Search Results

Search found 27205 results on 1089 pages for 'python imaging library'.

Page 176/1089 | < Previous Page | 172 173 174 175 176 177 178 179 180 181 182 183  | Next Page >

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Using __str__ representation for printing objects in containers in Python

    - by BobDobbs
    I've noticed that when an instance with an overloaded str method is passed to the print() function as an argument, it prints as intended. However, when passing a container that contains one of those instances to print(), it uses the repr method instead. That is to say, print(x) displays the correct string representation of x, and print(x, y) works correctly, but print([x]) or print((x, y)) prints the repr representation instead. First off, why does this happen? Secondly, is there a way to correct that behavior of print() in this circumstance?

    Read the article

  • compute mean in python for a generator

    - by nmaxwell
    Hi, I'm doing some statistics work, I have a (large) collection of random numbers to compute the mean of, I'd like to work with generators, because I just need to compute the mean, so I don't need to store the numbers. The problem is that numpy.mean breaks if you pass it a generator. I can write a simple function to do what I want, but I'm wondering if there's a proper, built-in way to do this? It would be nice if I could say "sum(values)/len(values)", but len doesn't work for genetators, and sum already consumed values. here's an example: import numpy def my_mean(values): n = 0 Sum = 0.0 try: while True: Sum += next(values) n += 1 except StopIteration: pass return float(Sum)/n X = [k for k in range(1,7)] Y = (k for k in range(1,7)) print numpy.mean(X) print my_mean(Y) these both give the same, correct, answer, buy my_mean doesn't work for lists, and numpy.mean doesn't work for generators. I really like the idea of working with generators, but details like this seem to spoil things. thanks for any help -nick

    Read the article

  • python fdb save huge data from database to file

    - by peter
    I have this script SELECT = """ select coalesce (p.ID,'') as id, coalesce (p.name,'') as name, from TABLE as p """ self.cur.execute(SELECT) for row in self.cur.itermap(): xml +=" <item>\n" xml +=" <id>" + id + "</id>\n" xml +=" <name>" + name + "</name>\n" xml +=" </item>\n\n" #save xml to file here f = open... and I need to save data from huge database to file. There are 10 000s (up to 40000) of items in my database and it takes very long time when script runs (1 hour and more) until finish. How can I take data I need from database and save it to file "at once"? (as quick as possible? I don't need xml output because I can process data from output on my server later. I just need to do it as quickly as possible. Any idea?) Many thanks!

    Read the article

  • how can i randomly print an element from a list in python

    - by lm
    So far i have this, which prints out every word in my list, but i am trying to print only one word at random. Any suggestions? def main(): # open a file wordsf = open('words.txt', 'r') word=random.choice('wordsf') words_count=0 for line in wordsf: word= line.rstrip('\n') print(word) words_count+=1 # close the file wordsf.close()

    Read the article

  • Extra characters Extracted with XPath and Python (html)

    - by Nacari
    I have been using XPath with scrapy to extract text from html tags online, but when I do I get extra characters attached. An example is trying to extract a number, like "204" from a <td> tag and getting [u'204']. In some cases its much worse. For instance trying to extract "1 - Mathoverflow" and instead getting [u'\r\n\t\t 1 \u2013 MathOverflow\r\n\t\t ']. Is there a way to prevent this, or trim the strings so that the extra characters arent a part of the string? (using items to store the data). It looks like it has something to do with formatting, so how do I get xpath to not pick up that stuff?

    Read the article

  • Sorting Python list based on the length of the string

    - by prosseek
    I want to sort a list of strings based on the string length. I tried to use sort as follows, but it doesn't seem to give me correct result. xs = ['dddd','a','bb','ccc'] print xs xs.sort(lambda x,y: len(x) < len(y)) print xs ['dddd', 'a', 'bb', 'ccc'] ['dddd', 'a', 'bb', 'ccc'] What might be wrong?

    Read the article

  • Organizing a random list of objects in Python.

    - by Saebin
    So I have a list that I want to convert to a list that contains a list for each group of objects. ie ['objA.attr1', 'objC', 'objA.attr55', 'objB.attr4'] would return [['objA.attr1', 'objA.attr55'], ['objC'], ['objB.attr4']] currently this is what I use: givenList = ['a.attr1', 'b', 'a.attr55', 'c.attr4'] trgList = [] objNames = [] for val in givenList: obj = val.split('.')[0] if obj in objNames: id = objNames.index(obj) trgList[id].append(val) else: objNames.append(obj) trgList.append([val]) #print trgList It seems to run a decent speed when the original list has around 100,000 ids... but I am curious if there is a better way to do this. Order of the objects or attributes does not matter. Any ideas?

    Read the article

  • How to debug an external library (OpenCV) in Visual C++?

    - by neuviemeporte
    I am developing a project in VC++2008. The project uses the OpenCV library (but I guess this applies to any other library). I am working with the Debug configuration, the linker properties include the debug versions of the library .lib's as additional dependencies. In VC++ Directories under Tools|Options i set up the include directory, the .lib directory, the source directories for the library as well. I get an error while calling one of the functions from the library and I'd like to see exactly what that function is doing. The line that produces the error is: double error = cvStereoCalibrate(&calObjPointsM, &img1PointsM, &img2PointsM, &pointCountsM, &cam1M, &dist1M, &cam2M, &dist2M, imgSize, &rotM, &transM, NULL, NULL, cvTermCriteria(CV_TERMCRIT_ITER + CV_TERMCRIT_EPS, 100, 1e-5)); I set up a breakpoint at this line to see how the cvStereoCalibrate() function fails. Unfortunately the debugger won't show the source code for this function when I hit "Step into". It skips immediately to the cvTermCriteria() (which is a simple inline, macro-kinda function) and show its contents. Is there anything else I need to do to be able to enter the external library functions in the debugger? EDIT: I think the cvTermCriteria() function shows in the debugger, because it's defined in a header file, therefore immediately accesible to the project.

    Read the article

  • python: problem with dictionary get method default value

    - by goutham
    I'm having a new problem here .. CODE 1: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name']))) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) CODE 2: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']])) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name']) code 2 fails but code 1 works the data serverInfo_D:{'user': 'usr', 'pass': 'pass'} data: {'par1': 9995, 'extraparam1': 22} val: {'par1','user','pass','extraparam1'} exception are raised for for data dict .. and all code in for loop which iterates over val

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to print a dictionary in python c api function

    - by dizgam
    PyObject* dict = PyDict_New(); PyDict_SetItem(dict, key, value); PyDict_GetItem(dict, key); Bus error if i use getitem function otherwise not. So Want to confirm that the dictionary has the same values which i have set. Other than using PyDict_GetItem function, Is there any other method to print the values of the dictionary?

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • Python - Subprocess Popen and Thread error

    - by n0idea
    In both functions record and ftp, i have subprocess.Popen if __name__ == '__main__': try: t1 = threading.Thread(target = record) t1.daemon = True t1.start() t2 = threading.Thread(target = ftp) t2.daemon = True t2.start() except (KeyboardInterrupt, SystemExit): sys.exit() The error I'm receiving is: Exception in thread Thread-1 (most likely raised during interpreter shutdown): Traceback (most recent call last): File "/usr/lib/python2.7/threading.py", line 551, in __bootstrap_inner File "/usr/lib/python2.7/threading.py", line 504, in run File "./in.py", line 20, in recordaudio File "/usr/lib/python2.7/subprocess.py", line 493, in call File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ File "/usr/lib/python2.7/subprocess.py", line 1237, in _execute_child <type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'close' What might the issue be ?

    Read the article

  • I want to design a html form in python

    - by VaIbHaV-JaIn
    when user will enter details in the text box on the html from <h1>Please enter new password</h1> <form method="POST" enctype="application/json action="uid"> Password<input name="passwd"type="password" /><br> Retype Password<input name="repasswd" type="password" /><br> <input type="Submit" /> </form> </body> i want to post the data in json format through http post request and also i want to set content-type = application/json

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

< Previous Page | 172 173 174 175 176 177 178 179 180 181 182 183  | Next Page >