1])), origin[1] + (sinT * (point[0] - origin[0]) + cosT * (point[1] - origin[1]))) def rotateRect(self, degrees): center = (self.collideRect.centerx, self.collideRect.centery) self.collideRect.topleft = self.rotatePoint(degrees, self.collideRect.topleft, center) self.collideRect.topright = self.rotatePoint(degrees, self.collideRect.topright, center) self.collideRect.bottomleft = self.rotatePoint(degrees, self.collideRect.bottomleft, center) self.collideRect.bottomright = self.rotatePoint(degrees, self.collideRect.bottomright, center)

    Read the article

  • Python module being reloaded for each request with django and mod_wsgi

    - by Vishal
    I have a variable in init of a module which get loaded from the database and takes about 15 seconds. For django development server everything is working fine but looks like with apache2 and mod_wsgi the module is loaded with every request (taking 15 seconds). Any idea about this behavior? Update: I have enabled daemon mode in mod wsgi, looks like its not reloading the modules now! needs more testing and I will update.

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • Organizing a random list of objects in Python.

    - by Saebin
    So I have a list that I want to convert to a list that contains a list for each group of objects. ie ['objA.attr1', 'objC', 'objA.attr55', 'objB.attr4'] would return [['objA.attr1', 'objA.attr55'], ['objC'], ['objB.attr4']] currently this is what I use: givenList = ['a.attr1', 'b', 'a.attr55', 'c.attr4'] trgList = [] objNames = [] for val in givenList: obj = val.split('.')[0] if obj in objNames: id = objNames.index(obj) trgList[id].append(val) else: objNames.append(obj) trgList.append([val]) #print trgList It seems to run a decent speed when the original list has around 100,000 ids... but I am curious if there is a better way to do this. Order of the objects or attributes does not matter. Any ideas?

    Read the article

  • Python - Subprocess Popen and Thread error

    - by n0idea
    In both functions record and ftp, i have subprocess.Popen if __name__ == '__main__': try: t1 = threading.Thread(target = record) t1.daemon = True t1.start() t2 = threading.Thread(target = ftp) t2.daemon = True t2.start() except (KeyboardInterrupt, SystemExit): sys.exit() The error I'm receiving is: Exception in thread Thread-1 (most likely raised during interpreter shutdown): Traceback (most recent call last): File "/usr/lib/python2.7/threading.py", line 551, in __bootstrap_inner File "/usr/lib/python2.7/threading.py", line 504, in run File "./in.py", line 20, in recordaudio File "/usr/lib/python2.7/subprocess.py", line 493, in call File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ File "/usr/lib/python2.7/subprocess.py", line 1237, in _execute_child <type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'close' What might the issue be ?

    Read the article

  • python: problem with dictionary get method default value

    - by goutham
    I'm having a new problem here .. CODE 1: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name']))) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) CODE 2: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']])) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name']) code 2 fails but code 1 works the data serverInfo_D:{'user': 'usr', 'pass': 'pass'} data: {'par1': 9995, 'extraparam1': 22} val: {'par1','user','pass','extraparam1'} exception are raised for for data dict .. and all code in for loop which iterates over val

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 163 164 165 166 167 168 169 170 171 172 173 174  | Next Page >