Search Results

Search found 59230 results on 2370 pages for 'character set'.

Page 18/2370 | < Previous Page | 14 15 16 17 18 19 20 21 22 23 24 25  | Next Page >

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Adding two Set[Any]

    - by Alex Boisvert
    Adding two Set[Int] works: Welcome to Scala version 2.8.1.final (Java HotSpot(TM) Server VM, Java 1.6.0_23). Type in expressions to have them evaluated. Type :help for more information. scala> Set(1,2,3) ++ Set(4,5,6) res0: scala.collection.immutable.Set[Int] = Set(4, 5, 6, 1, 2, 3) But adding two Set[Any] doesn't: scala> Set[Any](1,2,3) ++ Set[Any](4,5,6) <console>:6: error: ambiguous reference to overloaded definition, both method ++ in trait Addable of type (xs: scala.collection.TraversableOnce[Any])scala.collection.immutable.Set[Any] and method ++ in trait TraversableLike of type [B >: Any,That](that: scala.collection.TraversableOnce[B])(implicit bf: scala.collection.generic.CanBuildFrom[scala.collection.immutable.Set[Any],B,That])That match argument types (scala.collection.immutable.Set[Any]) Set[Any](1,2,3) ++ Set[Any](4,5,6) ^ Any suggestion to work around this error?

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • set proxy for vpn server on ubuntu server 12.4

    - by Morteza Soltanabadiyan
    I have a vpn server with HTTPS, L2TP , OPENVPN , PPTP. i want to set proxy in the server so all connection that comes from vpn clients use the proxy that i set in my server. I made a bash script file for it , but proxy not working. gsettings set org.gnome.system.proxy mode 'manual' gsettings set org.gnome.system.proxy.http enabled true gsettings set org.gnome.system.proxy.http host 'cproxy.anadolu.edu.tr' gsettings set org.gnome.system.proxy.http port 8080 gsettings set org.gnome.system.proxy.http authentication-user 'admin' gsettings set org.gnome.system.proxy.http authentication-password 'admin' gsettings set org.gnome.system.proxy use-same-proxy true export http_proxy=http://admin:[email protected]:8080 export https_proxy=http://admin:[email protected]:8080 export HTTP_PROXY=http://admin:[email protected]:8080 export HTTPS_PROXY=http://admin:[email protected]:8080 Now , i dont know what to do to make a global proxy for server and all vpn clients use it automatically.

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • How to set conditional activation to taskflows?

    - by shantala.sankeshwar(at)oracle.com
    This article describes implementing conditional activation to taskflows.Use Case Description Suppose we have a taskflow dropped as region on a page & this region is enclosed in a popup .By default when the page is loaded the respective region also gets loaded.Hence a region model needs to provide a viewId whenever one is requested.  A consequence of this is the TaskFlowRegionModel always has to initialize its task flow and execute the task flow's default activity in order to determine a viewId, even if the region is not visible on the page.This can lead to unnecessary performance overhead of executing task flow to generate viewIds for regions that are never visible. In order to increase the performance,we need to set the taskflow bindings activation property to 'conditional'.Below described is a simple usecase that shows how exactly we can set the conditional activations to taskflow bindings.Steps:1.Create an ADF Fusion web ApplicationView image 2.Create Business components for Emp tableView image3.Create a view criteria where deptno=:some_bind_variableView image4.Generate EmpViewImpl.java file & write the below code.Then expose this to client interface.    public void filterEmpRecords(Number deptNo){            // Code to filter the deptnos         ensureVariableManager().setVariableValue("some_bind_variable",  deptNo);        this.applyViewCriteria(this.getViewCriteria("EmpViewCriteria"));        this.executeQuery();       }5.Create an ADF Taskflow with page fragements & drop the above method on the taskflow6.Also drop the view activity(showEmp.jsff) .Define control flow case from the above method activity to the view activity.Set the method activity as default activityView image7.Create  main.jspx page & drop the above taskflow as region on this pageView image8.Surround the region with the dialog & surround the dialog with the popup(id is Popup1)9.Drop the commandButton on the above page & insert af:showPopupBehavior inside the commandButton:<af:commandButton text="show popup" id="cb1"><af:showPopupBehavior popupId="::Popup1"/></af:commandButton>10.Now if we execute this main page ,we will notice that the method action gets called even before the popup is launched.We can avoid this this by setting the activation property of the taskflow to conditional11.Goto the bindings of the above main page & select the taskflow binding ,set its activation property to 'conditional' & active property to Boolean value #{Somebean.popupVisible}.By default its value should be false.View image12.We need to set the above Boolean value to true only when the popup is launched.This can be achieved by inserting setPropertyListener inside the popup:<af:setPropertyListener from="true" to="#{Somebean.popupVisible}" type="popupFetch"/>13.Now if we run the page,we will notice that the method action is not called & only when we click on 'show popup' button the method action gets called.

    Read the article

  • Bit-Twiddling in SQL

    - by Mike C
    Someone posted a question to the SQL Server forum the other day asking how to count runs of zero bits in an integer using SQL. Basically the poster wanted to know how to efficiently determine the longest contiguous string of zero-bits (known as a run of bits) in any given 32-bit integer. Here are a couple of examples to demonstrate the idea: Decimal = Binary = Zero Run 999,999,999 decimal = 00 111011 1 00 11010 11 00 1 00 1 11111111 binary = 2 contiguous zero bits 666,666,666 decimal = 00100111 10111100...(read more)

    Read the article

  • Using set operation in LINQ

    - by vik20000in
    There are many set operation that are required to be performed while working with any kind of data. This can be done very easily with the help of LINQ methods available for this functionality. Below are some of the examples of the set operation with LINQ. Finding distinct values in the set of data. We can use the distinct method to find out distinct values in a given list.     int[] factorsOf300 = { 2, 2, 3, 5, 5 };     var uniqueFactors = factorsOf300.Distinct(); We can also use the set operation of UNION with the help of UNION method in the LINQ. The Union method takes another collection as a parameter and returns the distinct union values in  both the list. Below is an example.     int[] numbersA = { 0, 2, 4, 5, 6, 8, 9 };    int[] numbersB = { 1, 3, 5, 7, 8 };    var uniqueNumbers = numbersA.Union(numbersB); We can also get the set operation of INTERSECT with the help of the INTERSECT method. Below is an example.     int[] numbersA = { 0, 2, 4, 5, 6, 8, 9 };     int[] numbersB = { 1, 3, 5, 7, 8 };         var commonNumbers = numbersA.Intersect(numbersB);  We can also find the difference between the 2 sets of data with the help of except method.      int[] numbersA = { 0, 2, 4, 5, 6, 8, 9 };     int[] numbersB = { 1, 3, 5, 7, 8 };         IEnumerable<int> aOnlyNumbers = numbersA.Except(numbersB);  Vikram

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Boost.MultiIndex: How to make an effective set intersection?

    - by Arman
    Hello, assume that we have a data1 and data2. How can I intersect them with std::set_intersect()? struct pID { int ID; unsigned int IDf;// postition in the file pID(int id,const unsigned int idf):ID(id),IDf(idf){} bool operator<(const pID& p)const { return ID<p.ID;} }; struct ID{}; struct IDf{}; typedef multi_index_container< pID, indexed_by< ordered_unique< tag<IDf>, BOOST_MULTI_INDEX_MEMBER(pID,unsigned int,IDf)>, ordered_non_unique< tag<ID>,BOOST_MULTI_INDEX_MEMBER(pID,int,ID)> > > pID_set; ID_set data1, data2; Load(data1); Load(data2); pID_set::index<ID>::type& L1_ID_index=L1.data.get<ID>(); pID_set::index<ID>::type& L2_ID_index=L2.data.get<ID>(); // How do I use set_intersect? Kind regards, Arman.

    Read the article

  • Set scheduled task last result to 0x0 manually

    - by Rogier
    Every night a task runs that checks if any scheduled task has a Last Result is not equal to 0x0. If a scheduled tasks has an error like 0x1, then automatically an e-mail is sent to me. As some tasks are running only weekly, and sometimes an error occurs which results in not equal to 0x0, every night an e-mail is sent with the error message, as the Last Result column still shows the last result of 0x1. But I would like to set the Last Result column to 0x0 manually if I solved a problem, so I won't get every night an e-mail with the error message. So is it possible to set the scheduled tasks Last Result to 0x0 manually (or by a script)? @harrymc. See located script underneath that is sending the e-mail. I can easily add a criteria to ignore result 0x1 (or another code), however this is not the solution as most of the times this result is a real error and has to be e-mailed. set [email protected] set SMTPServer=SMTPserver set PathToScript=c:\scripts set [email protected] for /F "delims=" %%a in ('schtasks /query /v /fo:list ^| findstr /i "Taskname Result"') do call :Sub %%a goto :eof :Sub set Line=%* set BOL=%Line:~0,4% set MOL=%Line:~38% if /i %BOL%==Task ( set name=%MOL% goto :eof ) set result=%MOL% echo Task Name=%name%, Task Result=%result% if not %result%==0 ( echo Task %name% failed with result %result% > %PathToScript%\taskcheckerlog.txt bmail %PathToScript%\taskcheckerlog.txt -t %YourEmailAddress% -a "Warning! Failed %name% Scheduled Task on %computername%" -s %SMTPServer% -f %FromAddress% -b "Task %name% failed with result %result% on CorVu scheduler %computername%" )

    Read the article

  • How to set the service endPoint URI dynamically in SOA Suite 11gR1 by Sylvain Grosjean’s

    - by JuergenKress
    Use Case : This example demonstrates how to get the URI of the backend service from a repository and how to set it dynamically to our partnerLink (dynamicPartnerLink). Implementation steps : Create a dvm file Create a BPEL component Add the endPointURI variable and assign the uri Set the endpointURI property in the invoke activity 1. Create a DVM file : In order to define our repository, we are going to use DVM (Data Value Maps) : For more explanation regarding DVM, you should read this documentation. 2. Create a BPEL Component : First you need to implement the simple bpel process like this : - The AssignPayload is used to set the inputvariable of our invoke activity. - The AssignEndpointURI is used to dynamically set the endPointURI variable from our DVM repository - The invoke activity to call the external service Read the complete article here. SOA & BPM Partner Community For regular information on Oracle SOA Suite become a member in the SOA & BPM Partner Community for registration please visit www.oracle.com/goto/emea/soa (OPN account required) If you need support with your account please contact the Oracle Partner Business Center. Blog Twitter LinkedIn Facebook Wiki Technorati Tags: human task,SOA Community,Oracle SOA,Oracle BPM,Community,OPN,Jürgen Kress,Sylvain Grosjean

    Read the article

  • Writing algorithm on 2D data set in plain english

    - by Alexandre P. Levasseur
    I have started an introductory Java class and the material is absolutely horrendous and I have to get excellent grades to be accepted into the master's degree, hence my very beginner question: In my assignment I have to write algorithms (no pseudo-code yet) to solve a board game (Sudoku). Essentially, the notes say that an algorithm is specification of the input(s), the output(s) and the treatments applied to the input to get the output. My question lies on the wording of algorithms because I could probably code it but I can't seem to put it on paper in a coherent way. The game has a 9x9 board and one of the algorithms to write has to find the solution by looking at 3 squares (either horizontal or vertical) and see if one of the three sub-squares match the number you are looking for. If none match then the number you are looking to place is in one of the other 2 set of 3 sub-squares (see image to get a better idea). I really can't get my head around how to formulate the solution into the terms described above or maybe it's just too simple, here's what I was thinking: Input: A 2-dimensional set of data of size 9 by 9 to be solved and a number to search for. Ouput: A 2-dimensional set of data of size 9 by 9 either solved or partially solved. Treatment: Scan each set of 3x9 and 9x3 squares. For each line or column of a 3x3 square check if the number matches a line (or column). If it does then move to the next line (or column). If not then proceed to the next 3x3 square in the same line (or column). Rinse and repeat. Does that make sense as an algorithm written in plain english ? I'm not looking for an answer to the algorithm per se but rather on the formulation of algorithms in plain english.

    Read the article

  • How do I set up pairing email addresses?

    - by James A. Rosen
    Our team uses the Ruby gem hitch to manage pairing. You set it up with a group email address (e.g. [email protected]) and then tell it who is pairing: $ hitch james tiffany Hitch then sets your Git author configuration so that our commits look like commit 629dbd4739eaa91a720dd432c7a8e6e1a511cb2d Author: James and Tiffany <[email protected]> Date: Thu Oct 31 13:59:05 2013 -0700 Unfortunately, we've only been able to come up with two options: [email protected] doesn't exist. The downside is that if Travis CI tries to notify us that we broke the build, we don't see it. [email protected] does exist and forwards to all the developers. Now the downside is that everyone gets spammed with every broken build by every pair. We have too many possible pair to do any of the following: set up actual [email protected] email addresses or groups (n^2 email addresses) set up forwarding rules for [email protected] (n^2 forwarding rules) set up forwarding rules for [email protected] (n forwarding rules for each of n developers) Does anyone have a system that works for them?

    Read the article

  • Glowing Chess Set Combines LEDs, Chess, and DIY Electronics Fun

    - by ETC
    Anyone who says that the centuries old game of Chess cannot be improved upon has obviously never played with a glowing chess board. Today we take a look at a cheap glass chess set modded to glow from within. Instructables user Tetranitrate had a glass chess set he scored on-the-cheap and had always wanted to illuminate it in some way. He ruled out illuminating the board itself (no good way to keep track of the piece colors) and putting a battery in each piece (too big of a pain, over complicates the design). His final solution, the one seen in the photo here, was to build a wood and copper board, run a low voltage across the surface of the chess board, and affix a conductive copper ring to the bottom of each chess piece to power the LED embedded inside. In this manner the pieces would glow on the board and then go dark as soon as they were removed from play. Hit up the link below for additional details on the build and instructions on building your own. LED Chess Set [Instructables] Latest Features How-To Geek ETC How to Get Amazing Color from Photos in Photoshop, GIMP, and Paint.NET Learn To Adjust Contrast Like a Pro in Photoshop, GIMP, and Paint.NET Have You Ever Wondered How Your Operating System Got Its Name? Should You Delete Windows 7 Service Pack Backup Files to Save Space? What Can Super Mario Teach Us About Graphics Technology? Windows 7 Service Pack 1 is Released: But Should You Install It? Save Files Directly from Your Browser to the Cloud in Chrome and Iron The Steve Jobs Chronicles – Charlie and the Apple Factory [Video] Google Chrome Updates; Faster, Cleaner Menus, Encrypted Password Syncing, and More Glowing Chess Set Combines LEDs, Chess, and DIY Electronics Fun Peaceful Alpine River on a Sunny Day [Wallpaper] Fast Society Creates Mini and Mobile Temporary Social Networks

    Read the article

  • .NET Properties - Use Private Set or ReadOnly Property?

    - by tgxiii
    In what situation should I use a Private Set on a property versus making it a ReadOnly property? Take into consideration the two very simplistic examples below. First example: Public Class Person Private _name As String Public Property Name As String Get Return _name End Get Private Set(ByVal value As String) _name = value End Set End Property Public Sub WorkOnName() Dim txtInfo As TextInfo = _ Threading.Thread.CurrentThread.CurrentCulture.TextInfo Me.Name = txtInfo.ToTitleCase(Me.Name) End Sub End Class // ---------- public class Person { private string _name; public string Name { get { return _name; } private set { _name = value; } } public void WorkOnName() { TextInfo txtInfo = System.Threading.Thread.CurrentThread.CurrentCulture.TextInfo; this.Name = txtInfo.ToTitleCase(this.Name); } } Second example: Public Class AnotherPerson Private _name As String Public ReadOnly Property Name As String Get Return _name End Get End Property Public Sub WorkOnName() Dim txtInfo As TextInfo = _ Threading.Thread.CurrentThread.CurrentCulture.TextInfo _name = txtInfo.ToTitleCase(_name) End Sub End Class // --------------- public class AnotherPerson { private string _name; public string Name { get { return _name; } } public void WorkOnName() { TextInfo txtInfo = System.Threading.Thread.CurrentThread.CurrentCulture.TextInfo; _name = txtInfo.ToTitleCase(_name); } } They both yield the same results. Is this a situation where there's no right and wrong, and it's just a matter of preference?

    Read the article

  • How to Set Up a Hadoop Cluster Using Oracle Solaris (Hands-On Lab)

    - by Orgad Kimchi
    Oracle Technology Network (OTN) published the "How to Set Up a Hadoop Cluster Using Oracle Solaris" OOW 2013 Hands-On Lab. This hands-on lab presents exercises that demonstrate how to set up an Apache Hadoop cluster using Oracle Solaris 11 technologies such as Oracle Solaris Zones, ZFS, and network virtualization. Key topics include the Hadoop Distributed File System (HDFS) and the Hadoop MapReduce programming model. We will also cover the Hadoop installation process and the cluster building blocks: NameNode, a secondary NameNode, and DataNodes. In addition, you will see how you can combine the Oracle Solaris 11 technologies for better scalability and data security, and you will learn how to load data into the Hadoop cluster and run a MapReduce job. Summary of Lab Exercises This hands-on lab consists of 13 exercises covering various Oracle Solaris and Apache Hadoop technologies:     Install Hadoop.     Edit the Hadoop configuration files.     Configure the Network Time Protocol.     Create the virtual network interfaces (VNICs).     Create the NameNode and the secondary NameNode zones.     Set up the DataNode zones.     Configure the NameNode.     Set up SSH.     Format HDFS from the NameNode.     Start the Hadoop cluster.     Run a MapReduce job.     Secure data at rest using ZFS encryption.     Use Oracle Solaris DTrace for performance monitoring.  Read it now

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

< Previous Page | 14 15 16 17 18 19 20 21 22 23 24 25  | Next Page >