Search Results

Search found 5143 results on 206 pages for 'programs'.

Page 180/206 | < Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >

  • What file format can represent an uncompressed raster image at 48 or 64 bits per pixel?

    - by finnw
    I am creating screenshots under Windows and using the LockBits function from GDI+ to extract the pixel data, which will then be written to a file. To maximise performance I am also: Using the same PixelFormat as the source bitmap, to avoid format conversion Using the ImageLockModeUserInputBuf flag to extract the pixel data into a pre-allocated buffer This pre-allocated buffer (pointed to by BitmapData::Scan0) is part of a memory-mapped file (to avoid copying the pixel data again.) I will also be writing the code that reads the file, so I can use (or invent) any format I wish. However I would prefer to use a well-known format that existing programs (ideally web browsers) are able to read, because that means I can visually confirm that the images are correct before writing the code for the other program (that reads the image.) I have implemented this successfully for the PixelFormat32bppRGB format, which matches the format of a 32bpp BMP file, so if I extract the pixel data directly into the memory-mapped BMP file and prefix it with a BMP header I get a valid BMP image file that can be opened in Paint and most browsers. Unfortunately one of the machines I am testing on returns pixels in PixelFormat64bppPARGB format (presumably this is influenced by the video adapter driver) and there is no corresponding BMP pixel format for this. Converting to a 16, 24 or 32bpp BMP format slows the program down considerably (as well as being lossy) so I am looking for a file format that can use this pixel format without conversion, so I can extract directly into the memory-mapped file as I have done with the 32bpp format. What raster image file formats support 48bpp and/or 64bpp?

    Read the article

  • How to launch multiple Internet Explorer windows/tabs from batch file?

    - by TheZenker
    I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

    Read the article

  • What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

    - by Jason S
    I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

    Read the article

  • What programming languages do the top tier Universities teach?

    - by Simucal
    I'm constantly being inundated with articles and people talking about how most of today's Universities are nothing more than Java vocational schools churning out mediocre programmer after mediocre programmer. Our very own Joel Spolsky has his famous article, "The Perils of Java Schools." Similarly, Alan Kay, a famous Computer Scientist (and SO member) has said this in the past: "I fear — as far as I can tell — that most undergraduate degrees in computer science these days are basically Java vocational training." - Alan Kay (link) If the languages being taught by the schools are considered such a contributing factor to the quality of the school's program then I'm curious what languages do the "top-tier" computer science schools teach (MIT, Carnegie Mellon, Stanford, etc)? If the average school is performing so poorly due in large part the languages (or lack of) that they teach then what languages do the supposed "good" cs programs teach that differentiate them? If you can, provide the name of the school you attended, followed by a list of the languages they use throughout their coursework. Edit: Shog-9 asks why I don't get this information directly from the schools websites themselves. I would, but many schools websites don't discuss the languages they use in their class descriptions. Quite a few will say, "using high-level languages we will...", without elaborating on which languages they use. So, we should be able to get a pretty accurate list of languages taught at various well known institutions from the various SO members who have attended at them.

    Read the article

  • Asymptotic complexity of a compiler

    - by Meinersbur
    What is the maximal acceptable asymptotic runtime of a general-purpose compiler? For clarification: The complexity of compilation process itself, not of the compiled program. Depending on the program size, for instance, the number of source code characters, statements, variables, procedures, basic blocks, intermediate language instructions, assembler instructions, or whatever. This is highly depending on your point of view, so this is a community wiki. See this from the view of someone who writes a compiler. Will the optimisation level -O4 ever be used for larger programs when one of its optimisations takes O(n^6)? Related questions: When is superoptimisation (exponential complexity or even incomputable) acceptable? What is acceptable for JITs? Does it have to be linear? What is the complexity of established compilers? GCC? VC? Intel? Java? C#? Turbo Pascal? LCC? LLVM? (Reference?) If you do not know what asymptotic complexity is: How long are you willing to wait until the compiler compiled your project? (scripting languages excluded)

    Read the article

  • Monotouch or Titanium for rapid application development on IPhone?

    - by Ronnie
    As a .Net developer I always dreamed for the possibility to develop with my existing skills (c#) applications for the Iphone. Both programs require a Mac and the Iphone Sdk installed. Appcelerator Titanium was the first app I tried and it is based on exposing some Iphone native api to javascript so that they can be called using that language. Monotouch starts at $399 for beeing able to deploy on the Iphone and not on the Iphone simulator while Titanium is free. Monotouch (Monodevelop) has an Ide that is currently missing in Titanium (but you can use any editor like Textmate, Aptana...) I think both program generate at the end a native precompiled app (also if I am not sure about the size of the final app on the Iphone as I think the .Net framework calls are prelilnked at compilation time in Monotouch). I am also not sure about the full coverage of all the Iphone api and features. Titanium has also the advantage to enable Android app development but as a c# developer I still find Monotouch experience more like the Visual Studio one. Witch one would you choose and what are your experiences on Monotouch and Titanium?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • Hadoop streaming with Python and python subprocess

    - by Ganesh
    I have established a basic hadoop master slave cluster setup and able to run mapreduce programs (including python) on the cluster. Now I am trying to run a python code which accesses a C binary and so I am using the subprocess module. I am able to use the hadoop streaming for a normal python code but when I include the subprocess module to access a binary, the job is getting failed. As you can see in the below logs, the hello executable is recognised to be used for the packaging, but still not able to run the code. . . packageJobJar: [/tmp/hello/hello, /app/hadoop/tmp/hadoop-unjar5030080067721998885/] [] /tmp/streamjob7446402517274720868.jar tmpDir=null JarBuilder.addNamedStream hello . . 12/03/07 22:31:32 INFO mapred.FileInputFormat: Total input paths to process : 1 12/03/07 22:31:32 INFO streaming.StreamJob: getLocalDirs(): [/app/hadoop/tmp/mapred/local] 12/03/07 22:31:32 INFO streaming.StreamJob: Running job: job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:31:32 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:31:33 INFO streaming.StreamJob: map 0% reduce 0% 12/03/07 22:32:05 INFO streaming.StreamJob: map 100% reduce 100% 12/03/07 22:32:05 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:32:05 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:32:05 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:32:05 ERROR streaming.StreamJob: Job not Successful! 12/03/07 22:32:05 INFO streaming.StreamJob: killJob... Streaming Job Failed! Command I am trying is : hadoop jar contrib/streaming/hadoop-*streaming*.jar -mapper /home/hduser/MARS.py -reducer /home/hduser/MARS_red.py -input /user/hduser/mars_inputt -output /user/hduser/mars-output -file /tmp/hello/hello -verbose where hello is the C executable. It is a simple helloworld program which I am using to check the basic functioning. My Python code is : #!/usr/bin/env python import subprocess subprocess.call(["./hello"]) Any help with how to get the executable run with Python in hadoop streaming or help with debugging this will get me forward in this. Thanks, Ganesh

    Read the article

  • How Does a COM Program Locate a .NET DLL Registered for COM Interop?

    - by Eric J.
    One customer wants to consume our .NET DLLs from VB6. They are designed to support reverse interop and all works fine... except: There are two separate VB6 programs in two different directories. It seems it's necessary to do one of: Copy the .NET DLL into both directories, or Install the .NET DLL in the GAC This is the customer's observation and also supported by the RegAsm documentation: After registering an assembly using Regasm.exe, you can install it in the global assembly cache so that it can be activated from any COM client. If the assembly is only going to be activated by a single application, you can place it in that application's directory. I'm confused on this point. First point of confusion: As far as I understand, the COM runtime locates the DLL using the Prog ID / Class ID. When I look in the registry at the Class ID entry, I see the full path to the .NET DLL in the CodeBase key. Why is it that a COM program using the Prog ID / Class ID doesn't locate the .NET DLL using the CodeBase? Second point of confusion: The GAC is specific to .NET. How is it involved in resolving COM references?

    Read the article

  • Perl program - Dynamic Bootstrapping code

    - by mgj
    Hi.. I need to understand the working of this particular program, It seems to be quite complicated, could you please see if you could help me understanding what this program in Perl does, I am a beginner so I hardly can understand whats happening in the code given on the following link below, Any kind of guidance or insights wrt this program is highly appreciated. Thank you...:) This program is called premove.pl.c Its associated with one more program premove.pl, Its code looks like this: #!perl open (newdata,">newdata.txt") || die("cant create new file\n");#create passwd file $linedata = ""; while($line=<>){ chomp($line); #chop($line); print newdata $line."\n"; } close(newdata); close(olddata); __END__ I am even not sure how to run the two programs mentioned here. I wonder also what does the extension of the first program signify as it has "pl.c" extension, please let me know if you know what it could mean. I need to understand it asap thats why I am posting this question, I am kind of short of time else I would try to figure it out myself, This seems to be a complex program for a beginner like me, hope you understand. Thank you again for your time.

    Read the article

  • How can I effectively test against the Windows API?

    - by Billy ONeal
    I'm still having issues justifying TDD to myself. As I have mentioned in other questions, 90% of the code I write does absolutely nothing but Call some Windows API functions and Print out the data returned from said functions. The time spent coming up with the fake data that the code needs to process under TDD is incredible -- I literally spend 5 times as much time coming up with the example data as I would spend just writing application code. Part of this problem is that often I'm programming against APIs with which I have little experience, which forces me to write small applications that show me how the real API behaves so that I can write effective fakes/mocks on top of that API. Writing implementation first is the opposite of TDD, but in this case it is unavoidable: I do not know how the real API behaves, so how on earth am I going to be able to create a fake implementation of the API without playing with it? I have read several books on the subject, including Kent Beck's Test Driven Development, By Example, and Michael Feathers' Working Effectively with Legacy Code, which seem to be gospel for TDD fanatics. Feathers' book comes close in the way it describes breaking out dependencies, but even then, the examples provided have one thing in common: The program under test obtains input from other parts of the program under test. My programs do not follow that pattern. Instead, the only input to the program itself is the system upon which it runs. How can one effectively employ TDD on such a project?

    Read the article

  • In Perl, how can a subroutine get a coderef that points to itself?

    - by hillu
    For learning purposes, I am toying around with the idea of building event-driven programs in Perl and noticed that it might be nice if a subroutine that was registered as an event handler could, on failure, just schedule another call to itself for a later time. So far, I have come up with something like this: my $cb; my $try = 3; $cb = sub { my $rc = do_stuff(); if (!$rc && --$try) { schedule_event($cb, 10); # schedule $cb to be called in 10 seconds } else { do_other_stuff; } }; schedule_event($cb, 0); # schedule initial call to $cb to be performed ASAP Is there a way that code inside the sub can access the coderef to that sub so I could do without using an extra variable? I'd like to schedule the initial call like this. schedule_event( sub { ... }, 0); I first thought of using caller(0)[3], but this only gives me a function name, (__ANON__ if there's no name), not a code reference that has a pad attached to it.

    Read the article

  • Simple grid layout question

    - by Matt H.
    I can't believe I'm back to this after working with WPF for 3 months :) Consider very common setup: How do I configure the rowheights so that the top and bottom rows (menu bar and status bar) size to fit the height of their content, and the middle row (main content), fills the remaining available space in the program? I can't fix the height of the top/bottom rows because the height of their content can vary. <Window> <Grid> <Grid.RowDefinitions> <RowDefinition/> <RowDefinition/> <RowDefinition/> </Grid.RowDefinitions> <Menu Grid.Row=0> ...menuitems </Menu> <Grid Grid.Row=1> ...main application content here (like most programs) </Grid> <StatusBar> ...statusbaritems </StatusBar> </Grid> </Window>

    Read the article

  • Why do people have to use multiple versions of jQuery in the same page?

    - by reprogrammer
    I have noticed that sometimes people have to use multiple versions of jQuery in the same page (See question 1 and question 2). I assume people have to carry old versions of jQuery because some pieces of their code is based on an older version of jQuery. Obviously, this approach causes inefficiency. The ideal solution is to refactor the old code to use the newer jQuery API. I wonder if there are tools that automate the process of upgrading a piece of code to use a newer version of jQuery. I've never written programs in in either Javascript or jQuery. So, I'd like to hear from programmers experienced in these language about their opinion on this issue. In particular, I'd like to know the following. How much of problem it is to have to load multiple versions of jQuery? Have you ever had to load multiple versions of any other library in the same page? Do you know of any refactoring tools that helps you migrate your code to use the updated API? Do you think such a refactoring tool is useful? Are you willing to use it?

    Read the article

  • How to limit traffic using multicast over localhost

    - by Shane Holloway
    I'm using multicast UDP over localhost to implement a loose collection of cooperative programs running on a single machine. The following code works well on Mac OSX, Windows and linux. The flaw is that the code will receive UDP packets outside of the localhost network as well. For example, sendSock.sendto(pkt, ('192.168.0.25', 1600)) is received by my test machine when sent from another box on my network. import platform, time, socket, select addr = ("239.255.2.9", 1600) sendSock = socket.socket(socket.AF_INET, socket.SOCK_DGRAM, socket.IPPROTO_UDP) sendSock.setsockopt(socket.IPPROTO_IP, socket.IP_MULTICAST_TTL, 24) sendSock.setsockopt(socket.IPPROTO_IP, socket.IP_MULTICAST_IF, socket.inet_aton("127.0.0.1")) recvSock = socket.socket(socket.AF_INET, socket.SOCK_DGRAM, socket.IPPROTO_UDP) recvSock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, True) if hasattr(socket, 'SO_REUSEPORT'): recvSock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEPORT, True) recvSock.bind(("0.0.0.0", addr[1])) status = recvSock.setsockopt(socket.IPPROTO_IP, socket.IP_ADD_MEMBERSHIP, socket.inet_aton(addr[0]) + socket.inet_aton("127.0.0.1")); while 1: pkt = "Hello host: {1} time: {0}".format(time.ctime(), platform.node()) print "SEND to: {0} data: {1}".format(addr, pkt) r = sendSock.sendto(pkt, addr) while select.select([recvSock], [], [], 0)[0]: data, fromAddr = recvSock.recvfrom(1024) print "RECV from: {0} data: {1}".format(fromAddr, data) time.sleep(2) I've attempted to recvSock.bind(("127.0.0.1", addr[1])), but that prevents the socket from receiving any multicast traffic. Is there a proper way to configure recvSock to only accept multicast packets from the 127/24 network, or do I need to test the address of each received packet?

    Read the article

  • RDP through TCP Proxy

    - by johng100
    Hi, First time in Stackoverflow and I'm hoping someone can help me. I'm looking at a proof of concept to pass RDP traffic through a TCP Proxy/tunnel which will pass through firewalls using HTTPS. The problem has to do with deploying images to machines and so it can't be assumed that the .NET framework will be present, so C++ is being used at the deployment end of a connection. The basic system I have at present is a program which listens for client connections on a port then passes any data to a WCF service which stores it as a byte array. A deployment machine (using GSoap and C++) polls the WCF service for messages and if it finds them then passes the data onto the target server process via sockets. I know this sounds horrible, but it works for simple test clients and server passing data to and from simple test client and server programs via this WCF/C++/C# proxy layer. But I have to support traffic from RDP, VNC and possibly others, so I need a transparent proxy to do this and am wondering whether the above approach is worth pursuing. I've read up on SSH tunneling and that seems a possibility. My basic question is is it possible to tunnel RDP traffic over HTTPS using custom code. Thanks John

    Read the article

  • Jboss EAP 5 and Tomcat 6 on the same Win env. (Jboss gets Toncat`s home page when`s up)

    - by Eddie
    Hi guys, I`m newbie to Java technologies, just trying to catch up some idea of it. I was trying to build a java environment to play with Eclipse, Mysql, Tomcat and Jboss and integrate these together. I did: 1. Installed jdk1.6.0_20 (including JAVA_HOME and path variables; I work on Win Vista), mysql 5 and eclipse-jee-galileo (the latest one, 3.6 I believe) and all went good - java programs are compiled and run getting a DB connection. 2. Installed Jboss enterprise-installer-5.0.1.jar with localhost:8080 and this also went good - run.bat started it and I could log in as admin thru its home page. I integrated it with eclipse and could start and stop it from there too. 3. I got apache-tomcat-6.0.26-windows-x86 and this also runs and stops from command line and from eclipse. But this one uses localhost:8080 without asking. Now the problem is when I start jboss I get Tomcat home page and I can`t fix it. Is it probably because both now use localhost:8080? BTW, does Jboss EAP 5 contain Tomcat inside and I shouldn't add that Tomcat separately? Thanks for you help in advance, Eddie

    Read the article

  • Is it practical to program with your feet?

    - by bmm
    Has anyone tried using foot pedals in addition to the traditional keyboard and mouse combo to improve your effectiveness in the editor? Any actual experiences out there? Does it work, or is it just for carpal tunnel relief? I found one blog entry from a programmer who actually tried it: So now I can type using my feet for most of the modifier keys. I am using the pedals as I type this. I am still getting used to them, but the burning in my left wrist has definitely reduced. I think I can also type a little faster, but I am too lazy to do the speed tests with and without the pedals to verify this. On the negative side: Working out where to put your feet when you aren’t typing can be a little awkward. The pedals tend to move around the carpet, despite being metal and quite heavy. Some small spikes might have helped. Although the travel on the pedals is small, they are surprisingly stiff. Another programmer's experience: Anybody with hand pain must get foot pedals, since they can remove a tremendous load from your hands. I have two foot pedals, and use one for the SHIFT key, and the other for the CONTROL key. (I still type META by hand.) I have found that in the process of using the Emacs text editor to compose computer programs, I tend to use the SHIFT, CONTROL and META keys constantly, and it is easy to remove most of this load from one's hands. Some foot switch products: Savant Elite Triple Foot Switch FragPedal Bilbo Step On It!

    Read the article

  • What are the most interesting equivalences arising from the Curry-Howard Isomorphism?

    - by Tom
    I came upon the Curry-Howard Isomorphism relatively late in my programming life, and perhaps this contributes to my being utterly fascinated by it. It implies that for every programming concept there exists a precise analogue in formal logic, and vice versa. Here's an "obvious" list of such analogies, off the top of my head: program/definition | proof type/declaration | proposition inhabited type | theorem function | implication function argument | hypothesis/antecedent function result | conclusion/consequent function application | modus ponens recursion | induction identity function | tautology non-terminating function | absurdity tuple | conjunction (and) disjoint union | exclusive disjunction (xor) parametric polymorphism | universal quantification So, to my question: what are some of the more interesting/obscure implications of this isomorphism? I'm no logician so I'm sure I've only scratched the surface with this list. For example, here are some programming notions for which I'm unaware of pithy names in logic: currying | "((a & b) => c) iff (a => (b => c))" scope | "known theory + hypotheses" And here are some logical concepts which I haven't quite pinned down in programming terms: primitive type? | axiom set of valid programs? | theory ? | disjunction (or)

    Read the article

  • Why does Clojure hang after hacing performed my calculations?

    - by Thomas
    Hi all, I'm experimenting with filtering through elements in parallel. For each element, I need to perform a distance calculation to see if it is close enough to a target point. Never mind that data structures already exist for doing this, I'm just doing initial experiments for now. Anyway, I wanted to run some very basic experiments where I generate random vectors and filter them. Here's my implementation that does all of this (defn pfilter [pred coll] (map second (filter first (pmap (fn [item] [(pred item) item]) coll)))) (defn random-n-vector [n] (take n (repeatedly rand))) (defn distance [u v] (Math/sqrt (reduce + (map #(Math/pow (- %1 %2) 2) u v)))) (defn -main [& args] (let [[n-str vectors-str threshold-str] args n (Integer/parseInt n-str) vectors (Integer/parseInt vectors-str) threshold (Double/parseDouble threshold-str) random-vector (partial random-n-vector n) u (random-vector)] (time (println n vectors (count (pfilter (fn [v] (< (distance u v) threshold)) (take vectors (repeatedly random-vector)))))))) The code executes and returns what I expect, that is the parameter n (length of vectors), vectors (the number of vectors) and the number of vectors that are closer than a threshold to the target vector. What I don't understand is why the programs hangs for an additional minute before terminating. Here is the output of a run which demonstrates the error $ time lein run 10 100000 1.0 [null] 10 100000 12283 [null] "Elapsed time: 3300.856 msecs" real 1m6.336s user 0m7.204s sys 0m1.495s Any comments on how to filter in parallel in general are also more than welcome, as I haven't yet confirmed that pfilter actually works.

    Read the article

  • Optimizing PHP require_once's for low disk i/o?

    - by buggedcom
    Q1) I'm designing a CMS (-who isn't!) but priority is being given to caching. Literally everything is cached. DB rows, DB id queries, Configuration data, processed data, compiled templates. Currently it has two layers of caching. The first is a opcode cache or memory cache such as apc, eaccelerator, xcache or memcached. If an entry is not found in there it is then searched for in the secondary slow cache, ie php includes. Are the opcode caches actually faster than doing a require_once to a php file with a var_export'd array of data in it? My tests are inconclusive as my development box (5.3 of XAMPP) keeps throwing errors installing any of the aforementioned programs. Q2) The CMS has numerous helper classes that are autoloaded on demand instead of loading all files. Mostly each has a require before it so no autoloading needs to take place, however this is not the question. Because a page script can have up to 50/60 helper files included I have a feeling that if the site was under pressure it would buckle because of all the i/o that this incurs. Ignore for the moment that there is output cache in place that would remove the need for what I am about to suggest, and also that opcode caches would render this moot. What I have tried to do is join all the helper files required for the scripts execution in one single file. This is achievable and works well, however it has a side effect of greatly increasing the memory usage dramatically even though technically the same code is being used. What are your thoughts and opinions on this?

    Read the article

  • Can you force a crash if a write occurs to a given memory location with finer than page granularity?

    - by Joseph Garvin
    I'm writing a program that for performance reasons uses shared memory (alternatives have been evaluated, and they are not fast enough for my task, so suggestions to not use it will be downvoted). In the shared memory region I am writing many structs of a fixed size. There is one program responsible for writing the structs into shared memory, and many clients that read from it. However, there is one member of each struct that clients need to write to (a reference count, which they will update atomically). All of the other members should be read only to the clients. Because clients need to change that one member, they can't map the shared memory region as read only. But they shouldn't be tinkering with the other members either, and since these programs are written in C++, memory corruption is possible. Ideally, it should be as difficult as possible for one client to crash another. I'm only worried about buggy clients, not malicious ones, so imperfect solutions are allowed. I can try to stop clients from overwriting by declaring the members in the header they use as const, but that won't prevent memory corruption (buffer overflows, bad casts, etc.) from overwriting. I can insert canaries, but then I have to constantly pay the cost of checking them. Instead of storing the reference count member directly, I could store a pointer to the actual data in a separate mapped write only page, while keeping the structs in read only mapped pages. This will work, the OS will force my application to crash if I try to write to the pointed to data, but indirect storage can be undesirable when trying to write lock free algorithms, because needing to follow another level of indirection can change whether something can be done atomically. Is there any way to mark smaller areas of memory such that writing them will cause your app to blow up? Some platforms have hardware watchpoints, and maybe I could activate one of those with inline assembly, but I'd be limited to only 4 at a time on 32-bit x86 and each one could only cover part of the struct because they're limited to 4 bytes. It'd also make my program painful to debug ;)

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ?

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge from a conceptual Turing Machine to a real modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

< Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >