Search Results

Search found 10604 results on 425 pages for 'character break'.

Page 17/425 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • line break problem with MultiCell in FPDF

    - by user156073
    I am using java port of fpdf. I am encountering fowwlowing errors. 1).When i call multicell 2 times every time the text is printed on a new line. MultiCell(0, 1, "abcd", currentBorders, Alignment.LEFT, false); //prints on one line MultiCell(0, 1, "efg", currentBorders, Alignment.LEFT, false); //prints on next line I want that there is no line break after the call to multicell. How can i do it? 2)If i do the following thing then some part of my string gets printed on one line and some on next. MultiCell(getStringWidth(myString), 1, myStringcurrentBorders, Alignment.LEFT, false); 3)If i do the following thing then there are many blank lines after the line on which myString is printed. It works correctly if i use one 1 ans second parameter MultiCell(0, myFontSize, "123456", currentBorders, Alignment.LEFT, false); What is the problem?

    Read the article

  • C# Pragma to suppress break on thrown error

    - by Courtney de Lautour
    First off I run my applications with exceptions thrown on any error (handled or not). Second I am using a TypeConverter to convert from a user input string to the actual object. Third TypeConverter offers no TryConvert method so I'm stuck using exceptions for validation, using this rather ugly bit of code here: try { this._newValue = null; #pragma Magic_SuppressBreakErrorThrown System.Exception this._newValue = this.Converter.ConvertFromString(this._textBox.Text); #pragma Magic_ResumeBreakErrorThrown System.Exception this.HideInvalidNotification(); } catch (Exception exception) { if (exception.InnerException is FormatException) { this.ShowInvalidNotification(this._textBox.Text); } else { throw; } } I'm finding it rather distracting to have VS break execution every-time I type the - of -1, or some other invalid character. I could use something similar to this but not all the types I'm converting to have a TryParse method either. I'm hoping there may be some way to disable breaking for the section of code within the try without changing my exception settings.

    Read the article

  • rdlc - phantom page break, what to check?

    - by Antonio Nakic Alfirevic
    I have a RDLC report which has some controls on the first page, which are inside a rectangle and which display ok. Beneath the rectangle, i have a matrix, which spans more than one page both in width and in height. I want the matrix to start rendering on the second page. If I enable "insert break before" on the matrix, there is an extra blank page before the matrix(in print layout), which is my problem. If I reduce the amount of data, so the matrix does not span more than one page in width, there is no blank page, and all is well. I checked the Page and Body sizes, they are ok. Any tips? This has been driving me crazy all day, what can I check? Thx

    Read the article

  • How to break on unhandled exceptions in Silverlight

    - by Bruno Martinez
    In console .Net applications, the debugger breaks at the point of the throw (before stack unwinding) for exceptions with no matching catch block. It seems that Silverlight runs all user code inside a try catch, so the debugger never breaks. Instead, Application.UnhandledException is raised, but after catching the exception and unwinding the stack. To break when unhandled exceptions are thrown and not catched, I have to enable first chance exception breaks, which also stops the program for handled exceptions. Is there a way to remove the Silverlight try block, so that exceptions get directly to the debugger?

    Read the article

  • Line break in the mailto onclick

    - by malaki1974
    The code below works great except the email has all the text on one line like this: Height: 60 | Diagonal: 123 | Width: 107 | Total SF: 13.92 | Cost Per SF: 450 | Total Cost: $6,264.00 I would like to break after each so it looks like this: Height: 60 Diagonal: 123 Width: 107 Total SF: 13.92 Cost Per SF: 450 Total Cost: $6,264.00 I tried \n \r \n\r etc but none of them work. Any ideas? <a class="emailText" href="mailto:?subject=Screen Dimensions" onclick="this.href='mailto:?subject=Screen Dimensions&body='+'Height: '+document.forms.myform.high.value+' | '+'Diagonal: '+document.forms.myform.diagonal.value+' | '+'Width: '+document.forms.myform.wide.value+' | '+'Total SF: '+document.forms.myform.sf.value+' | '+'Cost Per SF: '+document.forms.myform.csf.value+' | '+'Total Cost: '+document.forms.myform.tc.value">Email</a>

    Read the article

  • MySQL break out group clause from subquery

    - by Anton Gildebrand
    Here is my query SELECT COALESCE(js.name,'Lead saknas'), count(j.id) FROM jobs j LEFT JOIN job_sources js ON j.job_source=js.id LEFT JOIN (SELECT * FROM quotes GROUP BY job_id) q ON j.id=q.job_id GROUP BY j.job_source The problem is that it's allowed for each job to have more than one quote. Because of that i group the quotes by job_id. Now sure, this works. But i don't like the solution with a subquery. How can i break out the group clause from the subquery to the main query? I have tried to add q.job_id to the main group clause, both before and after the existing one but don't get the same results.

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Break a string into parts, returning all characters

    - by Benjamin
    I want to break a string according to the following rules: all consecutive alpha-numeric chars, plus the dot (.) must be treated as one part all other consecutive chars must be treated as one part consecutive combinations of 1 and 2 must be treated as different parts no whitespace must be returned For example this string: Method(hierarchy.of.properties) = ? Should return this array: Array ( [0] => Method [1] => ( [2] => hierarchy.of.properties [3] => ) [4] => = [5] => ? ) I was unsuccessful with preg_split(), as AFAIK it cannot treat the pattern as an element to be returned. Any idea for a simple way to do this?

    Read the article

  • check compiler with break point

    - by KareemSaad
    When I tried to focus on compiler in code i made break point on code if (!IsPostBack) { using (SqlConnection Con = Connection.GetConnection()) { if (Request.QueryString["Category_Id"] != null && DDlProductFamily.SelectedIndex < 0) { SqlCommand Com = new SqlCommand("SelectAllCtageories_Front", Con); Com.CommandType = CommandType.StoredProcedure; Com.Parameters.Add(Parameter.NewInt("@Category_Id", Request.QueryString["Category_Id"])); SqlDataAdapter DA = new SqlDataAdapter(Com); DA.Fill(dt); DataList1.DataSource = dt; DataList1.DataBind(); } but I cannot check condition although I had the value of query string List item

    Read the article

  • How to break closures in JavaScript

    - by Not a Name
    Is there any way to break a closure easily in JavaScript? The closest I have gotten is this: var src = 3; function foo () { return function () { return src; } } function bar (func) { var src = 9; return eval('('+func.toString()+')')(); // Line breaks closure } alert(bar(foo())); Which prints 9, instead of 3 as a closure would dictate. However, this approach seems kind of ugly to me, are there any better ways?

    Read the article

  • How to break a jquery variable dynamically based on condition

    - by Adi
    I have a jquery variable which has is showing the value in the console as .. ["INCOMING", 0, "INETCALL", 0, "ISD", 31.8, "LOCAL", 197.92, "STD", 73.2] Now as per my need i have to break these values and make it like this ["INCOMING", 0],["INETCALL", 0],["ISD", 31.8],["LOCAL", 197.92],["STD", 73.2] but these values i need to make in the required formate dynamically as this is received from database. Here is my ajax call to get the values from server side.. var dbdata=""; $(document).ready(function() { $.ajax({ type: 'GET', url: 'getPieChartdata', async:false, dataType: "text", success: function(data) { dbdata=JSON.parse(data); } }); console.log(dbdata); }); Please guys help me . Thanks in advance..

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • Communication with HyperTerminal [ QT and WINApi ]

    - by javaAmator
    Hi! I write program to communicate with modem (it useing Hayes commands) and this is working. GUI is programmed with QT, but communication with COM port is write with winapi library. I have problem when I want to send with my program message from one computer to another, i can't send Polish chars (they are repleaced by '?'), how can I fix it ? Does anyone have idea ?? And I have one more problem, I can't send message from my program to Microsoft HyperTerminal, HyperTerminal receive something, but not that what I send. Thx for any help :) Important pieces of code: Connect with port: portHandle = CreateFile (portName, GENERIC_WRITE | GENERIC_READ, 0, NULL, OPEN_EXISTING, 0, NULL); GetCommState (portHandle, &dcb); switch(ui->comboBox->currentIndex()) { case 0 : dcb.BaudRate=CBR_110; break; case 1 : dcb.BaudRate=CBR_300; break; case 2 : dcb.BaudRate=CBR_600; break; case 3 : dcb.BaudRate=CBR_1200; break; case 4 : dcb.BaudRate=CBR_2400; break; case 5 : dcb.BaudRate=CBR_4800; break; case 6 : dcb.BaudRate=CBR_9600; break; case 7 : dcb.BaudRate=CBR_14400; break; case 8 : dcb.BaudRate=CBR_19200; break; case 9 : dcb.BaudRate=CBR_38400; break; case 10 : dcb.BaudRate=CBR_56000; break; case 11 : dcb.BaudRate=CBR_57600; break; case 12 : dcb.BaudRate=CBR_115200; break; case 13 : dcb.BaudRate=CBR_128000; break; case 14 : dcb.BaudRate=CBR_256000; break; } dcb.fBinary = TRUE; dcb.fParity = TRUE; dcb.fOutxCtsFlow = FALSE; dcb.fOutxDsrFlow = FALSE; dcb.fDtrControl = DTR_CONTROL_ENABLE; dcb.fDsrSensitivity = FALSE; dcb.fTXContinueOnXoff = TRUE; dcb.fOutX = FALSE; dcb.fInX = FALSE; dcb.fErrorChar = FALSE; dcb.fNull = FALSE; dcb.fRtsControl = RTS_CONTROL_ENABLE; dcb.fAbortOnError = FALSE; //dcb.ByteSize = dataBits; dcb.DCBlength = sizeof (DCB); switch(ui->comboBox_3->currentIndex()) { case 1 : dcb.Parity = EVENPARITY; break; case 3 : dcb.Parity = MARKPARITY; break; case 2 : dcb.Parity = ODDPARITY; break; case 4 : dcb.Parity = SPACEPARITY; break; case 0 : dcb.Parity = NOPARITY; break; } switch (ui->comboBox_4->currentIndex()) { case 0 : dcb.StopBits = ONESTOPBIT; break; case 1 : dcb.StopBits = ONE5STOPBITS;break; case 2 : dcb.StopBits = TWOSTOPBITS; break; } switch (ui->comboBox_2->currentIndex()) { case 0 : dcb.ByteSize = 5; break; case 1 : dcb.ByteSize = 6;break; case 2 : dcb.ByteSize= 7; break; case 3 : dcb.ByteSize = 8; break; } SetCommState (portHandle, &dcb); GetCommTimeouts (portHandle, &CommTimeouts); CommTimeouts.ReadIntervalTimeout = MAXDWORD; CommTimeouts.ReadTotalTimeoutMultiplier = 0; CommTimeouts.ReadTotalTimeoutConstant = 0; CommTimeouts.WriteTotalTimeoutMultiplier = 10; CommTimeouts.WriteTotalTimeoutConstant = 1000; SetCommTimeouts (portHandle, &CommTimeouts); Send MSG: void MainWindow::Send(char c) { do {WriteFile(portHandle, &c, 1, &cbWritten, NULL); } while (!(cbWritten)); } void MainWindow::on_pushButton_clicked() { QString str = ui->lineEdit->text(); std::string str2; ui->lineEdit->clear(); str2 = str.toStdString(); for(int i=0; i < str2.size();i++) { Send(str2[i]); //qDebug()<< str2[i]; } Send(char(13)); } Receive MSG: void ReaderThread::run() { char c; while(1) { c = Receive(); if(c==13) { emit insertPlainText("\n"); } else { emit insertPlainText(QString(c)); } } } char ReaderThread::Receive() { char c; do{ ReadFile(portHandle, &c, 1, &cbRead, NULL); } while (!(cbRead)); return c; }

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Force float left with no line break no matter what

    - by Tesserex
    I'm guessing this isn't possible, but here goes. I have two tables, and I'm trying to get them to sit side-by-side so that they look like one table. The reason for this, instead of using one larger table, is that the data in the second table needs to be handled on a column basis, not row basis, for performance reasons like caching and AJAX-fetching data. So rather than have to reload the whole table for a single column, I decided to break the column out into a separate table, but have it visually seem like a single table. I can't find a way to forcibly put the second table next to the first. I can float them, but when the first table is too wide, the second one breaks to the next line. Here's the kicker: the width of the first table is dynamic. So I can't just set a huge width to their container. Well, I could set a huge width, like 1000%, but then I have a huge ugly horizontal scroll bar. So is there any way to tell the second table "Stay on that same line, no matter what! And line up right next to the previous element please!"

    Read the article

  • Break on EXC_BAD_ACCESS in XCode?

    - by jasonh
    I'm new to iPhone development and XCode in general and have no idea how to begin troubleshooting an EXC_BAD_ACCESS signal. How can I get XCode to break at the exact line that is causing the error? I can't seem to get XCode to stop on the line causing the problem, but I do see the following lines in my debug console: Sun Oct 25 15:12:14 jasonsmacbook TestProject[1289] : CGContextSetStrokeColorWithColor: invalid context Sun Oct 25 15:12:14 jasonsmacbook TestProject[1289] : CGContextSetLineWidth: invalid context Sun Oct 25 15:12:14 jasonsmacbook TestProject[1289] : CGContextAddPath: invalid context Sun Oct 25 15:12:14 jasonsmacbook TestProject[1289] : CGContextDrawPath: invalid context 2009-10-25 15:12:14.680 LanderTest[1289:207] *** -[CFArray objectAtIndex:]: message sent to deallocated instance 0x3c4e610 Now, I am attempting to draw to the context I retrieve from UIGraphicsGetCurrentContext() and pass to the object that I want to draw with. Further trial and error debugging and I found that an NSMutableArray I have a property for on my class was a zombie. I went into the init function for the class and here's the code I was using: if ((self = [super init])) { NSMutableArray *array = [NSMutableArray array]; self.terrainBlocks = array; [array release]; } return self; } I removed the [array release] line and it no longer gives me the EXC_BAD_ACCESS signal, but I'm now confused about why this works. I thought that when I used the property, it automatically retained it for me, and thus I should release it from within init so that I don't have a leak. I'm thoroughly confused about how this works and all the guides and Stackoverflow questions I've read only confuse me more about how to set properties within my init method. There seems to be no consensus as to which way is the best.

    Read the article

  • Tinymce Line break problem on Safari and Chrome

    - by knightrider
    Hello all, Does anyone know how to fix the problem about Tinymce Line break problem on Safari and Chrome. For example, Let's say, I have two line pure text. When I copy and paste through firefox or IE. It's under one p tag. So it's same formatting i saw in the text file which is two line. But if i copy and paste through Chrome or Firefox, it becomes two p tag. So at display there,s one space between that two line. I tried to add safari plugin, but nothing happens. And if i put the plugin called paste_auto_cleanup_on_paste : true, it's removing the space, but two line text became one line. Cany anyone help me out by providing solution ? I noticed that at wordpress which is using Tinymce Editor also, doesn't occur that problem, because seems like they are using span instead of p at editor. If that's the solution, how can i change to span instead of p. Thanks for your help and greatly appreciated.

    Read the article

  • Does WPF break an Entity Framework ObjectContext?

    - by David Veeneman
    I am getting started with Entity Framework 4, and I am getting ready to write a WPF demo app to learn EF4 better. My LINQ queries return IQueryable<T>, and I know I can drop those into an ObservableCollection<T> with the following code: IQueryable<Foo> fooList = from f in Foo orderby f.Title select f; var observableFooList = new ObservableCollection<Foo>(fooList); At that point, I can set the appropriate property on my view model to the observable collection, and I will get WPF data binding between the view and the view model property. Here is my question: Do I break the ObjectContext when I move my foo list to the observable collection? Or put another way, assuming I am otherwise handling my ObjectContext properly, will EF4 properly update the model (and the database)? The reason why I ask is this: NHibernate tracks objects at the collection level. If I move an NHibernate IList<T> to an observable collection, it breaks NHibernate's change tracking mechanism. That means I have to do some very complicated object wrapping to get NHibernate to work with WPF. I am looking at EF4 as a way to dispense with all that. So, to get EF4 working with WPF, is it as simple as dropping my IQueryable<T> results into an ObservableCollection<T>. Does that preserve change-tracking on my EDM entity objects? Thanks for your help.

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >