Search Results

Search found 30085 results on 1204 pages for 'read only'.

Page 171/1204 | < Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >

  • How can i interpret a time value in ascii into a numerical value?

    - by Bilal
    I have a file which is as follows: 15:03:21 II 0.88 0.64 15:03:31 II 0.88 0.64 15:03:42 II 0.40 0.40 etc. after loading the file in matlab, I want to be able to read the first column (which corresponds to time) and interpret them as numerical values. At the moment, they are interpreted as a string of ascii characters and i can't perform any mathematical operations on them. Does anyone have any suggestions as to how i can read the time as numbers instead of a string of ascii characters?

    Read the article

  • Need help converting Ruby code to php code

    - by newprog
    Yesterday I posted this queston. Today I found the code which I need but written in Ruby. Some parts of code I have understood (I don't know Ruby) but there is one part that I can't. I think people who know ruby and php can help me understand this code. def do_create(image) # Clear any old info in case of a re-submit FIELDS_TO_CLEAR.each { |field| image.send(field+'=', nil) } image.save # Compose request vm_params = Hash.new # Submitting a file in ruby requires opening it and then reading the contents into the post body file = File.open(image.filename_in, "rb") # Populate the parameters and compute the signature # Normally you would do this in a subroutine - for maximum clarity all # parameters are explicitly spelled out here. vm_params["image"] = file # Contents will be read by the multipart object created below vm_params["image_checksum"] = image.image_checksum vm_params["start_job"] = 'vectorize' vm_params["image_type"] = image.image_type if image.image_type != 'none' vm_params["image_complexity"] = image.image_complexity if image.image_complexity != 'none' vm_params["image_num_colors"] = image.image_num_colors if image.image_num_colors != '' vm_params["image_colors"] = image.image_colors if image.image_colors != '' vm_params["expire_at"] = image.expire_at if image.expire_at != '' vm_params["licensee_id"] = DEVELOPER_ID #in php it's like this $vm_params["sequence_number"] = -rand(100000000);????? vm_params["sequence_number"] = Kernel.rand(1000000000) # Use a negative value to force an error when calling the test server vm_params["timestamp"] = Time.new.utc.httpdate string_to_sign = CREATE_URL + # Start out with the URL being called... #vm_params["image"].to_s + # ... don't include the file per se - use the checksum instead vm_params["image_checksum"].to_s + # ... then include all regular parameters vm_params["start_job"].to_s + vm_params["image_type"].to_s + vm_params["image_complexity"].to_s + # (nil.to_s => '', so this is fine for vm_params we don't use) vm_params["image_num_colors"].to_s + vm_params["image_colors"].to_s + vm_params["expire_at"].to_s + vm_params["licensee_id"].to_s + # ... then do all the security parameters vm_params["sequence_number"].to_s + vm_params["timestamp"].to_s vm_params["signature"] = sign(string_to_sign) #no problem # Workaround class for handling multipart posts mp = Multipart::MultipartPost.new query, headers = mp.prepare_query(vm_params) # Handles the file parameter in a special way (see /lib/multipart.rb) file.close # mp has read the contents, we can close the file now response = post_form(URI.parse(CREATE_URL), query, headers) logger.info(response.body) response_hash = ActiveSupport::JSON.decode(response.body) # Decode the JSON response string ##I have understood below def sign(string_to_sign) #logger.info("String to sign: '#{string_to_sign}'") Base64.encode64(HMAC::SHA1.digest(DEVELOPER_KEY, string_to_sign)) end # Within Multipart modul I have this: class MultipartPost BOUNDARY = 'tarsiers-rule0000' HEADER = {"Content-type" => "multipart/form-data, boundary=" + BOUNDARY + " "} def prepare_query (params) fp = [] params.each {|k,v| if v.respond_to?(:read) fp.push(FileParam.new(k, v.path, v.read)) else fp.push(Param.new(k,v)) end } query = fp.collect {|p| "--" + BOUNDARY + "\r\n" + p.to_multipart }.join("") + "--" + BOUNDARY + "--" return query, HEADER end end end Thanks for your help.

    Read the article

  • NoSQL vs. MySQL when scalability is irrelevant

    - by Bryan Ward
    Recently I have read a lot about different NoSQL databases and how they are being effectively deployed by some major websites out there. I'm starting a project in which I think the schema-free nature of a database such as MongoDB would be tremendously useful. Everything I have read though seems to indicate that the main advantage of a NoSQL database is scalability. Is choosing a NoSQL database for the schema-free design just as legitimate a design decision as that of scalability?

    Read the article

  • Different cache concurrent strategies for root entity and its collection (Hibernate with EHCache)?

    - by grigory
    Given example from Hibernate docs and modifying it so that root level entity (Customer) is read-only while one of its collections (tickets) is read-write: @Entity @Cache(usage = CacheConcurrencyStrategy.READ_ONLY) public class Customer { ... @OneToMany(...) @Cache(usage = CacheConcurrencyStrategy.READ_WRITE) public SortedSet<Ticket> getTickets() { return tickets; } ... } Would collection of tickets get refreshed when accessing customer from cache?

    Read the article

  • What does Error 3112 indicate when compacting an MDB file?

    - by Craig Johnston
    What does Error 3112 indicate when compacting an MDB file? The Error description is "Records can't be read; no read permission on 'xyz123.mdb'" There is a known issue with the Compact function on some versions of Access MDBs. Is the solution in this case to run the Microsoft utility JETCOMP.EXE on this file? What are the other possible causes of this error?

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Image compatibility in iphone and android

    - by damodar
    I developed UI for iphone apps and now want to use the same UI in Android apps. I read that Android use dip for image resolution and i also read that 1 dip=1.5 pixel.I simply multiply the image size by 1.5px. Now the problem is that the image is blur and not as clear as in iphone apps.So will some body suggest me how should i make a design so that it could be used in iphone and android.

    Read the article

  • How to convince someone, that reading books(blogs, so..) is important?

    - by hgulyan
    Dear all, please, help me to convince, that no matter what you're doing, you need to read some stuff, try to learn something new. They say, that they don't want to sit in front of computer in the end of a day and they don't have opportunity to read in working hours, or they're too tired for doing something. Have you faced this kind of situation? What did you do?

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • problem with reading arabic in jsp page?

    - by sword101
    Hey there i have a column in the databsePostgreSQL which contains arabic data when reading the data from the database in the controller it's read fine, encoding is good but when sending the data to the jsp page and trying to read it it appears something like ????????? any ideas why something like this occur?

    Read the article

  • Django Piston - how can I create custom methods?

    - by orokusaki
    I put my questions in the code comments for clarity: from piston.handler import AnonymousBaseHandler class AnonymousAPITest(AnonymousBaseHandler): fields = ('update_subscription',) def update_subscription(self, request, months): # Do some stuff here to update a subscription based on the # number of months provided. # How the heck can I call this method? return {'msg': 'Your subscription has been updated!'} def read(self, request): return { 'msg': 'Why would I need a read() method on a fully custom API?' }

    Read the article

  • dynamically scan pictures in a folder and display using jquery slideshow

    - by Nazmin
    guys, anyone know how to scan a folder using jquery or javascript code snippet, after that get a picture file name and embed in <li></li> or <div></div>, i've used php code to read through the folder and loop through the element to display the thumbnails and all, but it's not work well. I've try on galleria, gallerific, galleryView jquery slideshow plugin but those might not work well with php processing because of predefined configuration or something, can anyone tweak or hack these gallery to dynamically read an image from a folder?

    Read the article

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • How to prevent arbitrary code execution vulnerability in our programs?

    - by Calmarius
    You always read in changelogs when your system or browser or any program updates that they fixed a bug that made possible that an attacker can execute any code in your computer with a forged website, or attacking your computer with carefully forged packets, etc... Because you read it so often that means any program can have similar vulnerabilites... What causes this? how to design our programs to prevent similar issues?

    Read the article

  • Alt for images in JasperReports

    - by Aviator
    Hello all, While putting an image element in PDF report, how can we give the alt description or similar kind of description for that image? The idea is to read the description when some screen reader is used to read the PDF. Currently, the reader (JAWS) says just 'graphic' when encountering an image in the PDF. Thanks!

    Read the article

  • reading a text file in java

    - by aks
    I want to read a text file containing a space sepearted vlaues.Values are integers. How can i read it and put it in a array list?? eg of contents of texx file 1 62 4 55 5 6 77 now i want a arraylist as [1, 62,4,55,5,6,77]. How do i do it in java?

    Read the article

  • Ship maritime AIS information API

    - by James Cadd
    Is there an API or Web Service that can be used to read AIS data? Most links I read starting at Wikipedia (http://en.wikipedia.org/wiki/Automatic_Identification_System) say that AIS data is freely available but I'm having a hard time finding a provider of the data. A C# example or language agnostic web service would be helpful.

    Read the article

  • Boost BGL thread safety

    - by Budzoli
    Hi! I'd like multiple threads to use the dijkstra_shortest_paths and astar_search functions of the BGL, and then read the property maps of the result vertices and edges. I'm wondering wether I should use mutexes to ensure thread-safety. So here are my questions: 1., Are the dijkstra_shortest_paths and astar_search functions of the Boost.Graph thread safe? 2., If I only try to read the property maps of the graph from multiple threads, do I need to worry about thread safety?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • access DLLs with java script

    - by Caio Garcia
    I need to read the serial port as an input for a web based applicaton. I know that the browser can't do it, but if I build an DLL and send it to my client, can I access this DLL and read de serial port with an java script or i will need something like ActiveX?

    Read the article

< Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >