Search Results

Search found 5581 results on 224 pages for 'alignment character'.

Page 17/224 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • Top alignment for FlowLayout

    - by mrpaint
    I'm using a FlowLayout JPanel. The panel looks ugly when it's children components height are different. I'm looking for a solution to make them top-align (similar to valign="top" with table cell in HTML). Sorry for my bad English and hope someone can come up with a brilliant idea. Thank you

    Read the article

  • many-to-many-to-many, incl alignment of data from diff sources

    - by JefeCoon
    Re-factoring dbase to support many:many:many. At the second and third levels we need to preserve end-user 'mapping' or aligning of data from different sources, e.g. Order 17 FirstpartyOrderID => aha LineItem_for_BigShinyThingy => AA-1 # maps to 77-a LineItem_for_BigShinyThingy => AA-2 # maps to 77-b, 77-c LineItem_for_LittleWidget => AA-x # maps to 77-zulu, 77-alpha, 99-foxtrot LineItem_for_LittleWidget => AA-y # maps to 77-zulu, 99-foxtrot LineItem_for_LittleWidget => AA-z # maps to 77-alpha ThirdpartyOrderID => foo LineItem_for_BigShinyThingy => 77-a LineItem_for_BigShinyThingy => 77-b LineItem_for_BigShinyThingy => 77-c LineItem_for_LittleWidget => 77-zulu LineItem_for_LittleWidget => 77-alpha ThirdpartyOrderID => bar LineItem_for_LittleWidget => 99-foxtrot Each LineItem has daily datapoints reported from its own source (Firstparty|Thirdparty). In our UI & app we provide tools to align these, then we'd like to save them into the cleanest possible schema for querying, enabling us to diff the reported daily datapoints, and perform other daily calculations (which we'll store in the dbase also, fortunately that should be cake once we've nailed this). We need to map related [firstparty|thirdparty]line_items which have their own respective datapoints. We'll be using the association to pull each line_items collection of datapoints for summary and discrepancy calculations. I'm considering two options, std has_many,through x2 --or-- possibly (scary) ubermasterjoin table OptionA: order<<-->> order_join_table[id,order_id,firstparty_order_id,thirdparty_order_id] <<-->>line_item order_join_table[firstparty_order_id]-->raw_order[id] order_join_table[thirdparty_order_id]-->raw_order[id] raw_order-->raw_line_items[raw_order_id] line_item<<-->> line_item_join[id,LI_join_id,firstparty_LI,thirdparty_LI <<-->>raw_line_items line_item_join[firstparty_LI]-->raw_line_item[id] line_item_join[thirdparty_LI]-->raw_line_item[id] raw_line_item<<-->>datapoints = we rely upon join to store all mappings of first|third orders & line_items = keys to raw_* enable lookup of these order & line_item details = concerns about circular references and/or lack of correct mapping logic, e.g order--line_item--raw_line_items vs. order--raw_order--raw_line_items OptionB: order<<-->> join_master[id,order_id,FP_order_id,TP_order_id,FP_line_item_id,TP_line_item_id] join_master[FP_order_id & TP_order_id]-->raw_order[id] join_master[FP_line_item_id & TP_line_item_id]-->raw_line_item[id] = every combo of FP_line_item + TP_line_item writes a record into the join_master table = "theoretically" queries easy/fast/flexible/sexy At long last, my questions: a) any learnings from painful firsthand experience about how best to implement/tune/optimize many-to-many-to-many relationships b) in rails? c) any painful gotchas (circular references, slow queries, spaghetti-monsters) to watch out for? d) any joy & goodness in Rails3 that makes this magically easy & joyful? e) anyone written the "how to do many-to-many-to-many schema in Rails and make it fast & sexy?" tutorial that I somehow haven't found? If not, I'll follow up with our learnings in the hope it's helpful.. Thanks in advance- --Jeff

    Read the article

  • Basic data alignment question

    - by Broken Logic
    I've been playing around to see how my computer works under the hood. What I'm interested in is seeing is what happens on the stack inside a function. To do this I've written the following toy program: #include <stdio.h> void __cdecl Test1(char a, unsigned long long b, char c) { char c1; unsigned long long b1; char a1; c1 = 'b'; b1 = 4; a1 = 'r'; printf("%d %d - %d - %d %d Total: %d\n", (long)&b1 - (long)&a1, (long)&c1 - (long)&b1, (long)&a - (long)&c1, (long)&b - (long)&a, (long)&c - (long)&b, (long)&c - (long)&a1 ); }; struct TestStruct { char a; unsigned long long b; char c; }; void __cdecl Test2(char a, unsigned long long b, char c) { TestStruct locals; locals.a = 'b'; locals.b = 4; locals.c = 'r'; printf("%d %d - %d - %d %d Total: %d\n", (long)&locals.b - (long)&locals.a, (long)&locals.c - (long)&locals.b, (long)&a - (long)&locals.c, (long)&b - (long)&a, (long)&c - (long)&b, (long)&c - (long)&locals.a ); }; int main() { Test1('f', 0, 'o'); Test2('f', 0, 'o'); return 0; } And this spits out the following: 9 19 - 13 - 4 8 Total: 53 8 8 - 24 - 4 8 Total: 52 The function args are well behaved but as the calling convention is specified, I'd expect this. But the local variables are a bit wonky. My question is, why wouldn't these be the same? The second call seems to produce a more compact and better aligned stack. Looking at the ASM is unenlightening (at least to me), as the variable addresses are still aliased there. So I guess this is really a question about the assembler itself allocates the stack to local variables. I realise that any specific answer is likely to be platform specific. I'm more interested in a general explanation unless this quirk really is platform specific. For the record though, I'm compiling with VS2010 on a 64bit Intel machine.

    Read the article

  • Content alignment for Gridviewcolumn in the listview

    - by Pankaj Upadhyay
    Please see the picture below Following is the code for this :: <Grid> <ListView Style="{StaticResource listViewStyle}" Name="transactionListView" HorizontalAlignment="Stretch" VerticalAlignment="Top" ItemsSource="{Binding}" MouseDoubleClick="transactionListView_MouseDoubleClick" IsSynchronizedWithCurrentItem="True" > <ListView.View> <GridView ColumnHeaderContainerStyle="{StaticResource gridViewHeaderColumnStyle}"> <GridView.Columns> <GridViewColumn Width="70" Header="Serial" DisplayMemberBinding="{Binding Path=Serial}" /> <GridViewColumn Width="100" Header="Date" DisplayMemberBinding="{Binding Path=Date, StringFormat={}{0:dd-MM-yyyy}}" /> <GridViewColumn Width="200" Header="Seller" DisplayMemberBinding="{Binding Path=Seller}" /> <GridViewColumn Width="200" Header="Buyer" DisplayMemberBinding="{Binding Path=Buyer}" /> <GridViewColumn Width="70" Header="Bales" DisplayMemberBinding="{Binding Path=Bales}" /> </GridView.Columns> </GridView> </ListView.View> </ListView> </Grid>

    Read the article

  • Font alignment problem in webkit based browsers

    - by Mike
    Here is the code: <style type="text/css"> html, body {font:0.9em/1.2em arial, verdana, helvetica, sans-serif;} #todayOn {background-color:#efefef; repeat-x top left;border-bottom:1px solid #ddd;border-top:1px solid #ddd;height:52px;margin:15px 0;} #todayOn #pageTitle {float:left;padding-left:3px;} #todayOn #pageTitle h2 {color:#feb425;font-size:32px;margin:10px 0 0 0;padding:0;} #todayOn #pageTitle h2 em {color:#7498c0;display:block;font-size:14px;font-style:italic;font-weight:normal;line-height:20px;padding:5px 0 0 0;} </style> <div id="todayOn"> <div id="pageTitle"> <h2>TODAY <em>on this page.com</em></h2> </div> </div> In Firefox, IE (6+), Opera, etc. the subheader "on this page.com" displays vertically how I want it to. In Webkit browsers like Chrome and Safari, it's pushed down a couple more pixels. What's the prob? Thanks.

    Read the article

  • Android: Alignment of four squares

    - by metter
    Hello There I am trying to align four equally sized squares on an Android Screen & I have now tried what feels like a million different approaches, yet none of them seem to work :(. What I've got at the moment is the following: <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/MasterLayout" android:layout_width="wrap_content" android:layout_height="fill_parent" android:background="#FFFFFF" <TableRow android:layout_weight="1" android:background="#BBBBBB" android:padding="0dip"> <TableRow android:layout_weight="1" android:padding="0dip"> This basically does the job. However, every one of those four Images has a huge padding above and under it. How do I get rid of that? Or do I need to use a different Layout type alltogether? To help illustrate my problem, here's a picture. On the left is what I got, on the right is what I need. Image Thank you very much! Cheers, Markus!

    Read the article

  • Alignment for 2nd row data

    - by user1736299
    <table> <tr><td>test</td></tr> <tr> <td> <div style= height:200px;"> <div style="border:1px solid yellow; display: inline-block; width:100px"> <img src="orderedList4.png"> </div> <div align="center" style="border:1px solid green; display: inline-block; width:650px;height:100px;"> <div>center Test Header1</div> <div>center Test Header2</div> </div> <div align="right" style="border:1px solid red;display: inline-block; width:100px">REL 1.0</div> </div> </td> </tr> </table> In the above code, the image size is 75*75 pixels. I want to have all the three cells to have a height of 100 pixels. I want the image to be centered and left aligned. The middle text to centered. Third text to centered and right aligned. I could not make it working.

    Read the article

  • Content Alignment Issue in UITableView cell

    - by OhhMee
    Please see the image attached. I don't understand why it's going outside. I've also attached code snippet for tableView. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:CellIdentifier]; // cell.accessoryType = UITableViewCellAccessoryDetailDisclosureButton; } // Configure the cell. hNode* dCell = [array objectAtIndex:[indexPath row]]; cell.textLabel.text = @"Message"; cell.detailTextLabel.text = [NSString stringWithFormat:@"%@",[dCell contents]]; cell.detailTextLabel.lineBreakMode = UILineBreakModeWordWrap; cell.detailTextLabel.numberOfLines = 0; [[cell imageView] setImage:[UIImage imageNamed:@"user.png"]]; return cell; } - (CGFloat)tableView:(UITableView *)tableView heightForRowAtIndexPath:(NSIndexPath*)indexPath { return 60; } Where could be the issue?

    Read the article

  • Another Memory Alignment Question?

    - by utxeeeee
    I understand why data need to be aligned (and all the efforts made to accomplish it like padding) so we can reduce the number of memory accesses but this assumes that processor just can fetch addresses multiples of 4(supposing we are using a 32-bit architecture). And because of that assumption we need to align memory and my question is why we can just access addresses multiple of 4(efficiency, hardware restriction, another one)? Which is the advantages of doing this? Why cannot we access all the addresses available? hugs

    Read the article

  • Centering form elements with left alignment

    - by user1766797
    I would like to center the elements in my form without moving the text or buttons from being aligned on the left. So it would look like this: The bottom square is supposed to be a button. I want it centered, but the <center> tag moves the text and button so they're centered to the input box. Here is my code: <form action="login.php" method="post"> <div class="aside"> <div id="center"> Username:<br> <input type="text" name="username"><br> Password:<br> <input type="password" name="passwor"><br> <input type="submit" class="button" name="submit" value="Login"><br><br> </div> </div> </form> and the css: #center{ width: 250px; margin-left: auto; margin-right: auto; float: center; } div.aside { margin-left: 15px; margin-top: 10px; width: 250px; background: #f5f5f5; border: 1px solid #e9e9e9; line-height: 150%; } div.aside .button{ padding:3px; width: 50px; margin-top: 3px; background-color: #00A1E6; border: 1px solid #0184BC; text-decoration:none; color: #ffffff; text-align: center; -webkit-appearance: none; }

    Read the article

  • Alignment issues with IE7-8

    - by user1868861
    I have major issues with cross browser compatibility. This picture illustrates the problem: What code do I put in for IE7-8 so that my menu aligns properly? Right now it looks right in firefox but nothing else. This the the menu code she had (there might be other code associated but I don't know, see actual site): .custom .menu { height:25px; border: 1px none; float:right; } I have tried things mentioned in other threads, overflow:hidden; / giving a width / margin: 0 auto etc. Nothing works and only ends up breaking Firefox as well.

    Read the article

  • Using JDialog with Tabbed Pane to draw different pictures [migrated]

    - by Bryam Ulloa
    I am using NetBeans, and I have a class that extends to JDialog, inside that Dialog box I have created a Tabbed Pane. The Tabbed Pane contains 6 different tabs, with 6 different panels of course. What I want to do is when I click on the different tabs, a diagram is supposed to be drawn with the paint method. My question is how can I draw on the different panels with just one paint method in another class being called from the Dialog class? Here is my code for the Dialog class: package GUI; public class NewJDialog extends javax.swing.JDialog{ /** * Creates new form NewJDialog */ public NewJDialog(java.awt.Frame parent, boolean modal) { super(parent, modal); initComponents(); } /** * This method is called from within the constructor to initialize the form. * WARNING: Do NOT modify this code. The content of this method is always * regenerated by the Form Editor. */ @SuppressWarnings("unchecked") // <editor-fold defaultstate="collapsed" desc="Generated Code"> private void initComponents() { jTabbedPane1 = new javax.swing.JTabbedPane(); jPanel1 = new javax.swing.JPanel(); jPanel2 = new javax.swing.JPanel(); jPanel3 = new javax.swing.JPanel(); jPanel4 = new javax.swing.JPanel(); jPanel5 = new javax.swing.JPanel(); jPanel6 = new javax.swing.JPanel(); jPanel7 = new javax.swing.JPanel(); jLabel1 = new javax.swing.JLabel(); jLabel2 = new javax.swing.JLabel(); setDefaultCloseOperation(javax.swing.WindowConstants.DISPOSE_ON_CLOSE); javax.swing.GroupLayout jPanel1Layout = new javax.swing.GroupLayout(jPanel1); jPanel1.setLayout(jPanel1Layout); jPanel1Layout.setHorizontalGroup( jPanel1Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel1Layout.setVerticalGroup( jPanel1Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("FCFS", jPanel1); javax.swing.GroupLayout jPanel2Layout = new javax.swing.GroupLayout(jPanel2); jPanel2.setLayout(jPanel2Layout); jPanel2Layout.setHorizontalGroup( jPanel2Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel2Layout.setVerticalGroup( jPanel2Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("SSTF", jPanel2); javax.swing.GroupLayout jPanel3Layout = new javax.swing.GroupLayout(jPanel3); jPanel3.setLayout(jPanel3Layout); jPanel3Layout.setHorizontalGroup( jPanel3Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel3Layout.setVerticalGroup( jPanel3Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("LOOK", jPanel3); javax.swing.GroupLayout jPanel4Layout = new javax.swing.GroupLayout(jPanel4); jPanel4.setLayout(jPanel4Layout); jPanel4Layout.setHorizontalGroup( jPanel4Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel4Layout.setVerticalGroup( jPanel4Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("LOOK C", jPanel4); javax.swing.GroupLayout jPanel5Layout = new javax.swing.GroupLayout(jPanel5); jPanel5.setLayout(jPanel5Layout); jPanel5Layout.setHorizontalGroup( jPanel5Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel5Layout.setVerticalGroup( jPanel5Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("SCAN", jPanel5); javax.swing.GroupLayout jPanel6Layout = new javax.swing.GroupLayout(jPanel6); jPanel6.setLayout(jPanel6Layout); jPanel6Layout.setHorizontalGroup( jPanel6Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 466, Short.MAX_VALUE) ); jPanel6Layout.setVerticalGroup( jPanel6Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 242, Short.MAX_VALUE) ); jTabbedPane1.addTab("SCAN C", jPanel6); getContentPane().add(jTabbedPane1, java.awt.BorderLayout.CENTER); jLabel1.setText("Distancia:"); jLabel2.setText("___________"); javax.swing.GroupLayout jPanel7Layout = new javax.swing.GroupLayout(jPanel7); jPanel7.setLayout(jPanel7Layout); jPanel7Layout.setHorizontalGroup( jPanel7Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGroup(jPanel7Layout.createSequentialGroup() .addGap(21, 21, 21) .addComponent(jLabel1) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(jLabel2) .addContainerGap(331, Short.MAX_VALUE)) ); jPanel7Layout.setVerticalGroup( jPanel7Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGroup(jPanel7Layout.createSequentialGroup() .addContainerGap() .addGroup(jPanel7Layout.createParallelGroup(javax.swing.GroupLayout.Alignment.BASELINE) .addComponent(jLabel1) .addComponent(jLabel2)) .addContainerGap(15, Short.MAX_VALUE)) ); getContentPane().add(jPanel7, java.awt.BorderLayout.PAGE_START); pack(); }// </editor-fold> /** * @param args the command line arguments */ public static void main(String args[]) { /* Set the Nimbus look and feel */ //<editor-fold defaultstate="collapsed" desc=" Look and feel setting code (optional) "> /* If Nimbus (introduced in Java SE 6) is not available, stay with the default look and feel. * For details see http://download.oracle.com/javase/tutorial/uiswing/lookandfeel/plaf.html */ try { for (javax.swing.UIManager.LookAndFeelInfo info : javax.swing.UIManager.getInstalledLookAndFeels()) { if ("Nimbus".equals(info.getName())) { javax.swing.UIManager.setLookAndFeel(info.getClassName()); break; } } } catch (ClassNotFoundException ex) { java.util.logging.Logger.getLogger(NewJDialog.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (InstantiationException ex) { java.util.logging.Logger.getLogger(NewJDialog.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (IllegalAccessException ex) { java.util.logging.Logger.getLogger(NewJDialog.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (javax.swing.UnsupportedLookAndFeelException ex) { java.util.logging.Logger.getLogger(NewJDialog.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } //</editor-fold> /* Create and display the dialog */ java.awt.EventQueue.invokeLater(new Runnable() { public void run() { NewJDialog dialog = new NewJDialog(new javax.swing.JFrame(), true); dialog.addWindowListener(new java.awt.event.WindowAdapter() { @Override public void windowClosing(java.awt.event.WindowEvent e) { System.exit(0); } }); dialog.setVisible(true); } }); } // Variables declaration - do not modify private javax.swing.JLabel jLabel1; private javax.swing.JLabel jLabel2; private javax.swing.JPanel jPanel1; private javax.swing.JPanel jPanel2; private javax.swing.JPanel jPanel3; private javax.swing.JPanel jPanel4; private javax.swing.JPanel jPanel5; private javax.swing.JPanel jPanel6; private javax.swing.JPanel jPanel7; private javax.swing.JTabbedPane jTabbedPane1; // End of variables declaration } This is another class that I have created for the paint method: package GUI; import java.awt.Graphics; import javax.swing.JPanel; /** * * @author TOSHIBA */ public class Lienzo { private int width = 5; private int height = 5; private int y = 5; private int x = 0; private int x1 = 0; public Graphics Draw(Graphics g, int[] pistas) { //Im not sure if this is the correct way to do it //The diagram gets drawn according to values from an array //The array is not always the same thats why I used the different Panels for (int i = 0; i < pistas.length; i++) { x = pistas[i]; x1 = pistas[i + 1]; g.drawOval(x, y, width, height); g.drawString(Integer.toString(x), x, y); g.drawLine(x, y, x1, y); } return g; } } I hope you guys understand what I am trying to do with my program.

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

  • 3D Character/Model Creator

    - by Click Ok
    I'm in a project to create a 3d game using XNA/C#, and the game will use a lot of 3d characters. Looking at the current 3d games, in some they create near to hundreds of characters, what lead me to think that there are some good 3d character/model creator. To narrow the sample, the game will have characters like the game "Grand Chase". There are some good (and easy) character model creator for to use in XNA development? Free is better, of course, but I will get payed versions too. EDIT: Another question is about the movements of the characters. The movements like walk, jump, sit, etc are "created" by the "character creator tool" or by the game?

    Read the article

  • how to use different oracle character sets in one application

    - by Peter Shower
    Hi Guys, i'm developing a 32bit Client-Application with Delphi. From this application I need to connect to databases on two different servers. First databse character set ist WE8MSWIN1252, the other server decodes with WE8PC850. Setting the client NLS_LANG parameter to the correct value solves correct sql-query results. Unfortunately this (the client character-set) seems only to be recognized on applications startup (first connect to oracle). I need to change the client-characterset at runtime. Oracle client seems to store the character set an application used to connect! beside: I#m using udl-files to setup the connections (Microsoft OLE DB - driver) what can I do?

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >