Search Results

Search found 6326 results on 254 pages for 'continuous operation'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 17/254 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • edmx - The operation could not be completed - After adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

    Read the article

  • Asp.net Crawler Webresponse Operation Timed out.

    - by Leon
    Hi I have built a simple threadpool based web crawler within my web application. Its job is to crawl its own application space and build a Lucene index of every valid web page and their meta content. Here's the problem. When I run the crawler from a debug server instance of Visual Studio Express, and provide the starting instance as the IIS url, it works fine. However, when I do not provide the IIS instance and it takes its own url to start the crawl process(ie. crawling its own domain space), I get hit by operation timed out exception on the Webresponse statement. Could someone please guide me into what I should or should not be doing here? Here is my code for fetching the page. It is executed in the multithreaded environment. private static string GetWebText(string url) { string htmlText = ""; HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url); request.UserAgent = "My Crawler"; using (WebResponse response = request.GetResponse()) { using (Stream stream = response.GetResponseStream()) { using (StreamReader reader = new StreamReader(stream)) { htmlText = reader.ReadToEnd(); } } } return htmlText; } And the following is my stacktrace: at System.Net.HttpWebRequest.GetResponse() at CSharpCrawler.Crawler.GetWebText(String url) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 366 at CSharpCrawler.Crawler.CrawlPage(String url, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 105 at CSharpCrawler.Crawler.CrawlSiteBuildIndex(String hostUrl, String urlToBeginSearchFrom, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 89 at crawler_Default.threadedCrawlSiteBuildIndex(Object threadedCrawlerObj) in c:\myAppDev\myApp\site\crawler\Default.aspx.cs:line 108 at System.Threading.QueueUserWorkItemCallback.WaitCallback_Context(Object state) at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.RunInternal(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state, Boolean ignoreSyncCtx) at System.Threading.QueueUserWorkItemCallback.System.Threading.IThreadPoolWorkItem.ExecuteWorkItem() at System.Threading.ThreadPoolWorkQueue.Dispatch() at System.Threading._ThreadPoolWaitCallback.PerformWaitCallback() Thanks and cheers, Leon.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • edmx - The operation could not be completed - When adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas??? this is driving me crazy...

    Read the article

  • Invalid Pointer Operation, advice requested with debugging

    - by Xanyx
    I appear to have created code that is trashing memory. Having never had such problems before, i am now settign an Invalid Pointer Operation. In the following the value of the const string sFilename gets trashed after my call to PromptForXYZPropertiesSettings. // Allow the user to quickly display the properties of XYZ without needing to display the full Editor function PromptForXYZProperties(const sFilename:string; var AXYZProperties: TXYZProperties): boolean; var PropEditor: TdlgEditor; begin PropEditor:= TdlgEditor.create(nil); try PropEditor.LoadFromFile(sFilename); Other Details: Delphi 2007, Windows 7 64 bit, but can reproduce when testing EXE on XP REMOVING CONST STOPS PROBLEM FROM EXHIBITING (but presumably the problem is thus just lurking) PropEditor.PromptForXYZPropertiesSettings creates and shows a form. If I disable the ShowModal call then the memory is not trashed. Even though i have REMOVED ALL CONTROLS AND CODE from the form So I would like some advice on how to debug the issue. I was thinking perhaps watching the memory pointer where the sFilename var exists to see where it gets trashed, but not sure how i would do that (obviously needs to be done within the app so is owned memory). Thanks

    Read the article

  • question about siftdown operation on heap

    - by davit-datuashvili
    i have following pseudo code which execute siftdown operation on heap array suppose is x void siftdown(int n) pre heap(2,n) && n>=0 post heap(1,n) i=1; loop /*invariant heap(1,n) except perhaps between i and it's (0,1,or 2) children*/ c=2*i; if (c>n) break; // c is left child of i if (c+1)<=n /* c+1 is rigth child of i if (x[c+1]<x[c]) c++ /* c is lesser child of i if (x[i]<=x[c]) break; swap(c,i) i=c; i have wrote following code is it correct? public class siftdown{ public static void main(String[]args){ int c; int n=9; int a[]=new int[]{19,100,17,2,7,3,36,1,25}; int i=1; while (i<n){ c=2*i; if (c>n) break; //c is the left child of i if (c+1<=n) //c+1 ir rigth child of i if (a[c+1]<a[c]) c++; if (a[i]<=a[c]) break; int t=a[c]; a[c]=a[i]; a[i]=t; i=c; } for (int j=0;j<a.length;j++){ System.out.println(a[j]); } } } // result is 19 2 17 1 7 3 36 100 25

    Read the article

  • How can solve "Cross-thread operation not valid"?

    - by Phsika
    i try to start multi Thread but i can not it returns to me error: Cross-thread operation not valid: 'listBox1' thread was created to control outside access from another thread was. MyCodes: public DataTable dTable; public DataTable dtRowsCount; Thread t1; ThreadStart ts1; void ExcelToSql() { // SelectDataFromExcel(); ts1 = new ThreadStart(SelectDataFromExcel); t1 = new Thread(ts1); t1.Start(); } void SelectDataFromExcel() { string connectionString = @"Provider=Microsoft.ACE.OLEDB.12.0;Data Source=C:\Source\Addresses.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; OleDbConnection excelConnection = new OleDbConnection(connectionString); string[] Sheets = new string[] { "Sayfa1"}; excelConnection.Open(); // This code will open excel file. OleDbCommand dbCommand; OleDbDataAdapter dataAdapter; // progressBar1.Minimum = 1; foreach (var sheet in Sheets) { dbCommand = new OleDbCommand("select * From[" + sheet + "$]", excelConnection); //progressBar1.Maximum = CountRowsExcel(sheet).Rows.Count; // progressBar2.Value = i + 1; System.Threading.Thread.Sleep(1000); **listBox1.Items.Add("Tablo ismi: "+sheet.ToUpper()+"Satir Adeti: "+CountRowsExcel(sheet).Rows.Count.ToString()+" ");** dataAdapter = new OleDbDataAdapter(dbCommand); dTable = new DataTable(); dataAdapter.Fill(dTable); dTable.TableName = sheet.ToUpper(); dTable.Dispose(); dataAdapter.Dispose(); dbCommand.Dispose(); ArrangedDataList(dTable); FillSqlTable(dTable, dTable.TableName); } excelConnection.Close(); excelConnection.Dispose(); }

    Read the article

  • Is it possible to either abort or interrupt and later continue a lvconvert -m1 operation?

    - by SLi
    I have run the command lvconvert -m1 rootvg/newroot /dev/sdb to convert a linear logical volume to a mirrored one. The operation has not yet finished; I interrupted the command with ctrl-c at around 10% mark, but the operation seems to be running in the background anyway. Is it possible to either 1) Abort the lvconvert operation and revert to the state before it? (This would be my preferred option) 2) To safely interrupt the operation and resume it later?

    Read the article

  • Clear OS always showing "Operation too slow. Less than 1 bytes/sec"

    - by Blue Gene
    Have been trying to install clear os addon but nothing is working as i am facing this error on every mirror in the .repo file. Yum install squid http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'O*peration too slow. Less than 1 bytes/sec transfered the last 30 seconds'*) Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. Error: failure: repodata/primary.sqlite.bz2 from clearos-core: [Errno 256] No more mirrors to try. How can i fix this.i am able to access repo through web,and it seems nothing wrong with the repo.Where can be the problem. Tried yum clean all but it also didnt help. Is there a way to fix it as i am not able to install any package in it.

    Read the article

  • I keep on getting "save operation failure" after any change on my XCode Data Model

    - by Philip Schoch
    I started using Core Data for iPhone development. I started out by creating a very simple entity (called Evaluation) with just one string property (called evaluationTopic). I had following code for inserting a fresh string: - (void)insertNewObject { // Create a new instance of the entity managed by the fetched results controller. NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; NSEntityDescription *entity = [[fetchedResultsController fetchRequest] entity]; NSManagedObject *newManagedObject = [NSEntityDescription insertNewObjectForEntityForName:[entity name] inManagedObjectContext:context]; // If appropriate, configure the new managed object. [newManagedObject setValue:@"My Repeating String" forKey:@"evaluationTopic"]; // Save the context. NSError *error; if (![context save:&error]) { // Handle the error... } [self.tableView reloadData]; } This worked perfectly fine and by pushing the +button a new "My Repeating String" would be added to the table view and be in persistent store. I then pressed "Design - Add Model Version" in XCode. I added three entities to the existing entity and also added new properties to the existing "Evaluation" entity. Then, I created new files off the entities by pressing "File - New File - Managed Object Classes" and created a new .h and .m file for my four entities, including the "Evaluation" entity with Evaluation.h and Evaluation.m. Now I changed the model version by setting "Design - Data Model - Set Current Version". After having done all this, I changed my insertMethod: - (void)insertNewObject { // Create a new instance of the entity managed by the fetched results controller. NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; NSEntityDescription *entity = [[fetchedResultsController fetchRequest] entity]; Evaluation *evaluation = (Evaluation *) [NSEntityDescription insertNewObjectForEntityForName:[entity name] inManagedObjectContext:context]; // If appropriate, configure the new managed object. [evaluation setValue:@"My even new string" forKey:@"evaluationSpeechTopic"]; // Save the context. NSError *error; if (![context save:&error]) { // Handle the error... } [self.tableView reloadData]; } This does not work though! Every time I want to add a row the simulator crashes and I get the following: "NSInternalInconsistencyException', reason: 'This NSPersistentStoreCoordinator has no persistent stores. It cannot perform a save operation.'" I had this error before I knew about creating new version after changing anything on the datamodel, but why is this still coming up? Do I need to do any mapping (even though I just added entities and properties that did not exist before?). In the Apple Dev tutorial it sounds very easy but I have been struggling with this for long time, never worked after changing model version.

    Read the article

  • infix operation to postfix using stacks

    - by Chris De La O
    We are writing a program that needs to convert an infix operation (4 5/3) to postfix (4 5 3 / ) using stacks. however my convert to postfix does not work as it doesnt not output the postFix array that is supposed to store the conversion from infix notation to postfix notation. here is the code for the convertToPostix fuction. //converts infix expression to postfix expression void ArithmeticExpression::convertToPostfix(char *const inFix, char *const postFix) { //create a stack2 object named cow Stack2<char> cow; cout<<postFix; char thing = '('; //push a left parenthesis onto the stack cow.push(thing); //append a right parenthesis to the end of inFix array strcat(inFix, ")"); int i = 0;//declare an int that will control posFix position //if the stack is not empty if (!cow.isEmpty()) { //loop to run until the last character in inFix array for (int x = 0; inFix[x]!= '\0'; x++ ) { //if the inFix element is a digit if (isdigit(inFix[x])) { postFix[i]=inFix[x];//it is assigned to the next element in postFix array i++;//move on to next element in postFix } //if the inFix element is a left parenthesis else if (inFix[x]=='(') { cow.push(inFix[x]);//push it unto the stack } //if the inFix element is an operator else if (isOperator(inFix[x])) { char oper2 = inFix[x];//char variable holds inFix operator if (isOperator(cow.stackTop()))//if the top node in the stack is an operator { while (isOperator(cow.stackTop()))//and while the top node in the stack is an operator { char oper1 = cow.stackTop();//char variable holds node operator if(precedence( oper1, oper2))//if the node operator has higher presedence than node operator { postFix[i] = cow.pop();//we pop such operator and insert it in postFix array's next element cow.push(inFix[x]);//and push inFix operator unto the stack i++;//move to the next element in posFix } } } //if the top node is not an operator //we push the current inFix operator unto the top of the stack else cow.push(inFix[x]); } //if the inFix element is a right parenthesis else if (inFix[x]==')') { //we pop everything in the stack and insert it in postFix //until we arrive at a left paranthesis while (cow.stackTop()!='(') { postFix[i] = cow.pop(); i++; } //we then pop and discard left parenthesis cow.pop(); } } postFix[i]='\0'; //print !!postFix array!! (not stack) print();//code for this is just cout<<postFix; }

    Read the article

  • Dashboard for collaborative science / data processing projects

    - by rescdsk
    Hi, Continuous Integration servers like Hudson are a pretty amazing addition to software development. I work in an academic research lab, and I'd love to apply similar principles to scientific data analysis. I want a dashboard-like view of which collections of data are fine, which ones are failing their tests (simple shell scripts, mostly), and so on. A lot like the Chromium dashboard (WARNING: page takes a long time to load). It takes work from at least 4 people, and maybe 10 or 12 hours of computer time, to bring our data (from behavioral studies) from its raw form to its final, easily-analyzed form. I've tried Hudson and buildbot, but neither is really appropriate to our workflow. We just want to run a bunch of tests on maybe fifty independent collections of subject data, and display the results nicely. SO! Does anyone have a recommendation of a way to generate this kind of report easily? Or, can you think of a good way to shoehorn this kind of workflow into a continuous integration server? Or, can you recommend a unit testing dashboard that could deal with tests that are little shell scripts rather than little functions? Thank you!

    Read the article

  • Create a model that switches between two different states using Temporal Logic?

    - by NLed
    Im trying to design a model that can manage different requests for different water sources. Platform : MAC OSX, using latest Python with TuLip module installed. For example, Definitions : Two water sources : w1 and w2 3 different requests : r1,r2,and r3 - Specifications : Water 1 (w1) is preferred, but w2 will be used if w1 unavailable. Water 2 is only used if w1 is depleted. r1 has the maximum priority. If all entities request simultaneously, r1's supply must not fall below 50%. - The water sources are not discrete but rather continuous, this will increase the difficulty of creating the model. I can do a crude discretization for the water levels but I prefer finding a model for the continuous state first. So how do I start doing that ? Some of my thoughts : Create a matrix W where w1,w2 ? W Create a matrix R where r1,r2,r3 ? R or leave all variables singular without putting them in a matrix I'm not an expert in coding so that's why I need help. Not sure what is the best way to start tackling this problem. I am only interested in the model, or a code sample of how can this be put together. edit Now imagine I do a crude discretization of the water sources to have w1=[0...4] and w2=[0...4] for 0, 25, 50, 75,100 percent respectively. == means implies Usage of water sources : if w1[0]==w2[4] -- meaning if water source 1 has 0%, then use 100% of water source 2 etc if w1[1]==w2[3] if w1[2]==w2[2] if w1[3]==w2[1] if w1[4]==w2[0] r1=r2=r3=[0,1] -- 0 means request OFF and 1 means request ON Now what model can be designed that will give each request 100% water depending on the values of w1 and w2 (w1 and w2 values are uncontrollable so cannot define specific value, but 0...4 is used for simplicity )

    Read the article

  • manuplating matrix operation(transpose, negation, addition, and mutipication) using functions in c

    - by user292489
    i was trying to manuplate matrices in my input file using functions. my input file is, A 3 3 1 2 3 4 5 6 7 8 9 B 3 3 1 0 0 0 1 0 0 0 1 C 2 3 3 5 8 -1 -2 -3 D 3 5 0 0 0 1 0 1 0 1 0 1 0 1 0 0 1 E 1 1 10 F 3 10 1 0 2 0 3 0 4 0 5 0 0 2 3 -1 -3 -4 -3 8 3 7 0 0 0 4 6 5 8 2 -1 10 i am having trouble in impementing the funcitons that i declared. i assumed my program will perform those operations: transpose, negate, add, and mutiply matices according to the users choise: /* once this program is compliled and excuted, it will perform the basic matrix operations: negation, transpose,a\ ddition, and multiplication. */ #include <stdio.h> #include <stdlib.h> #define MAX 10 int readmatrix(FILE *input, char martixname[6],int , mat[10][10], int i, int j); void printmatrix(char matrixname[6], int mat[10][10], int i, int j); void Negate(char matrixname[6], int mat[10][10], int i, int j); void add(char matrixname[6], int mat[10][10],int i, int k); void multiply(char matrixname[], int mat[][10], char A[], int i, int k); void transpose (char matrixname[], int mat[][10], char A[], int); void printT(int mat[][10], int); int selctoption(); char selectmatrix(); int main(int argc, char *argv[]) { char matrixtype[6]; int mat[][10]; FILE *filein; int size; int optionop; int matrixop; int option; if (argc != 2) { printf("Usage: excutable input.\n"); exit (0); } filein = fopen(argv[1], "r"); if (!filein) { printf("ERROR: input file not found.\n"); exit (0); } size = readmatrix (filein, matrixtype); printmatrix(matrix[][10], size); option = selectoption(); matrixtype = selectmatrix(); //printf("You have: %5.2f ", deposit); optionop = readmatrix(option, matrix[][10], size); if (choiceop == 6) { printf("Thanks for using the matrix operation program.\n"); exit(0); } printf("Please select from the following matrix operations:\n") printf("\t1. Print matrix\n"); printf("\t2. Negate matrix\n"); printf("\t3. Transpose matrix\n"); printf("\t4. Add matrices\n"); printf("\t5. Multiply matrices\n"); printf("\t6. Quit\n"); fclose(filein); return 0; } do { printf("Please select option(1-%d):", optionop); scanf("%d", &matrixop); }while(matrixop <= 0 || matrixop > optionop); void readmatrix (FILE *in, int mat[][10], char A[], int i, int j) { int i=0,j = 0; while (fscanf(in, "%d", &mat[i][j]) != EOF) return 0; } // i would apprtaite anyones feedback. //thank you!

    Read the article

  • INSERT INTO in MS Access 2010 SOMETIMES GETS ERROR: 3073 Operation must use an updateable query

    - by Gary
    I get the ERROR: 3073 Operation must use an updateable query SOMETIMES, while performing an INSERT statment. I have no problem on my windows 7 PC, but the person I am writing this for sometimes gets the error. She also has MS Access 2010 on Windows 7. As I said I have never got it on my PC, and she only gets it sometimes. The code will insert a number of rows and then through the error, and other times not through the erro at all. The error occurs if I have the code and data in one .mdb file or seperate files. Here a snippet of code: OrderHdrInsertStmnt = " INSERT INTO ORDER_HDR " _ & "(ORDER_ID, SOURCE_CODE, ORDER_DATE, SHIP_FNAME, SHIP_LNAME, SHIP_EMAIL, SHIP_COMP, SHIP_PHONE, SHIP_ADDR, SHIP_CITY, SHIP_STATE, SHIP_ZIP, SHIP_CNTRY, " _ & " BILL_FNAME, BILL_LNAME, BILL_EMAIL, BILL_COMP, BILL_PHONE, BILL_ADDR, BILL_CITY, BILL_STATE, BILL_ZIP, BILL_CNTRY, " _ & " TAX, SHIPPING, TOTAL, MOD_DATE, INSERT_DATE) " _ & " VALUES (" _ & "'" & OrderId & "','" & SourceCode & "','" & Orderdate & "','" & ShipFName & "','" & ShipLName & "','" & ShipEmail & "','" & ShipComp & "','" & ShipPhone & "','" & ShipAddr & "','" & ShipCity & "','" & ShipState & "','" & ShipZip & "','" & ShipCntry _ & "','" & BillFName & "','" & BillLName & "','" & BillEmail & "','" & BillComp & "','" & BillPhone & "','" & BillAddr & "','" & BillCity & "','" & BillState & "','" & BillZip & "','" & BillCntry _ & "','" & OrderTax & "','" & OrderShipping & "','" & OrderTotal & "','" & ImportDate & "','" & ImportDate & "');" then I use dbsCurrent.Execute OrderHdrInsertStmnt, dbFailOnError Any assistance would be great!

    Read the article

  • Strange performance behaviour for 64 bit modulo operation

    - by codymanix
    The last three of these method calls take approx. double the time than the first four. The only difference is that their arguments doesn't fit in integer anymore. But should this matter? The parameter is declared to be long, so it should use long for calculation anyway. Does the modulo operation use another algorithm for numbersmaxint? I am using amd athlon64 3200+, winxp sp3 and vs2008. Stopwatch sw = new Stopwatch(); TestLong(sw, int.MaxValue - 3l); TestLong(sw, int.MaxValue - 2l); TestLong(sw, int.MaxValue - 1l); TestLong(sw, int.MaxValue); TestLong(sw, int.MaxValue + 1l); TestLong(sw, int.MaxValue + 2l); TestLong(sw, int.MaxValue + 3l); Console.ReadLine(); static void TestLong(Stopwatch sw, long num) { long n = 0; sw.Reset(); sw.Start(); for (long i = 3; i < 20000000; i++) { n += num % i; } sw.Stop(); Console.WriteLine(sw.Elapsed); } EDIT: I now tried the same with C and the issue does not occur here, all modulo operations take the same time, in release and in debug mode with and without optimizations turned on: #include "stdafx.h" #include "time.h" #include "limits.h" static void TestLong(long long num) { long long n = 0; clock_t t = clock(); for (long long i = 3; i < 20000000LL*100; i++) { n += num % i; } printf("%d - %lld\n", clock()-t, n); } int main() { printf("%i %i %i %i\n\n", sizeof (int), sizeof(long), sizeof(long long), sizeof(void*)); TestLong(3); TestLong(10); TestLong(131); TestLong(INT_MAX - 1L); TestLong(UINT_MAX +1LL); TestLong(INT_MAX + 1LL); TestLong(LLONG_MAX-1LL); getchar(); return 0; } EDIT2: Thanks for the great suggestions. I found that both .net and c (in debug as well as in release mode) does't not use atomically cpu instructions to calculate the remainder but they call a function that does. In the c program I could get the name of it which is "_allrem". It also displayed full source comments for this file so I found the information that this algorithm special cases the 32bit divisors instead of dividends which was the case in the .net application. I also found out that the performance of the c program really is only affected by the value of the divisor but not the dividend. Another test showed that the performance of the remainder function in the .net program depends on both the dividend and divisor. BTW: Even simple additions of long long values are calculated by a consecutive add and adc instructions. So even if my processor calls itself 64bit, it really isn't :( EDIT3: I now ran the c app on a windows 7 x64 edition, compiled with visual studio 2010. The funny thing is, the performance behavior stays the same, although now (I checked the assembly source) true 64 bit instructions are used.

    Read the article

  • OpenCV multiply scalar and a Matrix

    - by jarjarbinks
    Hi, I am trying to find the easiest way to add, subtract a scalar value with a opencv 2.0 cv::Mat class. Most of the existing function allows only matrix-matrix and matrix-scalar operations. I am looking for a scalar-matrix operations. I am doing it currently by creating a temporary matrix with the same scalar value and doing required arithmetic operation. Example below.. Mat M(Size(100,100), CV_8U); Mat temp = Mat::ones(100, 100, CV_8U)*255; M = temp-M; But I think there should be better/easier ways to do it. Any suggestions ?

    Read the article

  • Can I cancel a resize operation in GParted without causing data loss?

    - by Anderson Green
    I'm currently waiting for GParted to finish resizing a partition, but the progress bar is currently at 0, and it's been taking much longer than usual (perhaps an hour). Is it safe to cancel the resize operation? I don't want to wait days for the resize operation to complete, but I don't want to lose all of my files either. (Is there any way that I can simply pause the resize operation, attempt to recover files, and then resume the resize operation?) (An update: the operation has finally completed, and my files are still intact!)

    Read the article

  • Continous integration with Reporting Services

    - by SDReyes
    I'm implementing a continuous integration environment with SVN and reporting services. The reports are stored in the SVN repository. when a change occurs, they are automatically downloaded from the repository, and any file changed should be uploaded to the reporting services server. How could you automate the upload/update process for .rdl files?

    Read the article

  • How do I configure an extreme feedback device to notify CI build status?

    - by Gishu
    Trying to save the next guy/gal some trouble in finding out what is needed to setup lava lamps or traffic lights or what have you (the term I believe is eXtreme Feedback Devices) as a BIG VISIBLE INDICATOR of your continuous integration build status. Ensure your post includes... (and please don't mess this question up with imaginative responses.. although it may be insanely funny at the point of conception) the XFD what 'helper' hardware is needed software that you managed to hook it up with detailed instructions on how to set it up

    Read the article

  • Grouping SQL results by continous time intervals (oracle sql)

    - by Kamil Zadora
    Hi I have following data in the table: ID-----startDate----endDate 5549 2008-05-01 4712-12-31 5567 2008-04-17 2008-04-30 1 5567 2008-05-01 2008-07-31 1 5567 2008-09-01 4712-12-31 2 5569 2008-05-01 2008-08-31 5569 2008-09-01 4712-12-31 5589 2008-04-18 2008-04-30 5589 2008-05-01 4712-12-31 5667 2008-05-01 4712-12-31 5828 2008-06-03 4712-12-31 5867 2008-06-03 4712-12-31 6167 2008-11-01 4712-12-31 6207 2008-07-01 4712-12-31 6228 2008-07-01 4712-12-31 6267 2008-07-14 4712-12-31 I am looking for I way to group the continuous time intervals for each id to return: ID, min(startDate), max(endDate), to have something like this in result for the bolded ID 5567 5567 2008-04-17 2008-07-31 5567 2008-09-01 4712-12-31 PL/SQL is also an option here :) Thanks,

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >