Search Results

Search found 5859 results on 235 pages for 'escape character'.

Page 17/235 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • Java regex, need help with escape characters

    - by Blankman
    My HTML looks like: <td class="price" valign="top"><font color= "blue">&nbsp;&nbsp;$&nbsp; 5.93&nbsp;</font></td> I tried: String result = ""; Pattern p = Pattern.compile("\"blue\">&nbsp;&nbsp;$&nbsp;(.*)&nbsp;</font></td>"); Matcher m = p.matcher(text); if(m.find()) result = m.group(1).trim(); Doesn't seem to be matching. Am I missing an escape character?

    Read the article

  • do we need to escape the character '<'

    - by Ozkan
    In C# ASP.NET, if we have the characters < or in a string. Do we need to escape it like: string a = "\<test\>abcdef\</test\>" because this string will be send to an external method via webservices. And in that method, it will be converted to a some kind of xml file. contentHtml = "<?xml version=\"1.0\" encoding=\"utf-16\"?>" + contentHtml; content_ws.AddContent(contentHtml); //AddContent() method is a external method (via webservices) Thx for help

    Read the article

  • How do you escape parentheses in a Binding indexer

    - by Chris S
    I have the following XAML: <Grid x:Name="LayoutRoot" Background="White" DataContext="{Binding Source={StaticResource MyDataKey}}"> <TextBox Name="_myId" Text="{Binding MyDictionary[(Textbox.Name)]" /> </Grid> But it thinks the key in my dictionary is called "(Textbox.Name)", instead of "_myId". The format below works, where I have a property in my class called "_myId": <TextBox Name="_myId" Text="{Binding (Textbox.Name)" /> I've tried using ^ and \ to escape the brackets. Is this syntax supported? I'm trying to avoid duplication of the name in two attributes.

    Read the article

  • how to tell bulider to not to escape values

    - by dorelal
    ruby-1.8.7-p249 > xml = Builder::XmlMarkup.new => <inspect/> ruby-1.8.7-p249 > xml.foo '<b>wow</b>' => "<inspect/><foo>&lt;b&gt;wow&lt;/b&gt;</foo>" ruby-1.8.7-p249 > Builder is escaping the content and is converting the b tag into escaped value . How do I tell builder to no to escape it. I am using ruby 1.8.7 .

    Read the article

  • Scite Lua - escaping right bracket in regex?

    - by ~sd-imi
    Hi all, Bumped into a somewhat weird problem... I want to turn the string: a\left(b_{d}\right) into a \left( b_{d} \right) in Scite using a Lua script. So, I made the following Lua script for Scite: function SpaceTexEquations() editor:BeginUndoAction() local sel = editor:GetSelText() local cln3 = string.gsub(sel, "\\left(", " \\left( ") local cln4 = string.gsub(cln3, "\\right)", " \\right) ") editor:ReplaceSel(cln4) editor:EndUndoAction() end The cln3 line works fine, however, cln4 crashes with: /home/user/sciteLuaFunctions.lua:49: invalid pattern capture >Lua: error occurred while processing command I think this is because bracket characters () are reserved characters in Lua; but then, how come the cln3 line works without escaping? By the way I also tried: -- using backslash \ as escape char: local cln4 = string.gsub(cln3, "\\right\)", " \\right) ") -- crashes all the same -- using percentage sign % as escape chare local cln4 = string.gsub(cln3, "\\right%)", " \\right) ") -- does not crash, but does not match either Could anyone tell me what would be the correct way to do this? Thanks, Cheers!

    Read the article

  • Mount CIFS Credentials File has Special Character

    - by David George
    I'm having trouble mounting a share on my XenServer (5.6 FP1). From the command line I try: mount.cifs //server/share /mnt/share -o credentials=credfile The contents of credfile is: username=Administrator password=What@zR\!p3s When I run the above mount command I get "Access Denied". However if I run the following command it works: mount.cifs //server/share /mnt/share -o username=Administrator,password=What@zR\!p3s Please note the "\" is to escape the bang and I've tried this with and without it in the credentials file. Any suggestions?

    Read the article

  • Best way to escape characters before jquery post ASP.NET MVC

    - by Darcy
    Hello, I am semi-new to ASP.NET MVC. I am building an app that is used internally for my company. The scenario is this: There are two Html.Listbox's. One has all database information, and the other is initally empty. The user would add items from the database listbox to the empty listbox. Every time the user adds a command, I call a js function that calls an ActionResult "AddCommand" in my EditController. In the controller, the selected items that are added are saved to another database table. Here is the code (this gets called every time an item is added): function Add(listbox) { ... //skipping initializing code for berevity var url = "/Edit/AddCommand/" + cmd; $.post(url); } So the problem occurs when the 'cmd' is an item that has a '/', ':', '%', '?', etc (some kind of special character) So what I'm wondering is, what's the best way to escape these characters? Right now I'm checking the database's listbox item's text, and rebuilding the string, then in the Controller, I'm taking that built string and turning it back into its original state. So for example, if the item they are adding is 'Cats/Dogs', I am posting 'Cats[SLASH]Dogs' to the controller, and in the controller changing it back to 'Cats/Dogs'. Obviously this is a horrible hack, so I must be missing something. Any help would be greatly appreciated.

    Read the article

  • Regex Pattern for ignoring a custom escape character

    - by user1517464
    I am trying to find a suitable regex for matching pair of custom characters in an input string. These custom characters are replaced by their corresponding html tags. For e.g. The input string can have underscores in pairs to indicate words in bold. Hence, _Name_ outputs as <b>Name</b> However if there is a genuine underscore in the string, it cannot be replaced by "bold" tags and has to be ignored. The genuine underscore has to be preceded by / (I couldn't find a better character, it could be one more underscore or hyphen or whatever). Any single or paired occurrance of this genuine underscore has to be ignored by regex. So far I could come up with this regex: var pattern = @"(?!/)_(.*?)(?!/)_"; But it fails in below input string: _Tom_Katy/_Richard/_/_Stephan_and many users It outputs as <b>Tom</b>Katy/<b>Richard/_/</b>Stephan_and many users Many Thanks in Advance, Pr

    Read the article

  • asp.net mvc outputting json with backslashes ( escape) despite many attemps to filter

    - by minus4
    i have an asp.net controller that output Json as the results a section of it is here returnString += string.Format(@"{{""filename"":""{0}"",""line"":[", file.Filename); what i get returned is this: "{\"DPI\":\"66.8213457076566\",\"width\":\"563.341067\",\"editable\":\"True\",\"pricecat\":\"6\",\"numpages\":\"2\",\"height\":\"400\",\"page\":[{\"filename\":\"999_9_1.jpg\",\"line\":[]},{\"filename\":\"999_9_2.jpg\",\"line\":[]}]]" i have tried to return with the following methods: return Json(returnString); return Json(returnString.Replace("\\",""); return Json will serialize my string to a jSon string, this i know but it likes to escape for some reason, how can i get rid of it ???? for info this is how i call it with jQuery: $.ajax({ url:"/Products/LoadArtworkToJSon", type:"POST", dataType: "json", async: false, data:{prodid: prodid }, success: function(data){ sessvars.myData = data; measurements = sessvars.myData; $("#loading").remove(); //empty the canvas and create a new one with correct data, always start on page 0; $("#movements").remove(); $("#canvas").append("<div id=\"movements\" style=\"width:" + measurements.width + "px; height:" + Math.round(measurements.height) + "px; display:block; border:1px solid black; background:url(/Content/products/" + measurements.page[0].filename + ") no-repeat;\"></div>"); your help is much appreciated thanks

    Read the article

  • Escape whitespace in paths using nautilus script

    - by Tommy Brunn
    I didn't think this would be as tricky as it turned out to be, but here I am. I'm trying to write a Nautilus script in Python to upload one or more images to Imgur just by selecting and right clicking them. It works well enough with both single images and multiple images - as long as they don't contain any whitespace. In fact, you can upload a single image containing whitespace, just not multiple ones. The problem is that NAUTILUS_SCRIPT_SELECTED_FILE_PATHS returns all the selected files and directories as a space separated string. So for example, it could look like this: print os.environment['NAUTILUS_SCRIPT_SELECTED_FILE_PATHS'] /home/nevon/Desktop/test image.png /home/nevon/Desktop/test.jpg What I need is a way to -either in bash or Python- escape the spaces in the path - but not the spaces that delimit different items. Either that, or a way to put quotation marks around each item. The ultimate solution would be if I could do that in bash and then send the items as separate arguments to my python script. Something like: python uploader.py /home/nevon/Desktop/test\ image.png /home/nevon/Desktop/test.jpg I've tried RTFM'ing, but there doesn't seem to be a lot of good solutions for this. At least not that I've found. Any ideas?

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Escape characters in MySQL, in Ruby

    - by Swards
    I have a couple escaped characters in user-entered fields that I can't figure out. I know they are the "smart" single and double quotes, but I don't know how to search for them in mysql. The characters in ruby, when output from Ruby look like \222, \223, \224 etc irb> "\222".length => 1 So - do you know how to search for these in mysql? When I look in mysql, they look like '?'. I'd like to find all records that have this character in the text field. I tried mysql> select id from table where field LIKE '%\222%' but that did not work. Some more information - after doing a mysqldump, this is how one of the characters is represented - '\\xE2\\x80\\x99'. It's the smart single quote. Ultimately, I'm building an RTF file and the characters are coming out completely wrong, so I'm trying to replace them with 'dumb' quotes for now. I was able to do a gsub(/\222\, "'"). Thanks.

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

  • 3D Character/Model Creator

    - by Click Ok
    I'm in a project to create a 3d game using XNA/C#, and the game will use a lot of 3d characters. Looking at the current 3d games, in some they create near to hundreds of characters, what lead me to think that there are some good 3d character/model creator. To narrow the sample, the game will have characters like the game "Grand Chase". There are some good (and easy) character model creator for to use in XNA development? Free is better, of course, but I will get payed versions too. EDIT: Another question is about the movements of the characters. The movements like walk, jump, sit, etc are "created" by the "character creator tool" or by the game?

    Read the article

  • how to use different oracle character sets in one application

    - by Peter Shower
    Hi Guys, i'm developing a 32bit Client-Application with Delphi. From this application I need to connect to databases on two different servers. First databse character set ist WE8MSWIN1252, the other server decodes with WE8PC850. Setting the client NLS_LANG parameter to the correct value solves correct sql-query results. Unfortunately this (the client character-set) seems only to be recognized on applications startup (first connect to oracle). I need to change the client-characterset at runtime. Oracle client seems to store the character set an application used to connect! beside: I#m using udl-files to setup the connections (Microsoft OLE DB - driver) what can I do?

    Read the article

  • Perl TDS character sets

    - by skiphoppy
    I'm using the FreeTDS driver with DBD::Sybase, connecting to an MS SQL Server. When I query certain values of certain records, I get this error: DBD::Sybase::st fetchrow_arrayref failed: OpenClient message: LAYER = (0) ORIGIN = (0) SEVERITY = (9) NUMBER = (99) Server , database Message String: WARNING! Some character(s) could not be converted into client's character set. Unconverted bytes were changed to question marks ('?'). This seems to happen for records that contain special Windows character-set characters, such as curly quotes, copied and pasted from people's Outlook and Word messages. Unfortunately, I do not have any control of this database; sanitizing the input on the way in is obviously the way to go, but is not available to me. What FreeTDS settings do I need to change to be able to successfully query these records?

    Read the article

  • smarter character replacement using ruby gsub and regexp

    - by agriciuc
    Hi guys! I'm trying to create permalink like behavior for some article titles and i don't want to add a new db field for permalink. So i decided to write a helper that will convert my article title from: "O "focoasa" a pornit cruciada, împotriva barbatilor zgârciti" to "o-focoasa-a-pornit-cruciada-impotriva-barbatilor-zgarciti". While i figured out how to replace spaces with hyphens and remove other special characters (other than -) using: title.gsub(/\s/, "-").gsub(/[^\w-]/, '').downcase I am wondering if there is any other way to replace a character with a specific other character from only one .gsub method call, so I won't have to chain title.gsub("a", "a") methods for all the UTF-8 special characters of my localization. I was thinking of building a hash with all the special characters and their counterparts but I haven't figured out yet how to use variables with regexps. What I was looking for is something like: title.gsub(/\s/, "-").gsub(*replace character goes here*).gsub(/[^\w-]/, '').downcase Thanks!

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >