Search Results

Search found 43847 results on 1754 pages for 'command line arguments'.

Page 179/1754 | < Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >

  • Putting max. 30 characters per line with CSS

    - by Pieter
    I have a paragraph of text: <p>Lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum lorem ipsum</p> How can I make sure that no more than 30 characters are shown on one line with CSS?

    Read the article

  • die $template->error() produces no line number

    - by Kinopiko
    In the following short program: use Template; my $template = Template->new (INCLUDE_PATH => "."); $template->process ("non-existent-file") or die $template->error (); why does "die" not produce a line number and newline? Output looks like this: $ perl template.pl file error - non-existent-file: not found ~ 503 $

    Read the article

  • WPF Coordinates of intersection from two Line objects

    - by Becky Franklin
    I have two Line objects in C# WPF, and I'm trying to construct a method to work out the coordinates at which the lines intersect (if at all). After giving myself a headache reminding myself of high school maths to do this, I can't work out how to map it into programming format - anyone know how to do this? Thanks very much, Becky

    Read the article

  • java.util.logging: how to suppress date line

    - by andrews
    I'm trying to suppress output of the date line durinng logging when using the default logger in java.util.logging. For example, here is a typical output: Jun 1, 2010 10:18:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:18:12.0, local-time=20100601t101812, duration=180000 Jun 1, 2010 10:21:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:21:12.0, local-time=20100601t102112, duration=180000 I would like to get rid of the Jun 1, 2010... lines, they just clutter my log output. How can I do this?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • How to transform multiple line into one line in bash stdout ?

    - by Samantha
    Hello, I sometimes do this in my shell : sam@sam-laptop:~/shell$ ps aux | grep firefox | awk '{print $2}' 2681 2685 2689 4645 $ kill -9 2681 2685 2689 4645 Is there a way I can transform the multiple lines containing the PIDs into one line separated by spaces ? (It's a little bit annoying to type the PIDs every time and I really would like to learn :) ) Thanks a lot.

    Read the article

  • Current Line For Visual Studio Macros

    - by Vadim
    How can I read text of a current line (where cursor is situated) from Macros? I'm going to use such a fucntion: Public Sub AddTextToChangeLogFile() Dim textOnACurrentLine As ??? textOnACurrentLine = ??? If textOnACurrentLine.Text <> String.Empty Then Dim sw As New StreamWriter("C:\###\Changes.txt", True) sw.WriteLine(textOnACurrentLine + ". file: " + DTE.ActiveDocument.Name) sw.Close() End If End Sub

    Read the article

  • Animating gradient displays line artifacts in ActionScript

    - by TheDarkIn1978
    i've programatically created a simple gradient (blue to red) sprite rect using my own basic class called GradientRect, but moving or animation the sprite exhibits line artifacts. when the sprite is rotating, it kind of resembles bad reception of an old television set. i'm almost certain the cause is because each line slice of the gradient is vector so there are gaps between the lines - this is visible when the sprite is zoomed in. var colorPickerRect:GradientRect = new GradientRect(200, 200, 0x0000FF, 0xFF0000); addChild(colorPickerRect); colorPickerRect.cacheAsBitmap = true; colorPickerRect.x = colorPickerRect.y = 100; colorPickerRect.addEventListener(Event.ENTER_FRAME, rotate); function rotate(evt:Event):void { evt.target.rotation += 1; } ________________________ //CLASS PACKAGE package { import flash.display.CapsStyle; import flash.display.GradientType; import flash.display.LineScaleMode; import flash.display.Sprite; import flash.geom.Matrix; public class GradientRect extends Sprite { public function GradientRect(gradientRectWidth:Number, gradientRectHeight:Number, ...leftToRightColors) { init(gradientRectWidth, gradientRectHeight, leftToRightColors); } private function init(gradientRectWidth:Number, gradientRectHeight:Number, leftToRightColors:Array):void { var leftToRightAlphas:Array = new Array(); var leftToRightRatios:Array = new Array(); var leftToRightPartition:Number = 255 / (leftToRightColors.length - 1); var pixelColor:Number; var i:int; //Push arrays for (i = 0; i < leftToRightColors.length; i++) { leftToRightAlphas.push(1); leftToRightRatios.push(i * leftToRightPartition); } //Graphics matrix and lineStyle var leftToRightColorsMatrix:Matrix = new Matrix(); leftToRightColorsMatrix.createGradientBox(gradientRectWidth, 1); graphics.lineStyle(1, 0, 1, false, LineScaleMode.NONE, CapsStyle.NONE); for (i = 0; i < gradientRectWidth; i++) { graphics.lineGradientStyle(GradientType.LINEAR, leftToRightColors, leftToRightAlphas, leftToRightRatios, leftToRightColorsMatrix); graphics.moveTo(i, 0); graphics.lineTo(i, gradientRectHeight); } } } } how can i solve this problem?

    Read the article

  • NetBeans Java code formatter: logical operators on new line

    - by mizipzor
    My code looks like this: if (firstCondition() && secondCondition()) { // ... code } The default settings for the code formatter in NetBeans wants to put the && on a new line, like this: if (firstCondition() && secondCondition()) { // ... code } The formatter works well so I would just like to find the setting so it doesnt change the code to the latter. Whats the setting called?

    Read the article

  • Convert Line breaks to html break for all field getters in Symfony project

    - by Ben
    I am working on a Symfony project and I currently have this: <?php echo preg_replace('/\n/','<br />', $review->getComments()); ?> and would very much like to be able to make all getters add html line breaks so i don't have to pepper my code with preg_replace. the $object-getFieldname methods are work automatically so I am looking to extend this somewhere to globally add a new method. What is the best approach here?

    Read the article

  • Getting following exception javax.sound.sampled.LineUnavailableException: line with format ULAW 800

    - by angelina
    Dear All, I tried to play and get duration of a wave file using code below but got following exception.please resolve.I m using a wave file format. URL url = new URL("foo.wav"); Clip clip = AudioSystem.getClip(); AudioInputStream ais = AudioSystem.getAudioInputStream(url); clip.open(ais); System.out.println(clip.getMicrosecondLength()); **javax.sound.sampled.LineUnavailableException: line with format ULAW 8000.0 Hz, 8 bit, mono, 1 bytes/frame, not supported.**

    Read the article

  • Simple Tableless Positioning issue: Trying to float Div right on same line

    - by MrEnder
    Ok I just started a template for a website http://clickforclicks.com/design1/ I'm trying to make it tableless. Notice I have a red div along the side. I tried to get one on the otherside aswell that looked the same. But when I do it. It goes to a new line =[ How might I get this effect without using Javascript or Absolute positioning that wont look proper on all resolution sizes.

    Read the article

  • Python: try statement single line

    - by Brant
    Is there a way in python to turn a try/except into a single line? something like... b = 'some variable' a = c | b #try statement goes here Where b is a declared variable and c is not... so c would throw an error and a would become b...

    Read the article

  • Powershell $LastExitCode=0 but $?=False . Redirecting stderr to stdout gives NativeCommandError

    - by Colonel Panic
    Can anyone explain Powershell's surprising behaviour in the second example below? First, a example of sane behaviour: PS C:\> & cmd /c "echo Hello from standard error 1>&2"; echo "`$LastExitCode=$LastExitCode and `$?=$?" Hello from standard error $LastExitCode=0 and $?=True No surprises. I print a message to standard error (using cmd's echo). I inspect the variables $? and $LastExitCode. They equal to True and 0 respectively, as expected. However, if I ask Powershell to redirect standard error to standard output over the first command, I get a NativeCommandError: PS C:\> & cmd /c "echo Hello from standard error 1>&2" 2>&1; echo "`$LastExitCode=$LastExitCode and `$?=$?" cmd.exe : Hello from standard error At line:1 char:4 + cmd <<<< /c "echo Hello from standard error 1>&2" 2>&1; echo "`$LastExitCode=$LastExitCode and `$?=$?" + CategoryInfo : NotSpecified: (Hello from standard error :String) [], RemoteException + FullyQualifiedErrorId : NativeCommandError $LastExitCode=0 and $?=False My first question, why the NativeCommandError ? Secondly, why is $? False when cmd ran successfully and $LastExitCode is 0? Powershell's docs about_Automatic_Variables don't explicitly define $?. I always supposed it is True if and only if $LastExitCode is 0 but my example contradicts that. Here's how I came across this behaviour in the real-world (simplified). It really is FUBAR. I was calling one Powershell script from another. The inner script: cmd /c "echo Hello from standard error 1>&2" if (! $?) { echo "Job failed. Sending email.." exit 1 } # do something else Running this simply .\job.ps1, it works fine, no email is sent. However, I was calling it from another Powershell script, logging to a file .\job.ps1 2>&1 > log.txt. In this case, an email is sent! Here, the act of observing a phenomenon changes its outcome. This feels like quantum physics rather than scripting! [Interestingly: .\job.ps1 2>&1 may or not blow up depending on where you run it]

    Read the article

  • multi-line pattern matching in pyhon

    - by Horace Ho
    A periodic computer generated message (simplified): Hello user123, - (604)7080900 - 152 - minutes Regards Using python, how can I extract "(604)7080900", "152", "minutes" (i.e. any text following a leading "- " pattern) between the two empty lines (empty line is the \n\n after "Hello user123" and the \n\n before "Regards"). Even better if the result string list are stored in an array. Thanks!

    Read the article

< Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >