Search Results

Search found 4647 results on 186 pages for 'localizable strings'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 17/186 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • preg_match and long strings

    - by aleluja
    Hi, This is the preg_match i am trying to use to find specific text in text file. if (preg_match($regexp,$textFile,$result) > 0) { echo "Found ".$result[0]; } else { echo "Not found"; } However, the result is always Found and nothing more. The result array is empty. Now i read that preg_match can't work with long strings. My text file is about 300KB so thats 300000 characters i guess. I am 100% sure that the searched string is in the text file, and the fact that preg_match function returns value above 0 means it found it, but it didn't place it into the result array somehow. So my question would be, how do i make it work? regexp would be /[specific text]\{(\d*)\}/ so, of course i want to be able to get the number in the parentheses.

    Read the article

  • Replacing backslashes in Python strings

    - by user323659
    I have some code to encrypt some strings in Python. Encrypted text is used as a parameter in some urls, but after encrypting, there comes backslashes in string and I cannot use single backslash in urllib2.urlopen. I cannot replace single backslash with double. For example: print cipherText '\t3-@\xab7+\xc7\x93H\xdc\xd1\x13G\xe1\xfb' print cipherText.replace('\\','\\\\') '\t3-@\xab7+\xc7\x93H\xdc\xd1\x13G\xe1\xfb' Also putting r in front of \ in replace statement did not worked. All I want to do is calling that kind of url: http://awebsite.me/main?param="\t3-@\xab7+\xc7\x93H\xdc\xd1\x13G\xe1\xfb" And also this url can be successfully called: http://awebsite.me/main?param="\\t3-@\\xab7+\\xc7\\x93H\\xdc\\xd1\\x13G\\xe1\\xfb" Any idea will be appreciated.

    Read the article

  • Operations inside Rails I18n locales' strings

    - by Cristobal Viedma
    Hi, I am trying to put operations inside the locales to adapt to different languages. For example, in English a billion is 1,000,000,000, however in Spanish a billion is 1,000,000,000,000 so I would like to be able to have the following: en: billion: "You have %{money} billions" es: billion: "Tienes %{money/1000.0} billones" In order to be able to write: I18n.t :billion, :money => whatever And be right for whatever language. However, it seems that I cannot put operations inside the locales' strings. Any hint on how should I be doing this? Maybe my approach is just wrong "philosophically" talking? Thanks all!

    Read the article

  • Concatenating Strings in Obj C

    - by eco_bach
    Hi It seems that Objective C jumps thru hoops to make seemingly simple tasks extremely difficult. I simply need to create a sequence of strings, image1.jpg, image2.jpg, etc etc ie in a loop var imgString:String='image'+i+'.jpg; I assume a best practice is to use a NSMutableString with appendString method? What am I doing wrong?? NSMutableString *imgString; for(int i=1;i<=NUMIMAGES;i++){ imgString.appendString(@"image"+i+@".jpg"); } I get the following error error: request for member 'appendString' in something not a structure or union

    Read the article

  • What's a good, threadsafe, way to pass error strings back from a C shared library

    - by PerilousApricot
    Hello, all- I'm writing a C shared library for internal use (I'll be dlopen()'ing it to a c++ application, if that matters). The shared library loads (amongst other things) some java code through a JNI module, which means all manners of nightmare error modes can come out of the JVM that I need to handle intelligently in the application. Additionally, this library needs to be re-entrant. Is there in idiom for passing error strings back in this case, or am I stuck mapping errors to integers and using printfs to debug things? Thanks!

    Read the article

  • Writing Strings to files in python

    - by Leif Andersen
    I'm getting the following error when trying to write a string to a file in pythion: Traceback (most recent call last): File "export_off.py", line 264, in execute save_off(self.properties.path, context) File "export_off.py", line 244, in save_off primary.write(file) File "export_off.py", line 181, in write variable.write(file) File "export_off.py", line 118, in write file.write(self.value) TypeError: must be bytes or buffer, not str I basically have a string class, which contains a string: class _off_str(object): __slots__ = 'value' def __init__(self, val=""): self.value=val def get_size(self): return SZ_SHORT def write(self,file): file.write(self.value) def __str__(self): return str(self.value) Furthermore, I'm calling that class like this: def write(self, file): for variable in self.variables: variable.write(file) I have no idea what is going on. I've seen other python programs writing strings to files, so why can't this one? Thank you very much for your help.

    Read the article

  • Object for storing strings geted from prints

    - by evg
    class MyWriter: def __init__(self, stdout): self.stdout = stdout self.dumps = [] def write(self, text): self.stdout.write(smart_unicode(text).encode('cp1251')) self.dumps.append(text) def close(self): self.stdout.close() writer = MyWriter(sys.stdout) save = sys.stdout sys.stdout = writer I use self.dumps list to store geted data from prints. Is it exists more convinient object for storing string lines in memory? ideally i want dump it to one big string. I can get it like this "\n".join(self.dumps) from code above. Mb it's better to just concat strings - self.dumps += text ?

    Read the article

  • Strings, regexp and files

    - by A Moose
    <?php $iprange = array( "^12\.34\.", "^12\.35\.", ); foreach($iprange as $var) { if (preg_match($var, $_SERVER['REMOTE_ADDR'])) { I'm looking to have a list that will constitute each of the values inside the array. Let's call it iprange.txt, from which I would extract the variable $iprange. I would also be updating the file with new ranges, but I also want to convert those strings to regexp if that's something that's needed in php, as it is in the above example. If you could help me with the two following issues: I understand that somehow I would be using an array include, but I'm not sure how to implement it. I would like to run a cron that would update the text file and turn it into a regexp acceptable for use in the above example, if you think regexp is a good idea and there isn't another option. I know how to apply a cron in a directadmin gui, but I don't know what the cronned file would look like.

    Read the article

  • Dynamical array of strings in C

    - by Ir0nm
    I'm trying to make array of strings, I have function rLine which reads line from stdin, each inputted line I need to save in array, but I don't have any idea about number of inputted string lines. So I need to dynamically increase array size to store them, I wrote such code: char *res[2], *old = res; while( 1 ){ line = rLine( stdin ), len = strlen( line ); res[row] = (char*)malloc( len + 1); strcpy( res[row++], line); res = (char**) realloc( res, row ); /* adding 1 more row, not sure adding size row? */ if ( /*some cond*/ ) break; } But this code doesn't seem to work, how correctly declare array and increase it size?

    Read the article

  • regular expression for bit strings with even number of 1s

    - by equilibrium
    Let L= { w in (0+1)* | w has even number of 1s}, i.e. L is the set of all bit strings with even number of 1s. Which one of the regular expressions below represents L? A) (0*10*1)* B) 0*(10*10*)* C) 0*(10*1)* 0* D) 0*1(10*1)* 10* According to me option D is never correct because it does not represent the bit string with zero 1s. But what about the other options? We are concerned about the number of 1s(even or not) not the number of zeros doesn't matter. Then which is the correct option and why?

    Read the article

  • Method to concatenate 2 Strings in Java

    - by GooF
    I have a method in Java that concatenates 2 Strings. It currently works correctly, but I think it can be written better. public static String concat(String str1, String str2) { String rVal = null; if (str1 != null || str2 != null) { rVal = ""; if (str1 != null) { rVal += str1; } if (str2 != null) { rVal += str2; } } return rVal; } Here are some of the requirements: If both str1 and str2 are null, the method returns null If either str1 or str2 is null, it will just return the not null String If str1 and str2 are not null, it will concatenate them It never adds "null" to the result Can anyone do this with less code?

    Read the article

  • Object for storing strings in Python

    - by evg
    class MyWriter: def __init__(self, stdout): self.stdout = stdout self.dumps = [] def write(self, text): self.stdout.write(smart_unicode(text).encode('cp1251')) self.dumps.append(text) def close(self): self.stdout.close() writer = MyWriter(sys.stdout) save = sys.stdout sys.stdout = writer I use self.dumps list to store data obtained from prints. Is there a more convenient object for storing string lines in memory? Ideally I want dump it to one big string. I can get it like this "\n".join(self.dumps) from code above. May be it's better to just concatenate strings - self.dumps += text?

    Read the article

  • Strings - Filling In Leading Zeros Wtih A Zero

    - by headscratch
    I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

    Read the article

  • Different sizes of same strings - Telnet programming

    - by tommyogp
    Hi all, I have been trying to create an iphone app sending telnet command. However what puzzling me is that the sizes of certain strings are so much different, particularly when they include \n or \r. I listed out a few examples. Please assist. const char *a = "play 25\n"; int sizeBitA1 = sizeof(a); // 8 units int sizeBitA2 = sizeof("play 25\n"); // 9 units const char *b = "\r\n"; int sizeBitB1 = sizeof(b); // 8 units int sizeBitB2 = sizeof("\r\n"); // 3 units

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Localized database strings

    - by Steve
    I have a small Grails application that has the following domain: class Meal { String name String description String allergyNote } For localization purposes the three strings should now be available in multiple languages. For example, while an English user would see name="Steak", a Spanish user should see name="Filete" in the output. I was thinking of doing the following: class Language { String isoCode String languageName } class TranslatedString { Language language String translation } but I am not sure how to link the Meals with the TranslatedStrings as it is used for three members, also I would like to use it for other classes (not just Meal) as well (or do I need to have separated tables, i.e. a MealNameTranslated, MealDescriptionTranslated, etc tables?). I know this is probably a stupid question, but I am a beginner and have not been able to figure this out :-(

    Read the article

  • Are hashCodes unique for Strings?

    - by Batty
    Recently, I came across a piece of code, where Map<Integer, String> is used, where Integer(key) is hashCode of some string and String value corresponding to that. Is this right thing to do? Because now, equals will not be called for the String when calling get. (get is also done using hashCode() method on String object. Or, hashCode(s) are unique for unique Strings? I checked equals od String class. There is logic written for that. I am confused.

    Read the article

  • Problems with this stack implementation

    - by Andersson Melo
    where is the mistake? My code here: typedef struct _box { char *dados; struct _box * proximo; } Box; typedef struct _pilha { Box * topo; }Stack; void Push(Stack *p, char * algo) { Box *caixa; if (!p) { exit(1); } caixa = (Box *) calloc(1, sizeof(Box)); caixa->dados = algo; caixa->proximo = p->topo; p->topo = caixa; } char * Pop(Stack *p) { Box *novo_topo; char * dados; if (!p) { exit(1); } if (p->topo==NULL) return NULL; novo_topo = p->topo->proximo; dados = p->topo->dados; free(p->topo); p->topo = novo_topo; return dados; } void StackDestroy(Stack *p) { char * c; if (!p) { exit(1); } c = NULL; while ((c = Pop(p)) != NULL) { free(c); } free(p); } int main() { int conjunto = 1; char p[30]; int flag = 0; Stack *pilha = (Stack *) calloc(1, sizeof(Stack)); FILE* arquivoIN = fopen("L1Q3.in","r"); FILE* arquivoOUT = fopen("L1Q3.out","w"); if (arquivoIN == NULL) { printf("Erro na leitura do arquivo!\n\n"); exit(1); } fprintf(arquivoOUT,"Conjunto #%d\n",conjunto); while (fscanf(arquivoIN,"%s", p) != EOF ) { if (pilha->topo == NULL && flag != 0) { conjunto++; fprintf(arquivoOUT,"\nConjunto #%d\n",conjunto); } if(strcmp(p, "return") != 0) { Push(pilha, p); } else { p = Pop(pilha); if(p != NULL) { fprintf(arquivoOUT, "%s\n", p); } } flag = 1; } StackDestroy(pilha); return 0; } The Pop function returns the string value read from file. But is not correct and i don't know why.

    Read the article

  • strchr in objective C?

    - by Brian Postow
    I'm trying to write the equivalent of strchr, but with NSStrings... I've currently got this: Boolean nsstrchr(NSString* s, char c) { NSString *tmps = [NSString stringWithFormat: @"%c", c]; NSCharacterSet *cSet = [NSCharacterSet characterSetWithCharactersInString: tmps]; NSRange rg = [s rangeOfCharacterFromSet: cSet]; return rg.location != NSNotFound; } This seems needlessly complex... Is there a way to do this (preferably, one that doesn't involve turning the NSString into a cstring which doubles the run time, or writing it myself using characterAtIndex:... Am I missing some obvious method in the NSString description?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • endsWith in javascript

    - by Bobby Kumar
    How can I check if a string ends with a particular character in javascript? example I have a string say var str = "mystring#"; I want to know if that string str is ending with "#". How can I check it? is there a endsWith() method in javascript? one solution I have is take the length of the string and get the last character and check it. Is this the best way or there is any other way?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >