Search Results

Search found 59194 results on 2368 pages for 'depth first search'.

Page 183/2368 | < Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >

  • Java-Counting occurrence of word from huge textfile

    - by Naveen
    I have a text file of size 115MB. It consists of about 20 million words. I have to use the file as a word collection, and use it to search the occurrence of each user-given words from the collection. I am using this process as a small part in my project. I need a method for finding out the number of occurrence of given words in a faster and correct manner since i may use it in iterations. I am in need of suggestion about any API that i can make use or some other way that performs the task in a quicker manner. Any recommendations are appreciated.

    Read the article

  • Multiple errors while adding searching to app

    - by Thijs
    Hi, I'm fairly new at iOS programming, but I managed to make a (in my opinion quite nice) app for the app store. The main function for my next update will be a search option for the app. I followed a tutorial I found on the internet and adapted it to fit my app. I got back quite some errors, most of which I managed to fix. But now I'm completely stuck and don't know what to do next. I know it's a lot to ask, but if anyone could take a look at the code underneath, it would be greatly appreciated. Thanks! // // RootViewController.m // GGZ info // // Created by Thijs Beckers on 29-12-10. // Copyright 2010 __MyCompanyName__. All rights reserved. // #import "RootViewController.h" // Always import the next level view controller header(s) #import "CourseCodes.h" @implementation RootViewController @synthesize dataForCurrentLevel, tableViewData; #pragma mark - #pragma mark View lifecycle // OVERRIDE METHOD - (void)viewDidLoad { [super viewDidLoad]; // Go get the data for the app... // Create a custom string that points to the right location in the app bundle NSString *pathToPlist = [[NSBundle mainBundle] pathForResource:@"SCSCurriculum" ofType:@"plist"]; // Now, place the result into the dictionary property // Note that we must retain it to keep it around dataForCurrentLevel = [[NSDictionary dictionaryWithContentsOfFile:pathToPlist] retain]; // Place the top level keys (the program codes) in an array for the table view // Note that we must retain it to keep it around // NSDictionary has a really useful instance method - allKeys // The allKeys method returns an array with all of the keys found in (this level of) a dictionary tableViewData = [[[dataForCurrentLevel allKeys] sortedArrayUsingSelector:@selector(caseInsensitiveCompare:)] retain]; //Initialize the copy array. copyListOfItems = [[NSMutableArray alloc] init]; // Set the nav bar title self.title = @"GGZ info"; //Add the search bar self.tableView.tableHeaderView = searchBar; searchBar.autocorrectionType = UITextAutocorrectionTypeNo; searching = NO; letUserSelectRow = YES; } /* - (void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; } */ /* - (void)viewDidAppear:(BOOL)animated { [super viewDidAppear:animated]; } */ /* - (void)viewWillDisappear:(BOOL)animated { [super viewWillDisappear:animated]; } */ /* - (void)viewDidDisappear:(BOOL)animated { [super viewDidDisappear:animated]; } */ //RootViewController.m - (void) searchBarTextDidBeginEditing:(UISearchBar *)theSearchBar { searching = YES; letUserSelectRow = NO; self.tableView.scrollEnabled = NO; //Add the done button. self.navigationItem.rightBarButtonItem = [[[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemDone target:self action:@selector(doneSearching_Clicked:)] autorelease]; } - (NSIndexPath *)tableView :(UITableView *)theTableView willSelectRowAtIndexPath:(NSIndexPath *)indexPath { if(letUserSelectRow) return indexPath; else return nil; } //RootViewController.m - (void)searchBar:(UISearchBar *)theSearchBar textDidChange:(NSString *)searchText { //Remove all objects first. [copyListOfItems removeAllObjects]; if([searchText length] &gt; 0) { searching = YES; letUserSelectRow = YES; self.tableView.scrollEnabled = YES; [self searchTableView]; } else { searching = NO; letUserSelectRow = NO; self.tableView.scrollEnabled = NO; } [self.tableView reloadData]; } //RootViewController.m - (void) searchBarSearchButtonClicked:(UISearchBar *)theSearchBar { [self searchTableView]; } - (void) searchTableView { NSString *searchText = searchBar.text; NSMutableArray *searchArray = [[NSMutableArray alloc] init]; for (NSDictionary *dictionary in listOfItems) { NSArray *array = [dictionary objectForKey:@"Countries"]; [searchArray addObjectsFromArray:array]; } for (NSString *sTemp in searchArray) { NSRange titleResultsRange = [sTemp rangeOfString:searchText options:NSCaseInsensitiveSearch]; if (titleResultsRange.length &gt; 0) [copyListOfItems addObject:sTemp]; } [searchArray release]; searchArray = nil; } //RootViewController.m - (void) doneSearching_Clicked:(id)sender { searchBar.text = @""; [searchBar resignFirstResponder]; letUserSelectRow = YES; searching = NO; self.navigationItem.rightBarButtonItem = nil; self.tableView.scrollEnabled = YES; [self.tableView reloadData]; } //RootViewController.m - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { if (searching) return 1; else return [listOfItems count]; } // Customize the number of rows in the table view. - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { if (searching) return [copyListOfItems count]; else { //Number of rows it should expect should be based on the section NSDictionary *dictionary = [listOfItems objectAtIndex:section]; NSArray *array = [dictionary objectForKey:@"Countries"]; return [array count]; } } - (NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section { if(searching) return @""; if(section == 0) return @"Countries to visit"; else return @"Countries visited"; } // Customize the appearance of table view cells. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; } // Set up the cell... if(searching) cell.text = [copyListOfItems objectAtIndex:indexPath.row]; else { //First get the dictionary object NSDictionary *dictionary = [listOfItems objectAtIndex:indexPath.section]; NSArray *array = [dictionary objectForKey:@"Countries"]; NSString *cellValue = [array objectAtIndex:indexPath.row]; cell.text = cellValue; } return cell; } - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { //Get the selected country NSString *selectedCountry = nil; if(searching) selectedCountry = [copyListOfItems objectAtIndex:indexPath.row]; else { NSDictionary *dictionary = [listOfItems objectAtIndex:indexPath.section]; NSArray *array = [dictionary objectForKey:@"Countries"]; selectedCountry = [array objectAtIndex:indexPath.row]; } //Initialize the detail view controller and display it. DetailViewController *dvController = [[DetailViewController alloc] initWithNibName:@"DetailView" bundle:[NSBundle mainBundle]]; dvController.selectedCountry = selectedCountry; [self.navigationController pushViewController:dvController animated:YES]; [dvController release]; dvController = nil; } //RootViewController.m - (void) searchBarTextDidBeginEditing:(UISearchBar *)theSearchBar { //Add the overlay view. if(ovController == nil) ovController = [[OverlayViewController alloc] initWithNibName:@"OverlayView" bundle:[NSBundle mainBundle]]; CGFloat yaxis = self.navigationController.navigationBar.frame.size.height; CGFloat width = self.view.frame.size.width; CGFloat height = self.view.frame.size.height; //Parameters x = origion on x-axis, y = origon on y-axis. CGRect frame = CGRectMake(0, yaxis, width, height); ovController.view.frame = frame; ovController.view.backgroundColor = [UIColor grayColor]; ovController.view.alpha = 0.5; ovController.rvController = self; [self.tableView insertSubview:ovController.view aboveSubview:self.parentViewController.view]; searching = YES; letUserSelectRow = NO; self.tableView.scrollEnabled = NO; //Add the done button. self.navigationItem.rightBarButtonItem = [[[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemDone target:self action:@selector(doneSearching_Clicked:)] autorelease]; } // Override to allow orientations other than the default portrait orientation. - (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { // Return YES for supported orientations. return YES; } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Relinquish ownership any cached data, images, etc that aren't in use. } - (void)viewDidUnload { // Relinquish ownership of anything that can be recreated in viewDidLoad or on demand. // For example: self.myOutlet = nil; } - (void)dealloc { [dataForCurrentLevel release]; [tableViewData release]; [super dealloc]; } #pragma mark - #pragma mark Table view methods // DATA SOURCE METHOD - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 1; } // DATA SOURCE METHOD - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { // How many rows should be displayed? return [tableViewData count]; } // DELEGATE METHOD - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { // Cell reuse block static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } // Configure the cell's contents - we want the program code, and a disclosure indicator cell.textLabel.text = [tableViewData objectAtIndex:indexPath.row]; cell.accessoryType = UITableViewCellAccessoryDisclosureIndicator; return cell; } //RootViewController.m - (void)searchBar:(UISearchBar *)theSearchBar textDidChange:(NSString *)searchText { //Remove all objects first. [copyListOfItems removeAllObjects]; if([searchText length] &gt; 0) { [ovController.view removeFromSuperview]; searching = YES; letUserSelectRow = YES; self.tableView.scrollEnabled = YES; [self searchTableView]; } else { [self.tableView insertSubview:ovController.view aboveSubview:self.parentViewController.view]; searching = NO; letUserSelectRow = NO; self.tableView.scrollEnabled = NO; } [self.tableView reloadData]; } //RootViewController.m - (void) doneSearching_Clicked:(id)sender { searchBar.text = @""; [searchBar resignFirstResponder]; letUserSelectRow = YES; searching = NO; self.navigationItem.rightBarButtonItem = nil; self.tableView.scrollEnabled = YES; [ovController.view removeFromSuperview]; [ovController release]; ovController = nil; [self.tableView reloadData]; } // DELEGATE METHOD - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // In any navigation-based application, you follow the same pattern: // 1. Create an instance of the next-level view controller // 2. Configure that instance, with settings and data if necessary // 3. Push it on to the navigation stack // In this situation, the next level view controller is another table view // Therefore, we really don't need a nib file (do you see a CourseCodes.xib? no, there isn't one) // So, a UITableViewController offers an initializer that programmatically creates a view // 1. Create the next level view controller // ======================================== CourseCodes *nextVC = [[CourseCodes alloc] initWithStyle:UITableViewStylePlain]; // 2. Configure it... // ================== // It needs data from the dictionary - the "value" for the current "key" (that was tapped) NSDictionary *nextLevelDictionary = [dataForCurrentLevel objectForKey:[tableViewData objectAtIndex:indexPath.row]]; nextVC.dataForCurrentLevel = nextLevelDictionary; // Set the view title nextVC.title = [tableViewData objectAtIndex:indexPath.row]; // 3. Push it on to the navigation stack // ===================================== [self.navigationController pushViewController:nextVC animated:YES]; // Memory manage it [nextVC release]; } /* // Override to support conditional editing of the table view. - (BOOL)tableView:(UITableView *)tableView canEditRowAtIndexPath:(NSIndexPath *)indexPath { // Return NO if you do not want the specified item to be editable. return YES; } */ /* // Override to support editing the table view. - (void)tableView:(UITableView *)tableView commitEditingStyle:(UITableViewCellEditingStyle)editingStyle forRowAtIndexPath:(NSIndexPath *)indexPath { if (editingStyle == UITableViewCellEditingStyleDelete) { // Delete the row from the data source. [tableView deleteRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:UITableViewRowAnimationFade]; } else if (editingStyle == UITableViewCellEditingStyleInsert) { // Create a new instance of the appropriate class, insert it into the array, and add a new row to the table view. } } */ /* // Override to support rearranging the table view. - (void)tableView:(UITableView *)tableView moveRowAtIndexPath:(NSIndexPath *)fromIndexPath toIndexPath:(NSIndexPath *)toIndexPath { } */ /* // Override to support conditional rearranging of the table view. - (BOOL)tableView:(UITableView *)tableView canMoveRowAtIndexPath:(NSIndexPath *)indexPath { // Return NO if you do not want the item to be re-orderable. return YES; } */ @end

    Read the article

  • Twitter Bootstrap styling conflicts with plug-ins like jqGrid and other third part libraries

    - by Renso
    Issues:The concern is that the Twitter Bootstrap framework is that some of their css selectors are simply too generic and have incompatibility issues and conflicts with most third party plug-ins and css libraries, like jQuery-UI and jqGrid.My most pressing concern is only with the generic selector for the styling of "INPUT" controls.Some concerns:So basically anyone using BS (Bootstrap) will have to override styling 100% of the time on all input controls on all their web pages for all the plug-ins they use that render their own styling for input controls. This seems to chisel away any reason for using Bootstrap. Overriding Bootstrap css in this case seems illogical at best as it implies the BS styling is not correct or as granular as it is supposed to be. It also suggests you realize there is an issue here. Any person who has written a fair amount of css will realize that it is a mammoth task to to take an existing app, converting it to BS and then having to find all non-BS input controls and styling them all. The worst part is that there is no generic styling for this as each input control has a different source/context, some are regular tags and some belong to plug-ins, each with their own flavor of styling. For new web apps the challenge is not that different, each time you add a new plug-in you will have to test all facets of it, and I mean all of it, pop-ups, etc, that contain any kind of input control to make sure it is styled correctly. I am having a hard time seeing the benefits of BS in this context. So until the BS team addresses the issue, or not, you may be wondering what is the easiest solution.Help the community to drive this issue home by creating a new issue on github, see my entry here: https://github.com/twitter/bootstrap/issues/4008. As you can see I got some good and some negative feedback, but we all agree it is an issue. I do believe my solution below should be reverse compatible if the proper class declarations were followed as recommended by Bootstrap.The solution:Add a higher-level qualifier to the input selector, which may not break anything.  Add "control-group" and "controls" classes as higher-level selectors, as they have to be declared inside those classes anyway as far as I understand the design approach of BS. So in my example below can modify the css without possible breaking anything, see the css at the bottom. I tested this briefly and seems to render just as expected. May not be complete as I only spent a few minutes on the css. Your feedback will be greatly appreciated. <div class="control-group">    <label title="" for="Contact_FirstName" class="control-label">First Name</label>    <div class="controls">        <input type="text" value="" name="Contact.FirstName" id="Contact_FirstName" data-val-required="The Reader Contact&amp;#39;s First Name is required" data-val-length-min="2" data-val-length-max="250" data-val-length="The maximum length allowed for the Reader Contact&amp;#39;s First Name is 250 characters and must be two or more characters long" data-val="true" class="input-medium">        <span data-valmsg-replace="true" data-valmsg-for="Contact.FirstName" class="field-validation-valid"></span>    </div></div>Here are the SCSS (SASS) updates. In stead of just including the updates I decided to include the entire bootstrap SCSS file so you can just copy-and-paste it in stead of trying to figure out what selectors have changed./*! * Bootstrap v2.0.4 * Enhacement by Renso Hollhumer * Copyright 2012 Twitter, Inc * Licensed under the Apache License v2.0 * http://www.apache.org/licenses/LICENSE-2.0 * * Designed and built with all the love in the world @twitter by @mdo and @fat. * Enhancement by Renso Hollhumer: To isolate styling of INPUT tags to the Bootstrap context only */.clearfix {  *zoom: 1;}.clearfix:before,.clearfix:after {  display: table;  content: "";}.clearfix:after {  clear: both;}.hide-text {  font: 0/0 a;  color: transparent;  text-shadow: none;  background-color: transparent;  border: 0;}.input-block-level {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;}article,aside,details,figcaption,figure,footer,header,hgroup,nav,section {  display: block;}audio,canvas,video {  display: inline-block;  *display: inline;  *zoom: 1;}audio:not([controls]) {  display: none;}html {  font-size: 100%;  -webkit-text-size-adjust: 100%;  -ms-text-size-adjust: 100%;}a:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}a:hover,a:active {  outline: 0;}sub,sup {  position: relative;  font-size: 75%;  line-height: 0;  vertical-align: baseline;}sup {  top: -0.5em;}sub {  bottom: -0.25em;}img {  max-width: 100%;  vertical-align: middle;  border: 0;  -ms-interpolation-mode: bicubic;}#map_canvas img {  max-width: none;}button,input,select,textarea {  margin: 0;  font-size: 100%;  vertical-align: middle;}button,input {  *overflow: visible;  line-height: normal;}button::-moz-focus-inner,input::-moz-focus-inner {  padding: 0;  border: 0;}button,input[type="button"],input[type="reset"],input[type="submit"] {  cursor: pointer;  -webkit-appearance: button;}input[type="search"] {  -webkit-box-sizing: content-box;  -moz-box-sizing: content-box;  box-sizing: content-box;  -webkit-appearance: textfield;}input[type="search"]::-webkit-search-decoration,input[type="search"]::-webkit-search-cancel-button {  -webkit-appearance: none;}textarea {  overflow: auto;  vertical-align: top;}body {  margin: 0;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  line-height: 18px;  color: #333333;  background-color: #ffffff;}a {  color: #0088cc;  text-decoration: none;}a:hover {  color: #005580;  text-decoration: underline;}.row {  margin-left: -20px;  *zoom: 1;}.row:before,.row:after {  display: table;  content: "";}.row:after {  clear: both;}[class*="span"] {  float: left;  margin-left: 20px;}.container,.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.span12 {  width: 940px;}.span11 {  width: 860px;}.span10 {  width: 780px;}.span9 {  width: 700px;}.span8 {  width: 620px;}.span7 {  width: 540px;}.span6 {  width: 460px;}.span5 {  width: 380px;}.span4 {  width: 300px;}.span3 {  width: 220px;}.span2 {  width: 140px;}.span1 {  width: 60px;}.offset12 {  margin-left: 980px;}.offset11 {  margin-left: 900px;}.offset10 {  margin-left: 820px;}.offset9 {  margin-left: 740px;}.offset8 {  margin-left: 660px;}.offset7 {  margin-left: 580px;}.offset6 {  margin-left: 500px;}.offset5 {  margin-left: 420px;}.offset4 {  margin-left: 340px;}.offset3 {  margin-left: 260px;}.offset2 {  margin-left: 180px;}.offset1 {  margin-left: 100px;}.row-fluid {  width: 100%;  *zoom: 1;}.row-fluid:before,.row-fluid:after {  display: table;  content: "";}.row-fluid:after {  clear: both;}.row-fluid [class*="span"] {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  float: left;  margin-left: 2.127659574%;  *margin-left: 2.0744680846382977%;}.row-fluid [class*="span"]:first-child {  margin-left: 0;}.row-fluid .span12 {  width: 99.99999998999999%;  *width: 99.94680850063828%;}.row-fluid .span11 {  width: 91.489361693%;  *width: 91.4361702036383%;}.row-fluid .span10 {  width: 82.97872339599999%;  *width: 82.92553190663828%;}.row-fluid .span9 {  width: 74.468085099%;  *width: 74.4148936096383%;}.row-fluid .span8 {  width: 65.95744680199999%;  *width: 65.90425531263828%;}.row-fluid .span7 {  width: 57.446808505%;  *width: 57.3936170156383%;}.row-fluid .span6 {  width: 48.93617020799999%;  *width: 48.88297871863829%;}.row-fluid .span5 {  width: 40.425531911%;  *width: 40.3723404216383%;}.row-fluid .span4 {  width: 31.914893614%;  *width: 31.8617021246383%;}.row-fluid .span3 {  width: 23.404255317%;  *width: 23.3510638276383%;}.row-fluid .span2 {  width: 14.89361702%;  *width: 14.8404255306383%;}.row-fluid .span1 {  width: 6.382978723%;  *width: 6.329787233638298%;}.container {  margin-right: auto;  margin-left: auto;  *zoom: 1;}.container:before,.container:after {  display: table;  content: "";}.container:after {  clear: both;}.container-fluid {  padding-right: 20px;  padding-left: 20px;  *zoom: 1;}.container-fluid:before,.container-fluid:after {  display: table;  content: "";}.container-fluid:after {  clear: both;}p {  margin: 0 0 9px;}p small {  font-size: 11px;  color: #999999;}.lead {  margin-bottom: 18px;  font-size: 20px;  font-weight: 200;  line-height: 27px;}h1,h2,h3,h4,h5,h6 {  margin: 0;  font-family: inherit;  font-weight: bold;  color: inherit;  text-rendering: optimizelegibility;}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small {  font-weight: normal;  color: #999999;}h1 {  font-size: 30px;  line-height: 36px;}h1 small {  font-size: 18px;}h2 {  font-size: 24px;  line-height: 36px;}h2 small {  font-size: 18px;}h3 {  font-size: 18px;  line-height: 27px;}h3 small {  font-size: 14px;}h4,h5,h6 {  line-height: 18px;}h4 {  font-size: 14px;}h4 small {  font-size: 12px;}h5 {  font-size: 12px;}h6 {  font-size: 11px;  color: #999999;  text-transform: uppercase;}.page-header {  padding-bottom: 17px;  margin: 18px 0;  border-bottom: 1px solid #eeeeee;}.page-header h1 {  line-height: 1;}ul,ol {  padding: 0;  margin: 0 0 9px 25px;}ul ul,ul ol,ol ol,ol ul {  margin-bottom: 0;}ul {  list-style: disc;}ol {  list-style: decimal;}li {  line-height: 18px;}ul.unstyled,ol.unstyled {  margin-left: 0;  list-style: none;}dl {  margin-bottom: 18px;}dt,dd {  line-height: 18px;}dt {  font-weight: bold;  line-height: 17px;}dd {  margin-left: 9px;}.dl-horizontal dt {  float: left;  width: 120px;  clear: left;  text-align: right;  overflow: hidden;  text-overflow: ellipsis;  white-space: nowrap;}.dl-horizontal dd {  margin-left: 130px;}hr {  margin: 18px 0;  border: 0;  border-top: 1px solid #eeeeee;  border-bottom: 1px solid #ffffff;}strong {  font-weight: bold;}em {  font-style: italic;}.muted {  color: #999999;}abbr[title] {  cursor: help;  border-bottom: 1px dotted #999999;}abbr.initialism {  font-size: 90%;  text-transform: uppercase;}blockquote {  padding: 0 0 0 15px;  margin: 0 0 18px;  border-left: 5px solid #eeeeee;}blockquote p {  margin-bottom: 0;  font-size: 16px;  font-weight: 300;  line-height: 22.5px;}blockquote small {  display: block;  line-height: 18px;  color: #999999;}blockquote small:before {  content: '\2014 \00A0';}blockquote.pull-right {  float: right;  padding-right: 15px;  padding-left: 0;  border-right: 5px solid #eeeeee;  border-left: 0;}blockquote.pull-right p,blockquote.pull-right small {  text-align: right;}q:before,q:after,blockquote:before,blockquote:after {  content: "";}address {  display: block;  margin-bottom: 18px;  font-style: normal;  line-height: 18px;}small {  font-size: 100%;}cite {  font-style: normal;}code,pre {  padding: 0 3px 2px;  font-family: Menlo, Monaco, Consolas, "Courier New", monospace;  font-size: 12px;  color: #333333;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}code {  padding: 2px 4px;  color: #d14;  background-color: #f7f7f9;  border: 1px solid #e1e1e8;}pre {  display: block;  padding: 8.5px;  margin: 0 0 9px;  font-size: 12.025px;  line-height: 18px;  word-break: break-all;  word-wrap: break-word;  white-space: pre;  white-space: pre-wrap;  background-color: #f5f5f5;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.15);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}pre.prettyprint {  margin-bottom: 18px;}pre code {  padding: 0;  color: inherit;  background-color: transparent;  border: 0;}.pre-scrollable {  max-height: 340px;  overflow-y: scroll;}.label,.badge {  font-size: 10.998px;  font-weight: bold;  line-height: 14px;  color: #ffffff;  vertical-align: baseline;  white-space: nowrap;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #999999;}.label {  padding: 1px 4px 2px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.badge {  padding: 1px 9px 2px;  -webkit-border-radius: 9px;  -moz-border-radius: 9px;  border-radius: 9px;}a.label:hover,a.badge:hover {  color: #ffffff;  text-decoration: none;  cursor: pointer;}.label-important,.badge-important {  background-color: #b94a48;}.label-important[href],.badge-important[href] {  background-color: #953b39;}.label-warning,.badge-warning {  background-color: #f89406;}.label-warning[href],.badge-warning[href] {  background-color: #c67605;}.label-success,.badge-success {  background-color: #468847;}.label-success[href],.badge-success[href] {  background-color: #356635;}.label-info,.badge-info {  background-color: #3a87ad;}.label-info[href],.badge-info[href] {  background-color: #2d6987;}.label-inverse,.badge-inverse {  background-color: #333333;}.label-inverse[href],.badge-inverse[href] {  background-color: #1a1a1a;}table {  max-width: 100%;  background-color: transparent;  border-collapse: collapse;  border-spacing: 0;}.table {  width: 100%;  margin-bottom: 18px;}.table th,.table td {  padding: 8px;  line-height: 18px;  text-align: left;  vertical-align: top;  border-top: 1px solid #dddddd;}.table th {  font-weight: bold;}.table thead th {  vertical-align: bottom;}.table caption + thead tr:first-child th,.table caption + thead tr:first-child td,.table colgroup + thead tr:first-child th,.table colgroup + thead tr:first-child td,.table thead:first-child tr:first-child th,.table thead:first-child tr:first-child td {  border-top: 0;}.table tbody + tbody {  border-top: 2px solid #dddddd;}.table-condensed th,.table-condensed td {  padding: 4px 5px;}.table-bordered {  border: 1px solid #dddddd;  border-collapse: separate;  *border-collapse: collapsed;  border-left: 0;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.table-bordered th,.table-bordered td {  border-left: 1px solid #dddddd;}.table-bordered caption + thead tr:first-child th,.table-bordered caption + tbody tr:first-child th,.table-bordered caption + tbody tr:first-child td,.table-bordered colgroup + thead tr:first-child th,.table-bordered colgroup + tbody tr:first-child th,.table-bordered colgroup + tbody tr:first-child td,.table-bordered thead:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child td {  border-top: 0;}.table-bordered thead:first-child tr:first-child th:first-child,.table-bordered tbody:first-child tr:first-child td:first-child {  -webkit-border-top-left-radius: 4px;  border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;}.table-bordered thead:first-child tr:first-child th:last-child,.table-bordered tbody:first-child tr:first-child td:last-child {  -webkit-border-top-right-radius: 4px;  border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;}.table-bordered thead:last-child tr:last-child th:first-child,.table-bordered tbody:last-child tr:last-child td:first-child {  -webkit-border-radius: 0 0 0 4px;  -moz-border-radius: 0 0 0 4px;  border-radius: 0 0 0 4px;  -webkit-border-bottom-left-radius: 4px;  border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;}.table-bordered thead:last-child tr:last-child th:last-child,.table-bordered tbody:last-child tr:last-child td:last-child {  -webkit-border-bottom-right-radius: 4px;  border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;}.table-striped tbody tr:nth-child(odd) td,.table-striped tbody tr:nth-child(odd) th {  background-color: #f9f9f9;}.table tbody tr:hover td,.table tbody tr:hover th {  background-color: #f5f5f5;}table .span1 {  float: none;  width: 44px;  margin-left: 0;}table .span2 {  float: none;  width: 124px;  margin-left: 0;}table .span3 {  float: none;  width: 204px;  margin-left: 0;}table .span4 {  float: none;  width: 284px;  margin-left: 0;}table .span5 {  float: none;  width: 364px;  margin-left: 0;}table .span6 {  float: none;  width: 444px;  margin-left: 0;}table .span7 {  float: none;  width: 524px;  margin-left: 0;}table .span8 {  float: none;  width: 604px;  margin-left: 0;}table .span9 {  float: none;  width: 684px;  margin-left: 0;}table .span10 {  float: none;  width: 764px;  margin-left: 0;}table .span11 {  float: none;  width: 844px;  margin-left: 0;}table .span12 {  float: none;  width: 924px;  margin-left: 0;}table .span13 {  float: none;  width: 1004px;  margin-left: 0;}table .span14 {  float: none;  width: 1084px;  margin-left: 0;}table .span15 {  float: none;  width: 1164px;  margin-left: 0;}table .span16 {  float: none;  width: 1244px;  margin-left: 0;}table .span17 {  float: none;  width: 1324px;  margin-left: 0;}table .span18 {  float: none;  width: 1404px;  margin-left: 0;}table .span19 {  float: none;  width: 1484px;  margin-left: 0;}table .span20 {  float: none;  width: 1564px;  margin-left: 0;}table .span21 {  float: none;  width: 1644px;  margin-left: 0;}table .span22 {  float: none;  width: 1724px;  margin-left: 0;}table .span23 {  float: none;  width: 1804px;  margin-left: 0;}table .span24 {  float: none;  width: 1884px;  margin-left: 0;}form {  margin: 0 0 18px;}fieldset {  padding: 0;  margin: 0;  border: 0;}legend {  display: block;  width: 100%;  padding: 0;  margin-bottom: 27px;  font-size: 19.5px;  line-height: 36px;  color: #333333;  border: 0;  border-bottom: 1px solid #e5e5e5;}legend small {  font-size: 13.5px;  color: #999999;}.control-group .controls {    label,    input,    button,    select,    textarea {      font-size: 13px;      font-weight: normal;      line-height: 18px;    }}.control-group .controls {    input,    button,    select,    textarea {      font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;    }}label {  display: block;  margin-bottom: 5px;}.control-group .controls {    select,    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      display: inline-block;      height: 18px;      padding: 4px;      margin-bottom: 9px;      font-size: 13px;      line-height: 18px;      color: #555555;    }}.control-group .controls {    input,    textarea {      width: 210px;    }}.control-group .controls {    textarea {      height: auto;    }}.control-group .controls {    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      background-color: #ffffff;      border: 1px solid #cccccc;      -webkit-border-radius: 3px;      -moz-border-radius: 3px;      border-radius: 3px;      -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -webkit-transition: border linear 0.2s, box-shadow linear 0.2s;      -moz-transition: border linear 0.2s, box-shadow linear 0.2s;      -ms-transition: border linear 0.2s, box-shadow linear 0.2s;      -o-transition: border linear 0.2s, box-shadow linear 0.2s;      transition: border linear 0.2s, box-shadow linear 0.2s;    }}.control-group .controls {    textarea:focus,    input[type="text"]:focus,    input[type="password"]:focus,    input[type="datetime"]:focus,    input[type="datetime-local"]:focus,    input[type="date"]:focus,    input[type="month"]:focus,    input[type="time"]:focus,    input[type="week"]:focus,    input[type="number"]:focus,    input[type="email"]:focus,    input[type="url"]:focus,    input[type="search"]:focus,    input[type="tel"]:focus,    input[type="color"]:focus,    .uneditable-input:focus {      border-color: rgba(82, 168, 236, 0.8);      outline: 0;      outline: thin dotted \9;      /* IE6-9 */      -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      -moz-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);    }}.control-group .controls {    input[type="radio"],    input[type="checkbox"] {      margin: 3px 0;      *margin-top: 0;      /* IE7 */      line-height: normal;      cursor: pointer;    }}.control-group .controls {    input[type="submit"],    input[type="reset"],    input[type="button"],    input[type="radio"],    input[type="checkbox"] {      width: auto;    }}.uneditable-textarea {  width: auto;  height: auto;}.control-group .controls {    select,    input[type="file"] {      height: 28px;      /* In IE7, the height of the select element cannot be changed by height, only font-size */      *margin-top: 4px;      /* For IE7, add top margin to align select with labels */      line-height: 28px;    }}.control-group .controls {    select {      width: 220px;      border: 1px solid #bbb;    }}.control-group .controls {    select[multiple],    select[size] {      height: auto;    }}.control-group .controls {    select:focus,    input[type="file"]:focus,    input[type="radio"]:focus,    input[type="checkbox"]:focus {      outline: thin dotted #333;      outline: 5px auto -webkit-focus-ring-color;      outline-offset: -2px;    }}.radio,.checkbox {  min-height: 18px;  padding-left: 18px;}.radio input[type="radio"],.checkbox input[type="checkbox"] {  float: left;  margin-left: -18px;}.controls > .radio:first-child,.controls > .checkbox:first-child {  padding-top: 5px;}.radio.inline,.checkbox.inline {  display: inline-block;  padding-top: 5px;  margin-bottom: 0;  vertical-align: middle;}.radio.inline + .radio.inline,.checkbox.inline + .checkbox.inline {  margin-left: 10px;}.control-group .controls {    .input-mini {      width: 60px;    }}.control-group .controls {    .input-small {      width: 90px;    }}.control-group .controls {    .input-medium {      width: 150px;    }}.control-group .controls {    .input-large {      width: 210px;    }}.input-xlarge {    .input-xlarge {      width: 270px;    }}.input-xxlarge {    .input-xxlarge {      width: 530px;    }}.control-group .controls {    input[class*="span"],    select[class*="span"],    textarea[class*="span"],    .uneditable-input[class*="span"],    .row-fluid input[class*="span"],    .row-fluid select[class*="span"],    .row-fluid textarea[class*="span"],    .row-fluid .uneditable-input[class*="span"] {      float: none;      margin-left: 0;    }}.input-append input[class*="span"],.input-append .uneditable-input[class*="span"],.input-prepend input[class*="span"],.input-prepend .uneditable-input[class*="span"],.row-fluid .input-prepend [class*="span"],.row-fluid .input-append [class*="span"] {  display: inline-block;}.control-group .controls {    input,    textarea,    .uneditable-input {      margin-left: 0;    }}input.span12, textarea.span12, .uneditable-input.span12 {  width: 930px;}input.span11, textarea.span11, .uneditable-input.span11 {  width: 850px;}input.span10, textarea.span10, .uneditable-input.span10 {  width: 770px;}input.span9, textarea.span9, .uneditable-input.span9 {  width: 690px;}input.span8, textarea.span8, .uneditable-input.span8 {  width: 610px;}input.span7, textarea.span7, .uneditable-input.span7 {  width: 530px;}input.span6, textarea.span6, .uneditable-input.span6 {  width: 450px;}input.span5, textarea.span5, .uneditable-input.span5 {  width: 370px;}input.span4, textarea.span4, .uneditable-input.span4 {  width: 290px;}input.span3, textarea.span3, .uneditable-input.span3 {  width: 210px;}input.span2, textarea.span2, .uneditable-input.span2 {  width: 130px;}input.span1, textarea.span1, .uneditable-input.span1 {  width: 50px;}input[disabled],select[disabled],textarea[disabled],input[readonly],select[readonly],textarea[readonly] {  cursor: not-allowed;  background-color: #eeeeee;  border-color: #ddd;}input[type="radio"][disabled],input[type="checkbox"][disabled],input[type="radio"][readonly],input[type="checkbox"][readonly] {  background-color: transparent;}.control-group.warning > label,.control-group.warning .help-block,.control-group.warning .help-inline {  color: #c09853;}.control-group.warning .checkbox,.control-group.warning .radio,.control-group.warning input,.control-group.warning select,.control-group.warning textarea {  color: #c09853;  border-color: #c09853;}.control-group.warning .checkbox:focus,.control-group.warning .radio:focus,.control-group.warning input:focus,.control-group.warning select:focus,.control-group.warning textarea:focus {  border-color: #a47e3c;  -webkit-box-shadow: 0 0 6px #dbc59e;  -moz-box-shadow: 0 0 6px #dbc59e;  box-shadow: 0 0 6px #dbc59e;}.control-group.warning .input-prepend .add-on,.control-group.warning .input-append .add-on {  color: #c09853;  background-color: #fcf8e3;  border-color: #c09853;}.control-group.error > label,.control-group.error .help-block,.control-group.error .help-inline {  color: #b94a48;}.control-group.error .checkbox,.control-group.error .radio,.control-group.error input,.control-group.error select,.control-group.error textarea {  color: #b94a48;  border-color: #b94a48;}.control-group.error .checkbox:focus,.control-group.error .radio:focus,.control-group.error input:focus,.control-group.error select:focus,.control-group.error textarea:focus {  border-color: #953b39;  -webkit-box-shadow: 0 0 6px #d59392;  -moz-box-shadow: 0 0 6px #d59392;  box-shadow: 0 0 6px #d59392;}.control-group.error .input-prepend .add-on,.control-group.error .input-append .add-on {  color: #b94a48;  background-color: #f2dede;  border-color: #b94a48;}.control-group.success > label,.control-group.success .help-block,.control-group.success .help-inline {  color: #468847;}.control-group.success .checkbox,.control-group.success .radio,.control-group.success input,.control-group.success select,.control-group.success textarea {  color: #468847;  border-color: #468847;}.control-group.success .checkbox:focus,.control-group.success .radio:focus,.control-group.success input:focus,.control-group.success select:focus,.control-group.success textarea:focus {  border-color: #356635;  -webkit-box-shadow: 0 0 6px #7aba7b;  -moz-box-shadow: 0 0 6px #7aba7b;  box-shadow: 0 0 6px #7aba7b;}.control-group.success .input-prepend .add-on,.control-group.success .input-append .add-on {  color: #468847;  background-color: #dff0d8;  border-color: #468847;}input:focus:required:invalid,textarea:focus:required:invalid,select:focus:required:invalid {  color: #b94a48;  border-color: #ee5f5b;}input:focus:required:invalid:focus,textarea:focus:required:invalid:focus,select:focus:required:invalid:focus {  border-color: #e9322d;  -webkit-box-shadow: 0 0 6px #f8b9b7;  -moz-box-shadow: 0 0 6px #f8b9b7;  box-shadow: 0 0 6px #f8b9b7;}.form-actions {  padding: 17px 20px 18px;  margin-top: 18px;  margin-bottom: 18px;  background-color: #f5f5f5;  border-top: 1px solid #e5e5e5;  *zoom: 1;}.form-actions:before,.form-actions:after {  display: table;  content: "";}.form-actions:after {  clear: both;}.uneditable-input {  overflow: hidden;  white-space: nowrap;  cursor: not-allowed;  background-color: #ffffff;  border-color: #eee;  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);}:-moz-placeholder {  color: #999999;}:-ms-input-placeholder {  color: #999999;}::-webkit-input-placeholder {  color: #999999;}.help-block,.help-inline {  color: #555555;}.help-block {  display: block;  margin-bottom: 9px;}.help-inline {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  vertical-align: middle;  padding-left: 5px;}.input-prepend,.input-append {  margin-bottom: 5px;}.input-prepend input,.input-append input,.input-prepend select,.input-append select,.input-prepend .uneditable-input,.input-append .uneditable-input {  position: relative;  margin-bottom: 0;  *margin-left: 0;  vertical-align: middle;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend input:focus,.input-append input:focus,.input-prepend select:focus,.input-append select:focus,.input-prepend .uneditable-input:focus,.input-append .uneditable-input:focus {  z-index: 2;}.input-prepend .uneditable-input,.input-append .uneditable-input {  border-left-color: #ccc;}.input-prepend .add-on,.input-append .add-on {  display: inline-block;  width: auto;  height: 18px;  min-width: 16px;  padding: 4px 5px;  font-weight: normal;  line-height: 18px;  text-align: center;  text-shadow: 0 1px 0 #ffffff;  vertical-align: middle;  background-color: #eeeeee;  border: 1px solid #ccc;}.input-prepend .add-on,.input-append .add-on,.input-prepend .btn,.input-append .btn {  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend .active,.input-append .active {  background-color: #a9dba9;  border-color: #46a546;}.input-prepend .add-on,.input-prepend .btn {  margin-right: -1px;}.input-prepend .add-on:first-child,.input-prepend .btn:first-child {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append input,.input-append select,.input-append .uneditable-input {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append .uneditable-input {  border-right-color: #ccc;  border-left-color: #eee;}.input-append .add-on:last-child,.input-append .btn:last-child {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend.input-append input,.input-prepend.input-append select,.input-prepend.input-append .uneditable-input {  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend.input-append .add-on:first-child,.input-prepend.input-append .btn:first-child {  margin-right: -1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-prepend.input-append .add-on:last-child,.input-prepend.input-append .btn:last-child {  margin-left: -1px;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.search-query {  padding-right: 14px;  padding-right: 4px \9;  padding-left: 14px;  padding-left: 4px \9;  /* IE7-8 doesn't have border-radius, so don't indent the padding */  margin-bottom: 0;  -webkit-border-radius: 14px;  -moz-border-radius: 14px;  border-radius: 14px;}.form-search input,.form-inline input,.form-horizontal input,.form-search textarea,.form-inline textarea,.form-horizontal textarea,.form-search select,.form-inline select,.form-horizontal select,.form-search .help-inline,.form-inline .help-inline,.form-horizontal .help-inline,.form-search .uneditable-input,.form-inline .uneditable-input,.form-horizontal .uneditable-input,.form-search .input-prepend,.form-inline .input-prepend,.form-horizontal .input-prepend,.form-search .input-append,.form-inline .input-append,.form-horizontal .input-append {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-bottom: 0;}.form-search .hide,.form-inline .hide,.form-horizontal .hide {  display: none;}.form-search label,.form-inline label {  display: inline-block;}.form-search .input-append,.form-inline .input-append,.form-search .input-prepend,.form-inline .input-prepend {  margin-bottom: 0;}.form-search .radio,.form-search .checkbox,.form-inline .radio,.form-inline .checkbox {  padding-left: 0;  margin-bottom: 0;  vertical-align: middle;}.form-search .radio input[type="radio"],.form-search .checkbox input[type="checkbox"],.form-inline .radio input[type="radio"],.form-inline .checkbox input[type="checkbox"] {  float: left;  margin-right: 3px;  margin-left: 0;}.control-group {  margin-bottom: 9px;}legend + .control-group {  margin-top: 18px;  -webkit-margin-top-collapse: separate;}.form-horizontal .control-group {  margin-bottom: 18px;  *zoom: 1;}.form-horizontal .control-group:before,.form-horizontal .control-group:after {  display: table;  content: "";}.form-horizontal .control-group:after {  clear: both;}.form-horizontal .control-label {  float: left;  width: 140px;  padding-top: 5px;  text-align: right;}.form-horizontal .controls {  *display: inline-block;  *padding-left: 20px;  margin-left: 160px;  *margin-left: 0;}.form-horizontal .controls:first-child {  *padding-left: 160px;}.form-horizontal .help-block {  margin-top: 9px;  margin-bottom: 0;}.form-horizontal .form-actions {  padding-left: 160px;}.btn {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  padding: 4px 10px 4px;  margin-bottom: 0;  font-size: 13px;  line-height: 18px;  *line-height: 20px;  color: #333333;  text-align: center;  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);  vertical-align: middle;  cursor: pointer;  background-color: #f5f5f5;  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);  background-image: linear-gradient(top, #ffffff, #e6e6e6);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);  border-color: #e6e6e6 #e6e6e6 #bfbfbf;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #e6e6e6;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  border: 1px solid #cccccc;  *border: 0;  border-bottom-color: #b3b3b3;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  *margin-left: .3em;  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);}.btn:hover,.btn:active,.btn.active,.btn.disabled,.btn[disabled] {  background-color: #e6e6e6;  *background-color: #d9d9d9;}.btn:active,.btn.active {  background-color: #cccccc \9;}.btn:first-child {  *margin-left: 0;}.btn:hover {  color: #333333;  text-decoration: none;  background-color: #e6e6e6;  *background-color: #d9d9d9;  /* Buttons in IE7 don't get borders, so darken on hover */  background-position: 0 -15px;  -webkit-transition: background-position 0.1s linear;  -moz-transition: background-position 0.1s linear;  -ms-transition: background-position 0.1s linear;  -o-transition: background-position 0.1s linear;  transition: background-position 0.1s linear;}.btn:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}.btn.active,.btn:active {  background-color: #e6e6e6;  background-color: #d9d9d9 \9;  background-image: none;  outline: 0;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn.disabled,.btn[disabled] {  cursor: default;  background-color: #e6e6e6;  background-image: none;  opacity: 0.65;  filter: alpha(opacity=65);  -webkit-box-shadow: none;  -moz-box-shadow: none;  box-shadow: none;}.btn-large {  padding: 9px 14px;  font-size: 15px;  line-height: normal;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.btn-large [class^="icon-"] {  margin-top: 1px;}.btn-small {  padding: 5px 9px;  font-size: 11px;  line-height: 16px;}.btn-small [class^="icon-"] {  margin-top: -1px;}.btn-mini {  padding: 2px 6px;  font-size: 11px;  line-height: 14px;}.btn-primary,.btn-primary:hover,.btn-warning,.btn-warning:hover,.btn-danger,.btn-danger:hover,.btn-success,.btn-success:hover,.btn-info,.btn-info:hover,.btn-inverse,.btn-inverse:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.btn-primary.active,.btn-warning.active,.btn-danger.active,.btn-success.active,.btn-info.active,.btn-inverse.active {  color: rgba(255, 255, 255, 0.75);}.btn {  border-color: #ccc;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);}.btn-primary {  background-color: #0074cc;  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);  background-image: -o-linear-gradient(top, #0088cc, #0055cc);  background-image: linear-gradient(top, #0088cc, #0055cc);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);  border-color: #0055cc #0055cc #003580;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #0055cc;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-primary:hover,.btn-primary:active,.btn-primary.active,.btn-primary.disabled,.btn-primary[disabled] {  background-color: #0055cc;  *background-color: #004ab3;}.btn-primary:active,.btn-primary.active {  background-color: #004099 \9;}.btn-warning {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);  border-color: #f89406 #f89406 #ad6704;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #f89406;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-warning:hover,.btn-warning:active,.btn-warning.active,.btn-warning.disabled,.btn-warning[disabled] {  background-color: #f89406;  *background-color: #df8505;}.btn-warning:active,.btn-warning.active {  background-color: #c67605 \9;}.btn-danger {  background-color: #da4f49;  background-image: -moz-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -ms-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#bd362f));  background-image: -webkit-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -o-linear-gradient(top, #ee5f5b, #bd362f);  background-image: linear-gradient(top, #ee5f5b, #bd362f);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#bd362f', GradientType=0);  border-color: #bd362f #bd362f #802420;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #bd362f;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-danger:hover,.btn-danger:active,.btn-danger.active,.btn-danger.disabled,.btn-danger[disabled] {  background-color: #bd362f;  *background-color: #a9302a;}.btn-danger:active,.btn-danger.active {  background-color: #942a25 \9;}.btn-success {  background-color: #5bb75b;  background-image: -moz-linear-gradient(top, #62c462, #51a351);  background-image: -ms-linear-gradient(top, #62c462, #51a351);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));  background-image: -webkit-linear-gradient(top, #62c462, #51a351);  background-image: -o-linear-gradient(top, #62c462, #51a351);  background-image: linear-gradient(top, #62c462, #51a351);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);  border-color: #51a351 #51a351 #387038;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #51a351;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-success:hover,.btn-success:active,.btn-success.active,.btn-success.disabled,.btn-success[disabled] {  background-color: #51a351;  *background-color: #499249;}.btn-success:active,.btn-success.active {  background-color: #408140 \9;}.btn-info {  background-color: #49afcd;  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);  background-image: linear-gradient(top, #5bc0de, #2f96b4);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);  border-color: #2f96b4 #2f96b4 #1f6377;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #2f96b4;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-info:hover,.btn-info:active,.btn-info.active,.btn-info.disabled,.btn-info[disabled] {  background-color: #2f96b4;  *background-color: #2a85a0;}.btn-info:active,.btn-info.active {  background-color: #24748c \9;}.btn-inverse {  background-color: #414141;  background-image: -moz-linear-gradient(top, #555555, #222222);  background-image: -ms-linear-gradient(top, #555555, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#555555), to(#222222));  background-image: -webkit-linear-gradient(top, #555555, #222222);  background-image: -o-linear-gradient(top, #555555, #222222);  background-image: linear-gradient(top, #555555, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#555555', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-inverse:hover,.btn-inverse:active,.btn-inverse.active,.btn-inverse.disabled,.btn-inverse[disabled] {  background-color: #222222;  *background-color: #151515;}.btn-inverse:active,.btn-inverse.active {  background-color: #080808 \9;}button.btn,input[type="submit"].btn {  *padding-top: 2px;  *padding-bottom: 2px;}button.btn::-moz-focus-inner,input[type="submit"].btn::-moz-focus-inner {  padding: 0;  border: 0;}button.btn.btn-large,input[type="submit"].btn.btn-large {  *padding-top: 7px;  *padding-bottom: 7px;}button.btn.btn-small,input[type="submit"].btn.btn-small {  *padding-top: 3px;  *padding-bottom: 3px;}button.btn.btn-mini,input[type="submit"].btn.btn-mini {  *padding-top: 1px;  *padding-bottom: 1px;}.btn-group {  position: relative;  *zoom: 1;  *margin-left: .3em;}.btn-group:before,.btn-group:after {  display: table;  content: "";}.btn-group:after {  clear: both;}.btn-group:first-child {  *margin-left: 0;}.btn-group + .btn-group {  margin-left: 5px;}.btn-toolbar {  margin-top: 9px;  margin-bottom: 9px;}.btn-toolbar .btn-group {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;}.btn-group > .btn {  position: relative;  float: left;  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.btn-group > .btn:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;  border-top-left-radius: 4px;  -webkit-border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;  border-bottom-left-radius: 4px;}.btn-group > .btn:last-child,.btn-group > .dropdown-toggle {  -webkit-border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;  border-top-right-radius: 4px;  -webkit-border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;  border-bottom-right-radius: 4px;}.btn-group > .btn.large:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 6px;  -moz-border-radius-topleft: 6px;  border-top-left-radius: 6px;  -webkit-border-bottom-left-radius: 6px;  -moz-border-radius-bottomleft: 6px;  border-bottom-left-radius: 6px;}.btn-group > .btn.large:last-child,.btn-group > .large.dropdown-toggle {  -webkit-border-top-right-radius: 6px;  -moz-border-radius-topright: 6px;  border-top-right-radius: 6px;  -webkit-border-bottom-right-radius: 6px;  -moz-border-radius-bottomright: 6px;  border-bottom-right-radius: 6px;}.btn-group > .btn:hover,.btn-group > .btn:focus,.btn-group > .btn:active,.btn-group > .btn.active {  z-index: 2;}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle {  outline: 0;}.btn-group > .dropdown-toggle {  padding-left: 8px;  padding-right: 8px;  -webkit-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-mini.dropdown-toggle {  padding-left: 5px;  padding-right: 5px;}.btn-group > .btn-small.dropdown-toggle {  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-large.dropdown-toggle {  padding-left: 12px;  padding-right: 12px;}.btn-group.open .dropdown-toggle {  background-image: none;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn-group.open .btn.dropdown-toggle {  background-color: #e6e6e6;}.btn-group.open .btn-primary.dropdown-toggle {  background-color: #0055cc;}.btn-group.open .btn-warning.dropdown-toggle {  background-color: #f89406;}.btn-group.open .btn-danger.dropdown-toggle {  background-color: #bd362f;}.btn-group.open .btn-success.dropdown-toggle {  background-color: #51a351;}.btn-group.open .btn-info.dropdown-toggle {  background-color: #2f96b4;}.btn-group.open .btn-inverse.dropdown-toggle {  background-color: #222222;}.btn .caret {  margin-top: 7px;  margin-left: 0;}.btn:hover .caret,.open.btn-group .caret {  opacity: 1;  filter: alpha(opacity=100);}.btn-mini .caret {  margin-top: 5px;}.btn-small .caret {  margin-top: 6px;}.btn-large .caret {  margin-top: 6px;  border-left-width: 5px;  border-right-width: 5px;  border-top-width: 5px;}.dropup .btn-large .caret {  border-bottom: 5px solid #000000;  border-top: 0;}.btn-primary .caret,.btn-warning .caret,.btn-danger .caret,.btn-info .caret,.btn-success .caret,.btn-inverse .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 0.75;  filter: alpha(opacity=75);}.nav {  margin-left: 0;  margin-bottom: 18px;  list-style: none;}.nav > li > a {  display: block;}.nav > li > a:hover {  text-decoration: none;  background-color: #eeeeee;}.nav > .pull-right {  float: right;}.nav .nav-header {  display: block;  padding: 3px 15px;  font-size: 11px;  font-weight: bold;  line-height: 18px;  color: #999999;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  text-transform: uppercase;}.nav li + .nav-header {  margin-top: 9px;}.nav-list {  padding-left: 15px;  padding-right: 15px;  margin-bottom: 0;}.nav-list > li > a,.nav-list .nav-header {  margin-left: -15px;  margin-right: -15px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);}.nav-list > li > a {  padding: 3px 15px;}.nav-list > .active > a,.nav-list > .active > a:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.2);  background-color: #0088cc;}.nav-list [class^="icon-"] {  margin-right: 2px;}.nav-list .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.nav-tabs,.nav-pills {  *zoom: 1;}.nav-tabs:before,.nav-pills:before,.nav-tabs:after,.nav-pills:after {  display: table;  content: "";}.nav-tabs:after,.nav-pills:after {  clear: both;}.nav-tabs > li,.nav-pills > li {  float: left;}.nav-tabs > li > a,.nav-pills > li > a {  padding-right: 12px;  padding-left: 12px;  margin-right: 2px;  line-height: 14px;}.nav-tabs {  border-bottom: 1px solid #ddd;}.nav-tabs > li {  margin-bottom: -1px;}.nav-tabs > li > a {  padding-top: 8px;  padding-bottom: 8px;  line-height: 18px;  border: 1px solid transparent;  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #dddddd;}.nav-tabs > .active > a,.nav-tabs > .active > a:hover {  color: #555555;  background-color: #ffffff;  border: 1px solid #ddd;  border-bottom-color: transparent;  cursor: default;}.nav-pills > li > a {  padding-top: 8px;  padding-bottom: 8px;  margin-top: 2px;  margin-bottom: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.nav-pills > .active > a,.nav-pills > .active > a:hover {  color: #ffffff;  background-color: #0088cc;}.nav-stacked > li {  float: none;}.nav-stacked > li > a {  margin-right: 0;}.nav-tabs.nav-stacked {  border-bottom: 0;}.nav-tabs.nav-stacked > li > a {  border: 1px solid #ddd;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.nav-tabs.nav-stacked > li:first-child > a {  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs.nav-stacked > li:last-child > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.nav-tabs.nav-stacked > li > a:hover {  border-color: #ddd;  z-index: 2;}.nav-pills.nav-stacked > li > a {  margin-bottom: 3px;}.nav-pills.nav-stacked > li:last-child > a {  margin-bottom: 1px;}.nav-tabs .dropdown-menu {  -webkit-border-radius: 0 0 5px 5px;  -moz-border-radius: 0 0 5px 5px;  border-radius: 0 0 5px 5px;}.nav-pills .dropdown-menu {  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.nav-tabs .dropdown-toggle .caret,.nav-pills .dropdown-toggle .caret {  border-top-color: #0088cc;  border-bottom-color: #0088cc;  margin-top: 6px;}.nav-tabs .dropdown-toggle:hover .caret,.nav-pills .dropdown-toggle:hover .caret {  border-top-color: #005580;  border-bottom-color: #005580;}.nav-tabs .active .dropdown-toggle .caret,.nav-pills .active .dropdown-toggle .caret {  border-top-color: #333333;  border-bottom-color: #333333;}.nav > .dropdown.active > a:hover {  color: #000000;  cursor: pointer;}.nav-tabs .open .dropdown-toggle,.nav-pills .open .dropdown-toggle,.nav > li.dropdown.open.active > a:hover {  color: #ffffff;  background-color: #999999;  border-color: #999999;}.nav li.dropdown.open .caret,.nav li.dropdown.open.active .caret,.nav li.dropdown.open a:hover .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 1;  filter: alpha(opacity=100);}.tabs-stacked .open > a:hover {  border-color: #999999;}.tabbable {  *zoom: 1;}.tabbable:before,.tabbable:after {  display: table;  content: "";}.tabbable:after {  clear: both;}.tab-content {  overflow: auto;}.tabs-below > .nav-tabs,.tabs-right > .nav-tabs,.tabs-left > .nav-tabs {  border-bottom: 0;}.tab-content > .tab-pane,.pill-content > .pill-pane {  display: none;}.tab-content > .active,.pill-content > .active {  display: block;}.tabs-below > .nav-tabs {  border-top: 1px solid #ddd;}.tabs-below > .nav-tabs > li {  margin-top: -1px;  margin-bottom: 0;}.tabs-below > .nav-tabs > li > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.tabs-below > .nav-tabs > li > a:hover {  border-bottom-color: transparent;  border-top-color: #ddd;}.tabs-below > .nav-tabs > .active > a,.tabs-below > .nav-tabs > .active > a:hover {  border-color: transparent #ddd #ddd #ddd;}.tabs-left > .nav-tabs > li,.tabs-right > .nav-tabs > li {  float: none;}.tabs-left > .nav-tabs > li > a,.tabs-right > .nav-tabs > li > a {  min-width: 74px;  margin-right: 0;  margin-bottom: 3px;}.tabs-left > .nav-tabs {  float: left;  margin-right: 19px;  border-right: 1px solid #ddd;}.tabs-left > .nav-tabs > li > a {  margin-right: -1px;  -webkit-border-radius: 4px 0 0 4px;  -moz-border-radius: 4px 0 0 4px;  border-radius: 4px 0 0 4px;}.tabs-left > .nav-tabs > li > a:hover {  border-color: #eeeeee #dddddd #eeeeee #eeeeee;}.tabs-left > .nav-tabs .active > a,.tabs-left > .nav-tabs .active > a:hover {  border-color: #ddd transparent #ddd #ddd;  *border-right-color: #ffffff;}.tabs-right > .nav-tabs {  float: right;  margin-left: 19px;  border-left: 1px solid #ddd;}.tabs-right > .nav-tabs > li > a {  margin-left: -1px;  -webkit-border-radius: 0 4px 4px 0;  -moz-border-radius: 0 4px 4px 0;  border-radius: 0 4px 4px 0;}.tabs-right > .nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #eeeeee #dddddd;}.tabs-right > .nav-tabs .active > a,.tabs-right > .nav-tabs .active > a:hover {  border-color: #ddd #ddd #ddd transparent;  *border-left-color: #ffffff;}.navbar {  *position: relative;  *z-index: 2;  overflow: visible;  margin-bottom: 18px;}.navbar-inner {  min-height: 40px;  padding-left: 20px;  padding-right: 20px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  -moz-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);}.navbar .container {  width: auto;}.nav-collapse.collapse {  height: auto;}.navbar {  color: #999999;}.navbar .brand:hover {  text-decoration: none;}.navbar .brand {  float: left;  display: block;  padding: 8px 20px 12px;  margin-left: -20px;  font-size: 20px;  font-weight: 200;  line-height: 1;  color: #999999;}.navbar .navbar-text {  margin-bottom: 0;  line-height: 40px;}.navbar .navbar-link {  color: #999999;}.navbar .navbar-link:hover {  color: #ffffff;}.navbar .btn,.navbar .btn-group {  margin-top: 5px;}.navbar .btn-group .btn {  margin: 0;}.navbar-form {  margin-bottom: 0;  *zoom: 1;}.navbar-form:before,.navbar-form:after {  display: table;  content: "";}.navbar-form:after {  clear: both;}.navbar-form input,.navbar-form select,.navbar-form .radio,.navbar-form .checkbox {  margin-top: 5px;}.navbar-form input,.navbar-form select {  display: inline-block;  margin-bottom: 0;}.navbar-form input[type="image"],.navbar-form input[type="checkbox"],.navbar-form input[type="radio"] {  margin-top: 3px;}.navbar-form .input-append,.navbar-form .input-prepend {  margin-top: 6px;  white-space: nowrap;}.navbar-form .input-append input,.navbar-form .input-prepend input {  margin-top: 0;}.navbar-search {  position: relative;  float: left;  margin-top: 6px;  margin-bottom: 0;}.navbar-search .search-query {  padding: 4px 9px;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  font-weight: normal;  line-height: 1;  color: #ffffff;  background-color: #626262;  border: 1px solid #151515;  -webkit-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -moz-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -webkit-transition: none;  -moz-transition: none;  -ms-transition: none;  -o-transition: none;  transition: none;}.navbar-search .search-query:-moz-placeholder {  color: #cccccc;}.navbar-search .search-query:-ms-input-placeholder {  color: #cccccc;}.navbar-search .search-query::-webkit-input-placeholder {  color: #cccccc;}.navbar-search .search-query:focus,.navbar-search .search-query.focused {  padding: 5px 10px;  color: #333333;  text-shadow: 0 1px 0 #ffffff;  background-color: #ffffff;  border: 0;  -webkit-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  -moz-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  outline: 0;}.navbar-fixed-top,.navbar-fixed-bottom {  position: fixed;  right: 0;  left: 0;  z-index: 1030;  margin-bottom: 0;}.navbar-fixed-top .navbar-inner,.navbar-fixed-bottom .navbar-inner {  padding-left: 0;  padding-right: 0;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.navbar-fixed-top {  top: 0;}.navbar-fixed-bottom {  bottom: 0;}.navbar .nav {  position: relative;  left: 0;  display: block;  float: left;  margin: 0 10px 0 0;}.navbar .nav.pull-right {  float: right;}.navbar .nav > li {  display: block;  float: left;}.navbar .nav > li > a {  float: none;  padding: 9px 10px 11px;  line-height: 19px;  color: #999999;  text-decoration: none;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.navbar .btn {  display: inline-block;  padding: 4px 10px 4px;  margin: 5px 5px 6px;  line-height: 18px;}.navbar .btn-group {  margin: 0;  padding: 5px 5px 6px;}.navbar .nav > li > a:hover {  background-color: transparent;  color: #ffffff;  text-decoration: none;}.navbar .nav .active > a,.navbar .nav .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #222222;}.navbar .divider-vertical {  height: 40px;  width: 1px;  margin: 0 9px;  overflow: hidden;  background-color: #222222;  border-right: 1px solid #333333;}.navbar .nav.pull-right {  margin-left: 10px;  margin-right: 0;}.navbar .btn-navbar {  display: none;  float: right;  padding: 7px 10px;  margin-left: 5px;  margin-right: 5px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);}.navbar .btn-navbar:hover,.navbar .btn-navbar:active,.navbar .btn-navbar.active,.navbar .btn-navbar.disabled,.navbar .btn-navbar[disabled] {  background-color: #222222;  *background-color: #151515;}.navbar .btn-navbar:active,.navbar .btn-navbar.active {  background-color: #080808 \9;}.navbar .btn-navbar .icon-bar {  display: block;  width: 18px;  height: 2px;  background-color: #f5f5f5;  -webkit-border-radius: 1px;  -moz-border-radius: 1px;  border-radius: 1px;  -webkit-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  -moz-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);}.btn-navbar .icon-bar + .icon-bar {  margin-top: 3px;}.navbar .dropdown-menu:before {  content: '';  display: inline-block;  border-left: 7px solid transparent;  border-right: 7px solid transparent;  border-bottom: 7px solid #ccc;  border-bottom-color: rgba(0, 0, 0, 0.2);  position: absolute;  top: -7px;  left: 9px;}.navbar .dropdown-menu:after {  content: '';  display: inline-block;  border-left: 6px solid transparent;  border-right: 6px solid transparent;  border-bottom: 6px solid #ffffff;  position: absolute;  top: -6px;  left: 10px;}.navbar-fixed-bottom .dropdown-menu:before {  border-top: 7px solid #ccc;  border-top-color: rgba(0, 0, 0, 0.2);  border-bottom: 0;  bottom: -7px;  top: auto;}.navbar-fixed-bottom .dropdown-menu:after {  border-top: 6px solid #ffffff;  border-bottom: 0;  bottom: -6px;  top: auto;}.navbar .nav li.dropdown .dropdown-toggle .caret,.navbar .nav li.dropdown.open .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;}.navbar .nav li.dropdown.active .caret {  opacity: 1;  filter: alpha(opacity=100);}.navbar .nav li.dropdown.open > .dropdown-toggle,.navbar .nav li.dropdown.active > .dropdown-toggle,.navbar .nav li.dropdown.open.active > .dropdown-toggle {  background-color: transparent;}.navbar .nav li.dropdown.active > .dropdown-toggle:hover {  color: #ffffff;}.navbar .pull-right .dropdown-menu,.navbar .dropdown-menu.pull-right {  left: auto;  right: 0;}.navbar .pull-right .dropdown-menu:before,.navbar .dropdown-menu.pull-right:before {  left: auto;  right: 12px;}.navbar .pull-right .dropdown-menu:after,.navbar .dropdown-menu.pull-right:after {  left: auto;  right: 13px;}.breadcrumb {  padding: 7px 14px;  margin: 0 0 18px;  list-style: none;  background-color: #fbfbfb;  background-image: -moz-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -ms-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#f5f5f5));  background-image: -webkit-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -o-linear-gradient(top, #ffffff, #f5f5f5);  background-image: linear-gradient(top, #ffffff, #f5f5f5);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#f5f5f5', GradientType=0);  border: 1px solid #ddd;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;}.breadcrumb li {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  text-shadow: 0 1px 0 #ffffff;}.breadcrumb .divider {  padding: 0 5px;  color: #999999;}.breadcrumb .active a {  color: #333333;}.pagination {  height: 36px;  margin: 18px 0;}.pagination ul {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-left: 0;  margin-bottom: 0;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  -moz-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);}.pagination li {  display: inline;}.pagination a {  float: left;  padding: 0 14px;  line-height: 34px;  text-decoration: none;  border: 1px solid #ddd;  border-left-width: 0;}.pagination a:hover,.pagination .active a {  background-color: #f5f5f5;}.pagination .active a {  color: #999999;  cursor: default;}.pagination .disabled span,.pagination .disabled a,.pagination .disabled a:hover {  color: #999999;  background-color: transparent;  cursor: default;}.pagination li:first-child a {  border-left-width: 1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.pagination li:last-child a {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.pagination-centered {  text-align: center;}.pagination-right {  text-align: right;}.pager {  margin-left: 0;  margin-bottom: 18px;  list-style: none;  text-align: center;  *zoom: 1;}.pager:before,.pager:after {  display: table;  content: "";}.pager:after {  clear: both;}.pager li {  display: inline;}.pager a {  display: inline-block;  padding: 5px 14px;  background-color: #fff;  border: 1px solid #ddd;  -webkit-border-radius: 15px;  -moz-border-radius: 15px;  border-radius: 15px;}.pager a:hover {  text-decoration: none;  background-color: #f5f5f5;}.pager .next a {  float: right;}.pager .previous a {  float: left;}.pager .disabled a,.pager .disabled a:hover {  color: #999999;  background-color: #fff;  cursor: default;}.thumbnails {  margin-left: -20px;  list-style: none;  *zoom: 1;}.thumbnails:before,.thumbnails:after {  display: table;  content: "";}.thumbnails:after {  clear: both;}.row-fluid .thumbnails {  margin-left: 0;}.thumbnails > li {  float: left;  margin-bottom: 18px;  margin-left: 20px;}.thumbnail {  display: block;  padding: 4px;  line-height: 1;  border: 1px solid #ddd;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  -moz-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);}a.thumbnail:hover {  border-color: #0088cc;  -webkit-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  -moz-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);}.thumbnail > img {  display: block;  max-width: 100%;  margin-left: auto;  margin-right: auto;}.thumbnail .caption {  padding: 9px;}.alert {  padding: 8px 35px 8px 14px;  margin-bottom: 18px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  background-color: #fcf8e3;  border: 1px solid #fbeed5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  color: #c09853;}.alert-heading {  color: inherit;}.alert .close {  position: relative;  top: -2px;  right: -21px;  line-height: 18px;}.alert-success {  background-color: #dff0d8;  border-color: #d6e9c6;  color: #468847;}.alert-danger,.alert-error {  background-color: #f2dede;  border-color: #eed3d7;  color: #b94a48;}.alert-info {  background-color: #d9edf7;  border-color: #bce8f1;  color: #3a87ad;}.alert-block {  padding-top: 14px;  padding-bottom: 14px;}.alert-block > p,.alert-block > ul {  margin-bottom: 0;}.alert-block p + p {  margin-top: 5px;}@-webkit-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-moz-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-ms-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-o-keyframes progress-bar-stripes {  from {    background-position: 0 0;  }  to {    background-position: 40px 0;  }}@keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}.progress {  overflow: hidden;  height: 18px;  margin-bottom: 18px;  background-color: #f7f7f7;  background-image: -moz-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -ms-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#f5f5f5), to(#f9f9f9));  background-image: -webkit-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -o-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: linear-gradient(top, #f5f5f5, #f9f9f9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#f5f5f5', endColorstr='#f9f9f9', GradientType=0);  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.progress .bar {  width: 0%;  height: 18px;  color: #ffffff;  font-size: 12px;  text-align: center;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #0e90d2;  background-image: -moz-linear-gradient(top, #149bdf, #0480be);  background-image: -ms-linear-gradient(top, #149bdf, #0480be);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#149bdf), to(#0480be));  background-image: -webkit-linear-gradient(top, #149bdf, #0480be);  background-image: -o-linear-gradient(top, #149bdf, #0480be);  background-image: linear-gradient(top, #149bdf, #0480be);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#149bdf', endColorstr='#0480be', GradientType=0);  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -moz-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  -webkit-transition: width 0.6s ease;  -moz-transition: width 0.6s ease;  -ms-transition: width 0.6s ease;  -o-transition: width 0.6s ease;  transition: width 0.6s ease;}.progress-striped .bar {  background-color: #149bdf;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  -webkit-background-size: 40px 40px;  -moz-background-size: 40px 40px;  -o-background-size: 40px 40px;  background-size: 40px 40px;}.progress.active .bar {  -webkit-animation: progress-bar-stripes 2s linear infinite;  -moz-animation: progress-bar-stripes 2s linear infinite;  -ms-animation: progress-bar-stripes 2s linear infinite;  -o-animation: progress-bar-stripes 2s linear infinite;  animation: progress-bar-stripes 2s linear infinite;}.progress-danger .bar {  background-color: #dd514c;  background-image: -moz-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -ms-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#c43c35));  background-image: -webkit-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -o-linear-gradient(top, #ee5f5b, #c43c35);  background-image: linear-gradient(top, #ee5f5b, #c43c35);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#c43c35', GradientType=0);}.progress-danger.progress-striped .bar {  background-color: #ee5f5b;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-success .bar {  background-color: #5eb95e;  background-image: -moz-linear-gradient(top, #62c462, #57a957);  background-image: -ms-linear-gradient(top, #62c462, #57a957);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#57a957));  background-image: -webkit-linear-gradient(top, #62c462, #57a957);  background-image: -o-linear-gradient(top, #62c462, #57a957);  background-image: linear-gradient(top, #62c462, #57a957);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#57a957', GradientType=0);}.progress-success.progress-striped .bar {  background-color: #62c462;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-info .bar {  background-color: #4bb1cf;  background-image: -moz-linear-gradient(top, #5bc0de, #339bb9);  background-image: -ms-linear-gradient(top, #5bc0de, #339bb9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#339bb9));  background-image: -webkit-linear-gradient(top, #5bc0de, #339bb9);  background-image: -o-linear-gradient(top, #5bc0de, #339bb9);  background-image: linear-gradient(top, #5bc0de, #339bb9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#339bb9', GradientType=0);}.progress-info.progress-striped .bar {  background-color: #5bc0de;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-warning .bar {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);}.progress-warning.progress-striped .bar {  background-color: #fbb450;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.hero-unit {  padding: 60px;  margin-bottom: 30px;  background-color: #eeeeee;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.hero-unit h1 {  margin-bottom: 0;  font-size: 60px;  line-height: 1;  color: inherit;  letter-spacing: -1px;}.hero-unit p {  font-size: 18px;  font-weight: 200;  line-height: 27px;  color: inherit;}.tooltip {  position: absolute;  z-index: 1020;  display: block;  visibility: visible;  padding: 5px;  font-size: 11px;  opacity: 0;  filter: alpha(opacity=0);}.tooltip.in {  opacity: 0.8;  filter: alpha(opacity=80);}.tooltip.top {  margin-top: -2px;}.tooltip.right {  margin-left: 2px;}.tooltip.bottom {  margin-top: 2px;}.tooltip.left {  margin-left: -2px;}.tooltip.top .tooltip-arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.tooltip.left .tooltip-arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.tooltip.bottom .tooltip-arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.tooltip.right .tooltip-arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.tooltip-inner {  max-width: 200px;  padding: 3px 8px;  color: #ffffff;  text-align: center;  text-decoration: none;  background-color: #000000;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.tooltip-arrow {  position: absolute;  width: 0;  height: 0;}.popover {  position: absolute;  top: 0;  left: 0;  z-index: 1010;  display: none;  padding: 5px;}.popover.top {  margin-top: -5px;}.popover.right {  margin-left: 5px;}.popover.bottom {  margin-top: 5px;}.popover.left {  margin-left: -5px;}.popover.top .arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.popover.right .arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.popover.bottom .arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.popover.left .arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.popover .arrow {  position: absolute;  width: 0;  height: 0;}.popover-inner {  padding: 3px;  width: 280px;  overflow: hidden;  background: #000000;  background: rgba(0, 0, 0, 0.8);  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);}.popover-title {  padding: 9px 15px;  line-height: 1;  background-color: #f5f5f5;  border-bottom: 1px solid #eee;  -webkit-border-radius: 3px 3px 0 0;  -moz-border-radius: 3px 3px 0 0;  border-radius: 3px 3px 0 0;}.popover-content {  padding: 14px;  background-color: #ffffff;  -webkit-border-radius: 0 0 3px 3px;  -moz-border-radius: 0 0 3px 3px;  border-radius: 0 0 3px 3px;  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.popover-content p,.popover-content ul,.popover-content ol {  margin-bottom: 0;}.modal-open .dropdown-menu {  z-index: 2050;}.modal-open .dropdown.open {  *z-index: 2050;}.modal-open .popover {  z-index: 2060;}.modal-open .tooltip {  z-index: 2070;}.modal-backdrop {  position: fixed;  top: 0;  right: 0;  bottom: 0;  left: 0;  z-index: 1040;  background-color: #000000;}.modal-backdrop.fade {  opacity: 0;}.modal-backdrop,.modal-backdrop.fade.in {  opacity: 0.8;  filter: alpha(opacity=80);}.modal {  position: fixed;  top: 50%;  left: 50%;  z-index: 1050;  overflow: auto;  width: 560px;  margin: -250px 0 0 -280px;  background-color: #ffffff;  border: 1px solid #999;  border: 1px solid rgba(0, 0, 0, 0.3);  *border: 1px solid #999;  /* IE6-7 */  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.modal.fade {  -webkit-transition: opacity .3s linear, top .3s ease-out;  -moz-transition: opacity .3s linear, top .3s ease-out;  -ms-transition: opacity .3s linear, top .3s ease-out;  -o-transition: opacity .3s linear, top .3s ease-out;  transition: opacity .3s linear, top .3s ease-out;  top: -25%;}.modal.fade.in {  top: 50%;}.modal-header {  padding: 9px 15px;  border-bottom: 1px solid #eee;}.modal-header .close {  margin-top: 2px;}.modal-body {  overflow-y: auto;  max-height: 400px;  padding: 15px;}.modal-form {  margin-bottom: 0;}.modal-footer {  padding: 14px 15px 15px;  margin-bottom: 0;  text-align: right;  background-color: #f5f5f5;  border-top: 1px solid #ddd;  -webkit-border-radius: 0 0 6px 6px;  -moz-border-radius: 0 0 6px 6px;  border-radius: 0 0 6px 6px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;  *zoom: 1;}.modal-footer:before,.modal-footer:after {  display: table;  content: "";}.modal-footer:after {  clear: both;}.modal-footer .btn + .btn {  margin-left: 5px;  margin-bottom: 0;}.modal-footer .btn-group .btn + .btn {  margin-left: -1px;}.dropup,.dropdown {  position: relative;}.dropdown-toggle {  *margin-bottom: -3px;}.dropdown-toggle:active,.open .dropdown-toggle {  outline: 0;}.caret {  display: inline-block;  width: 0;  height: 0;  vertical-align: top;  border-top: 4px solid #000000;  border-right: 4px solid transparent;  border-left: 4px solid transparent;  content: "";  opacity: 0.3;  filter: alpha(opacity=30);}.dropdown .caret {  margin-top: 8px;  margin-left: 2px;}.dropdown:hover .caret,.open .caret {  opacity: 1;  filter: alpha(opacity=100);}.dropdown-menu {  position: absolute;  top: 100%;  left: 0;  z-index: 1000;  display: none;  float: left;  min-width: 160px;  padding: 4px 0;  margin: 1px 0 0;  list-style: none;  background-color: #ffffff;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.2);  *border-right-width: 2px;  *border-bottom-width: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -moz-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -webkit-background-clip: padding-box;  -moz-background-clip: padding;  background-clip: padding-box;}.dropdown-menu.pull-right {  right: 0;  left: auto;}.dropdown-menu .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.dropdown-menu a {  display: block;  padding: 3px 15px;  clear: both;  font-weight: normal;  line-height: 18px;  color: #333333;  white-space: nowrap;}.dropdown-menu li > a:hover,.dropdown-menu .active > a,.dropdown-menu .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #0088cc;}.open {  *z-index: 1000;}.open  > .dropdown-menu {  display: block;}.pull-right > .dropdown-menu {  right: 0;  left: auto;}.dropup .caret,.navbar-fixed-bottom .dropdown .caret {  border-top: 0;  border-bottom: 4px solid #000000;  content: "\2191";}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu {  top: auto;  bottom: 100%;  margin-bottom: 1px;}.typeahead {  margin-top: 2px;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion {  margin-bottom: 18px;}.accordion-group {  margin-bottom: 2px;  border: 1px solid #e5e5e5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion-heading {  border-bottom: 0;}.accordion-heading .accordion-toggle {  display: block;  padding: 8px 15px;}.accordion-toggle {  cursor: pointer;}.accordion-inner {  padding: 9px 15px;  border-top: 1px solid #e5e5e5;}.carousel {  position: relative;  margin-bottom: 18px;  line-height: 1;}.carousel-inner {  overflow: hidden;  width: 100%;  position: relative;}.carousel .item {  display: none;  position: relative;  -webkit-transition: 0.6s ease-in-out left;  -moz-transition: 0.6s ease-in-out left;  -ms-transition: 0.6s ease-in-out left;  -o-transition: 0.6s ease-in-out left;  transition: 0.6s ease-in-out left;}.carousel .item > img {  display: block;  line-height: 1;}.carousel .active,.carousel .next,.carousel .prev {  display: block;}.carousel .active {  left: 0;}.carousel .next,.carousel .prev {  position: absolute;  top: 0;  width: 100%;}.carousel .next {  left: 100%;}.carousel .prev {  left: -100%;}.carousel .next.left,.carousel .prev.right {  left: 0;}.carousel .active.left {  left: -100%;}.carousel .active.right {  left: 100%;}.carousel-control {  position: absolute;  top: 40%;  left: 15px;  width: 40px;  height: 40px;  margin-top: -20px;  font-size: 60px;  font-weight: 100;  line-height: 30px;  color: #ffffff;  text-align: center;  background: #222222;  border: 3px solid #ffffff;  -webkit-border-radius: 23px;  -moz-border-radius: 23px;  border-radius: 23px;  opacity: 0.5;  filter: alpha(opacity=50);}.carousel-control.right {  left: auto;  right: 15px;}.carousel-control:hover {  color: #ffffff;  text-decoration: none;  opacity: 0.9;  filter: alpha(opacity=90);}.carousel-caption {  position: absolute;  left: 0;  right: 0;  bottom: 0;  padding: 10px 15px 5px;  background: #333333;  background: rgba(0, 0, 0, 0.75);}.carousel-caption h4,.carousel-caption p {  color: #ffffff;}.well {  min-height: 20px;  padding: 19px;  margin-bottom: 20px;  background-color: #f5f5f5;  border: 1px solid #eee;  border: 1px solid rgba(0, 0, 0, 0.05);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);}.well blockquote {  border-color: #ddd;  border-color: rgba(0, 0, 0, 0.15);}.well-large {  padding: 24px;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.well-small {  padding: 9px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.close {  float: right;  font-size: 20px;  font-weight: bold;  line-height: 18px;  color: #000000;  text-shadow: 0 1px 0 #ffffff;  opacity: 0.2;  filter: alpha(opacity=20);}.close:hover {  color: #000000;  text-decoration: none;  cursor: pointer;  opacity: 0.4;  filter: alpha(opacity=40);}button.close {  padding: 0;  cursor: pointer;  background: transparent;  border: 0;  -webkit-appearance: none;}.pull-right {  float: right;}.pull-left {  float: left;}.hide {  display: none;}.show {  display: block;}.invisible {  visibility: hidden;}.fade {  opacity: 0;  -webkit-transition: opacity 0.15s linear;  -moz-transition: opacity 0.15s linear;  -ms-transition: opacity 0.15s linear;  -o-transition: opacity 0.15s linear;  transition: opacity 0.15s linear;}.fade.in {  opacity: 1;}.collapse {  position: relative;  height: 0;  overflow: hidden;  -webkit-transition: height 0.35s ease;  -moz-transition: height 0.35s ease;  -ms-transition: height 0.35s ease;  -o-transition: height 0.35s ease;  transition: height 0.35s ease;}.collapse.in {  height: auto;}.hidden {  display: none;  visibility: hidden;}.visible-phone {  display: none !important;}.visible-tablet {  display: none !important;}.hidden-desktop {  display: none !important;}@media (max-width: 767px) {  .visible-phone {    display: inherit !important;  }  .hidden-phone {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important;  }}@media (min-width: 768px) and (max-width: 979px) {  .visible-tablet {    display: inherit !important;  }  .hidden-tablet {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important ;  }}@media (max-width: 480px) {  .nav-collapse {    -webkit-transform: translate3d(0, 0, 0);  }  .page-header h1 small {    display: block;    line-height: 18px;  }  input[type="checkbox"],  input[type="radio"] {    border: 1px solid #ccc;  }  .form-horizontal .control-group > label {    float: none;    width: auto;    padding-top: 0;    text-align: left;  }  .form-horizontal .controls {    margin-left: 0;  }  .form-horizontal .control-list {    padding-top: 0;  }  .form-horizontal .form-actions {    padding-left: 10px;    padding-right: 10px;  }  .modal {    position: absolute;    top: 10px;    left: 10px;    right: 10px;    width: auto;    margin: 0;  }  .modal.fade.in {    top: auto;  }  .modal-header .close {    padding: 10px;    margin: -10px;  }  .carousel-caption {    position: static;  }}@media (max-width: 767px) {  body {    padding-left: 20px;    padding-right: 20px;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    margin-left: -20px;    margin-right: -20px;  }  .container-fluid {    padding: 0;  }  .dl-horizontal dt {    float: none;    clear: none;    width: auto;    text-align: left;  }  .dl-horizontal dd {    margin-left: 0;  }  .container {    width: auto;  }  .row-fluid {    width: 100%;  }  .row,  .thumbnails {    margin-left: 0;  }  [class*="span"],  .row-fluid [class*="span"] {    float: none;    display: block;    width: auto;    margin-left: 0;  }  .input-large,  .input-xlarge,  .input-xxlarge,  input[class*="span"],  select[class*="span"],  textarea[class*="span"],  .uneditable-input {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;  }  .input-prepend input,  .input-append input,  .input-prepend input[class*="span"],  .input-append input[class*="span"] {    display: inline-block;    width: auto;  }}@media (min-width: 768px) and (max-width: 979px) {  .row {    margin-left: -20px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 20px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 724px;  }  .span12 {    width: 724px;  }  .span11 {    width: 662px;  }  .span10 {    width: 600px;  }  .span9 {    width: 538px;  }  .span8 {    width: 476px;  }  .span7 {    width: 414px;  }  .span6 {    width: 352px;  }  .span5 {    width: 290px;  }  .span4 {    width: 228px;  }  .span3 {    width: 166px;  }  .span2 {    width: 104px;  }  .span1 {    width: 42px;  }  .offset12 {    margin-left: 764px;  }  .offset11 {    margin-left: 702px;  }  .offset10 {    margin-left: 640px;  }  .offset9 {    margin-left: 578px;  }  .offset8 {    margin-left: 516px;  }  .offset7 {    margin-left: 454px;  }  .offset6 {    margin-left: 392px;  }  .offset5 {    margin-left: 330px;  }  .offset4 {    margin-left: 268px;  }  .offset3 {    margin-left: 206px;  }  .offset2 {    margin-left: 144px;  }  .offset1 {    margin-left: 82px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.762430939%;    *margin-left: 2.709239449638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 99.999999993%;    *width: 99.9468085036383%;  }  .row-fluid .span11 {    width: 91.436464082%;    *width: 91.38327259263829%;  }  .row-fluid .span10 {    width: 82.87292817100001%;    *width: 82.8197366816383%;  }  .row-fluid .span9 {    width: 74.30939226%;    *width: 74.25620077063829%;  }  .row-fluid .span8 {    width: 65.74585634900001%;    *width: 65.6926648596383%;  }  .row-fluid .span7 {    width: 57.182320438000005%;    *width: 57.129128948638304%;  }  .row-fluid .span6 {    width: 48.618784527%;    *width: 48.5655930376383%;  }  .row-fluid .span5 {    width: 40.055248616%;    *width: 40.0020571266383%;  }  .row-fluid .span4 {    width: 31.491712705%;    *width: 31.4385212156383%;  }  .row-fluid .span3 {    width: 22.928176794%;    *width: 22.874985304638297%;  }  .row-fluid .span2 {    width: 14.364640883%;    *width: 14.311449393638298%;  }  .row-fluid .span1 {    width: 5.801104972%;    *width: 5.747913482638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 714px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 652px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 590px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 528px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 466px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 404px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 342px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 280px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 218px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 156px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 94px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 32px;  }}@media (min-width: 1200px) {  .row {    margin-left: -30px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 30px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 1170px;  }  .span12 {    width: 1170px;  }  .span11 {    width: 1070px;  }  .span10 {    width: 970px;  }  .span9 {    width: 870px;  }  .span8 {    width: 770px;  }  .span7 {    width: 670px;  }  .span6 {    width: 570px;  }  .span5 {    width: 470px;  }  .span4 {    width: 370px;  }  .span3 {    width: 270px;  }  .span2 {    width: 170px;  }  .span1 {    width: 70px;  }  .offset12 {    margin-left: 1230px;  }  .offset11 {    margin-left: 1130px;  }  .offset10 {    margin-left: 1030px;  }  .offset9 {    margin-left: 930px;  }  .offset8 {    margin-left: 830px;  }  .offset7 {    margin-left: 730px;  }  .offset6 {    margin-left: 630px;  }  .offset5 {    margin-left: 530px;  }  .offset4 {    margin-left: 430px;  }  .offset3 {    margin-left: 330px;  }  .offset2 {    margin-left: 230px;  }  .offset1 {    margin-left: 130px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.564102564%;    *margin-left: 2.510911074638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 100%;    *width: 99.94680851063829%;  }  .row-fluid .span11 {    width: 91.45299145300001%;    *width: 91.3997999636383%;  }  .row-fluid .span10 {    width: 82.905982906%;    *width: 82.8527914166383%;  }  .row-fluid .span9 {    width: 74.358974359%;    *width: 74.30578286963829%;  }  .row-fluid .span8 {    width: 65.81196581200001%;    *width: 65.7587743226383%;  }  .row-fluid .span7 {    width: 57.264957265%;    *width: 57.2117657756383%;  }  .row-fluid .span6 {    width: 48.717948718%;    *width: 48.6647572286383%;  }  .row-fluid .span5 {    width: 40.170940171000005%;    *width: 40.117748681638304%;  }  .row-fluid .span4 {    width: 31.623931624%;    *width: 31.5707401346383%;  }  .row-fluid .span3 {    width: 23.076923077%;    *width: 23.0237315876383%;  }  .row-fluid .span2 {    width: 14.529914530000001%;    *width: 14.4767230406383%;  }  .row-fluid .span1 {    width: 5.982905983%;    *width: 5.929714493638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 1160px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 1060px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 960px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 860px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 760px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 660px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 560px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 460px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 360px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 260px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 160px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 60px;  }  .thumbnails {    margin-left: -30px;  }  .thumbnails > li {    margin-left: 30px;  }  .row-fluid .thumbnails {    margin-left: 0;  }}@media (max-width: 979px) {  body {    padding-top: 0;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    position: static;  }  .navbar-fixed-top {    margin-bottom: 18px;  }  .navbar-fixed-bottom {    margin-top: 18px;  }  .navbar-fixed-top .navbar-inner,  .navbar-fixed-bottom .navbar-inner {    padding: 5px;  }  .navbar .container {    width: auto;    padding: 0;  }  .navbar .brand {    padding-left: 10px;    padding-right: 10px;    margin: 0 0 0 -5px;  }  .nav-collapse {    clear: both;  }  .nav-collapse .nav {    float: none;    margin: 0 0 9px;  }  .nav-collapse .nav > li {    float: none;  }  .nav-collapse .nav > li > a {    margin-bottom: 2px;  }  .nav-collapse .nav > .divider-vertical {    display: none;  }  .nav-collapse .nav .nav-header {    color: #999999;    text-shadow: none;  }  .nav-collapse .nav > li > a,  .nav-collapse .dropdown-menu a {    padding: 6px 15px;    font-weight: bold;    color: #999999;    -webkit-border-radius: 3px;    -moz-border-radius: 3px;    border-radius: 3px;  }  .nav-collapse .btn {    padding: 4px 10px 4px;    font-weight: normal;    -webkit-border-radius: 4px;    -moz-border-radius: 4px;    border-radius: 4px;  }  .nav-collapse .dropdown-menu li + li a {    margin-bottom: 2px;  }  .nav-collapse .nav > li > a:hover,  .nav-collapse .dropdown-menu a:hover {    background-color: #222222;  }  .nav-collapse.in .btn-group {    margin-top: 5px;    padding: 0;  }  .nav-collapse .dropdown-menu {    position: static;    top: auto;    left: auto;    float: none;    display: block;    max-width: none;    margin: 0 15px;    padding: 0;    background-color: transparent;    border: none;    -webkit-border-radius: 0;    -moz-border-radius: 0;    border-radius: 0;    -webkit-box-shadow: none;    -moz-box-shadow: none;    box-shadow: none;  }  .nav-collapse .dropdown-menu:before,  .nav-collapse .dropdown-menu:after {    display: none;  }  .nav-collapse .dropdown-menu .divider {    display: none;  }  .nav-collapse .navbar-form,  .nav-collapse .navbar-search {    float: none;    padding: 9px 15px;    margin: 9px 0;    border-top: 1px solid #222222;    border-bottom: 1px solid #222222;    -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);  }  .navbar .nav-collapse .nav.pull-right {    float: none;    margin-left: 0;  }  .nav-collapse,  .nav-collapse.collapse {    overflow: hidden;    height: 0;  }  .navbar .btn-navbar {    display: block;  }  .navbar-static .navbar-inner {    padding-left: 10px;    padding-right: 10px;  }}@media (min-width: 980px) {  .nav-collapse.collapse {    height: auto !important;    overflow: visible !important;  }}

    Read the article

  • Fulltext search for django : Mysql not so bad ? (vs sphinx, xapian)

    - by Eric
    I am studying fulltext search engines for django. It must be simple to install, fast indexing, fast index update, not blocking while indexing, fast search. After reading many web pages, I put in short list : Mysql MYISAM fulltext, djapian/python-xapian, and django-sphinx I did not choose lucene because it seems complex, nor haystack as it has less features than djapian/django-sphinx (like fields weighting). Then I made some benchmarks, to do so, I collected many free books on the net to generate a database table with 1 485 000 records (id,title,body), each record is about 600 bytes long. From the database, I also generated a list of 100 000 existing words and shuffled them to create a search list. For the tests, I made 2 runs on my laptop (4Go RAM, Dual core 2.0Ghz): the first one, just after a server reboot to clear all caches, the second is done juste after in order to test how good are cached results. Here are the "home made" benchmark results : 1485000 records with Title (150 bytes) and body (450 bytes) Mysql 5.0.75/Ubuntu 9.04 Fulltext : ========================================================================== Full indexing : 7m14.146s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:11.553524 next run : 0:00:00.168508 Mysql 5.5.4 m3/Ubuntu 9.04 Fulltext : ========================================================================== Full indexing : 6m08.154s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:11.553524 next run : 0:00:00.168508 1 thread, 100000 searchs with single word randomly taken from database : First run : 9m09s next run : 5m38s 1 thread, 10000 random strings (random strings should not be found in database) : just after the 100000 search test : 0:00:15.007353 1 thread, boolean search : 1000 x (+word1 +word2) First run : 0:00:21.205404 next run : 0:00:00.145098 Djapian Fulltext : ========================================================================== Full indexing : 84m7.601s 1 thread, 1000 searchs with single word randomly taken from database with prefetch : First run : 0:02:28.085680 next run : 0:00:14.300236 python-xapian Fulltext : ========================================================================== 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:26.402084 next run : 0:00:00.695092 django-sphinx Fulltext : ========================================================================== Full indexing : 1m25.957s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:30.073001 next run : 0:00:05.203294 1 thread, 100000 searchs with single word randomly taken from database : First run : 12m48s next run : 9m45s 1 thread, 10000 random strings (random strings should not be found in database) : just after the 100000 search test : 0:00:23.535319 1 thread, boolean search : 1000 x (word1 word2) First run : 0:00:20.856486 next run : 0:00:03.005416 As you can see, Mysql is not so bad at all for fulltext search. In addition, its query cache is very efficient. Mysql seems to me a good choice as there is nothing to install (I need just to write a small script to synchronize an Innodb production table to a MyISAM search table) and as I do not really need advanced search feature like stemming etc... Here is the question : What do you think about Mysql fulltext search engine vs sphinx and xapian ?

    Read the article

  • search a collection for a specific keyword

    - by icelated
    What i want to do is search a hashset with a keyword.. I have 3 classes... main() Library Item(CD, DVD,Book classes) In library i am trying to do my search of the items in the hashsets.. In Item class is where i have the getKeywords function.. here is the Items class... import java.io.PrintStream; import java.util.Collection; import java.util.*; class Item { private String title; private String [] keywords; public String toString() { String line1 = "title: " + title + "\n" + "keywords: " + Arrays.toString(keywords); return line1; } public void print() { System.out.println(toString()); } public Item() { } public Item(String theTitle, String... theKeyword) { this.title = theTitle; this.keywords = theKeyword; } public String getTitle() { return title; } public String [] getKeywords() { return keywords; } } class CD extends Item { private String artist; private String [] members; // private String [] keywords; private int number; public CD(String theTitle, String theBand, int Snumber, String... keywords) { super(theTitle, keywords); this.artist = theBand; this.number = Snumber; // this.keywords = keywords; } public void addband(String... member) { this.members = member; } public String getArtist() { return artist; } public String [] getMembers() { return members; } // public String [] getKeywords() // { // return keywords; //} public String toString() { return "-Music-" + "\n" + "band: " + artist + "\n" + "# songs: " + number + "\n" + "members: " + Arrays.toString(members) + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } public void print() { System.out.println(toString()); } } class DVD extends Item { private String director; private String [] cast; private int scenes; // private String [] keywords; public DVD(String theTitle, String theDirector, int nScenes, String... keywords) { super(theTitle, keywords); this.director = theDirector; this.scenes = nScenes; // this.keywords = keywords; } public void addmoviecast(String... members) { this.cast = members; } public String [] getCast() { return cast; } public String getDirector() { return director; } // public String [] getKeywords() // { // return keywords; // } public String toString() { return "-Movie-" + "\n" + "director: " + director + "\n" + "# scenes: " + scenes + "\n" + "cast: " + Arrays.toString(cast) + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } public void print() { System.out.println(toString()); } } class Book extends Item { private String author; private int pages; public Book(String theTitle, String theAuthor, int nPages, String... keywords) { super(theTitle, keywords); this.author = theAuthor; this.pages = nPages; // this.keywords = keywords; } public String getAuthor() { return author; } //public String [] getKeywords() // { // return keywords; //} public void print() { System.out.println(toString()); } public String toString() { return "-Book-" + "\n" + "Author: " + author + "\n" + "# pages " + pages + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } } I hope i didnt confuse you? I need help with the itemsForKeyword(String keyword) function.. the first keyword being passed in is "science fiction" and i want to search the keywords in the sets and return the matches.. What am i doing so wrong? Thank you

    Read the article

  • Setting value for autocomplete search field linked to Google Places API

    - by user1653350
    I have a web page where people will be able to enter multiple destinations. When they state they want to enter a new destination, the current field values are stored in arrays. If they choose to go back to a previous destination, the relevant values are reinserted into the form fields. I am using the search field linked to autocomplete as the visible display of the destination. When I attempt to put a value into the linked search field, the value is presented as if it is a placeholder instead of a value. Enter the field and the value is removed by the onFocus() event of the Google Places autocomplete add-in. How can I reinsert the value and have it recognised as a value instead of placeholder. field definition in the form <label for="GoogleDestSrch" class="inputText">Destination: <span id="DestinationDisplay2">1</span> <span class="required"><font size="5"> * </font></span></label> <input id="GoogleDestSrch" type="text" size="50" placeholder="Please enter your destination" /> initialise code for Google Places API listener var input = document.getElementById('GoogleDestSrch'); var autocomplete = new google.maps.places.Autocomplete(input); google.maps.event.addListener(autocomplete, 'place_changed', function() { fillInAddress(); }); attempting to reinsert value into search field when prior destination reloaded form.GoogleDestSrch.value = GoogleDestSrch[index]; Issue With Google Places <script language="JavaScript" type="text/javascript"> function GotoDestination(index) { var domove = true; if (index == 0) { index = lastIndex + 1; } else { if (index == -1) { index = lastIndex - 1; if (index == 0) { index = 1; domove = false; } } } if (domove) { if (index != lastIndex) { var doc = window.document; var pdbutton = doc.getElementById("pdbutton"); var pdbutton1 = doc.getElementById("pdbutton1"); if ((index > lastIndex)) { // move to next destination saveDataF(lastIndex); loadDataF(index); lastIndex = index; } else if (index <= lastIndex) { // move to previous destination saveDataF(lastIndex); loadDataF(index); lastIndex = index; } } } } var input; var autocomplete; // fill in the Google metadata when a destination is selected function fillInAddress() { var strFullValue = ''; var strFullGeoValue = ''; var place = autocomplete.getPlace(); document.getElementById("GoogleType").value = place.types[0]; } function saveDataF(index) { var fieldValue; var blankSearch = "Please enter"; // placeholder text for Google Places fieldValue = document.getElementById("GoogleDestSrch").value; if (fieldValue.indexOf(blankSearch) > -1) { fieldValue = ""; } GoogleDestSrch[index] = fieldValue; } function loadDataF(index) { if ((GoogleDestSrch[index] + "") == "undefined") { document.getElementById("GoogleDestSrch").value = ""; } else { document.getElementById("GoogleDestSrch").value = GoogleDestSrch[index]; } } // -- Destination: 1 * Type of place // input = document.getElementById('GoogleDestSrch'); autocomplete = new google.maps.places.Autocomplete(input); google.maps.event.addListener(autocomplete, 'place_changed', function () { fillInAddress(); }); //]]

    Read the article

  • Choosing a type for search results in C#

    - by Chris M
    I have a result set that will never exceed 500; the results that come back from the web-service are assigned to a search results object. The data from the webservice is about 2mb; the bit I want to use is about a third of each record, so this allows me to cache and quickly manipulate it. I want to be able to sort and filter the results with the least amount of overhead and as fast as possible so I used the VCSKICKS timing class to measure their performance Average Total (10,000) Type Create Sort Create Sort HashSet 0.1579 0.0003 1579 3 IList 0.0633 0.0002 633 2 IQueryable 0.0072 0.0432 72 432 Measured in Seconds using http://www.vcskicks.com/algorithm-performance.php I created the hashset through a for loop over the web-service response (adding to the hashset). The List & IQueryable were created using LINQ. Question I can understand why HashSet takes longer to create (the foreach loop vs linq); but why would IQueryable take longer to sort than the other two; and finally is there a better way to assign the HashSet. Thanks Actual Program public class Program { private static AuthenticationHeader _authHeader; private static OPSoapClient _opSession; private static AccommodationSearchResponse _searchResults; private static HashSet<SearchResults> _myHash; private static IList<SearchResults> _myList; private static IQueryable<SearchResults> _myIQuery; static void Main(string[] args) { #region Setup WebService _authHeader = new AuthenticationHeader { UserName = "xx", Password = "xx" }; _opSession = new OPSoapClient(); #region Setup Search Results _searchResults = _opgSession.SearchCR(_authHeader, "ENG", "GBP", "GBR"); #endregion Setup Search Results #endregion Setup WebService // HASHSET SpeedTester hashTest = new SpeedTester(TestHashSet); hashTest.RunTest(); Console.WriteLine("- Hash Test \nAverage Running Time: {0}; Total Time: {1}", hashTest.AverageRunningTime, hashTest.TotalRunningTime); SpeedTester hashSortTest = new SpeedTester(TestSortingHashSet); hashSortTest.RunTest(); Console.WriteLine("- Hash Sort Test \nAverage Running Time: {0}; Total Time: {1}", hashSortTest.AverageRunningTime, hashSortTest.TotalRunningTime); // ILIST SpeedTester listTest = new SpeedTester(TestList); listTest.RunTest(); Console.WriteLine("- List Test \nAverage Running Time: {0}; Total Time: {1}", listTest.AverageRunningTime, listTest.TotalRunningTime); SpeedTester listSortTest = new SpeedTester(TestSortingList); listSortTest.RunTest(); Console.WriteLine("- List Sort Test \nAverage Running Time: {0}; Total Time: {1}", listSortTest.AverageRunningTime, listSortTest.TotalRunningTime); // IQUERIABLE SpeedTester iqueryTest = new SpeedTester(TestIQueriable); iqueryTest.RunTest(); Console.WriteLine("- iquery Test \nAverage Running Time: {0}; Total Time: {1}", iqueryTest.AverageRunningTime, iqueryTest.TotalRunningTime); SpeedTester iquerySortTest = new SpeedTester(TestSortableIQueriable); iquerySortTest.RunTest(); Console.WriteLine("- iquery Sort Test \nAverage Running Time: {0}; Total Time: {1}", iquerySortTest.AverageRunningTime, iquerySortTest.TotalRunningTime); } static void TestHashSet() { var test = _searchResults.Items; _myHash = new HashSet<SearchResults>(); foreach(var x in test) { _myHash.Add(new SearchResults { Ref = x.Ref, Price = x.StandardPrice }); } } static void TestSortingHashSet() { var sorted = _myHash.OrderBy(s => s.Price); } static void TestList() { var test = _searchResults.Items; _myList = (from x in test select new SearchResults { Ref = x.Ref, Price = x.StandardPrice }).ToList(); } static void TestSortingList() { var sorted = _myList.OrderBy(s => s.Price); } static void TestIQueriable() { var test = _searchResults.Items; _myIQuery = (from x in test select new SearchResults { Ref = x.Ref, Price = x.StandardPrice }).AsQueryable(); } static void TestSortableIQueriable() { var sorted = _myIQuery.OrderBy(s => s.Price); } }

    Read the article

  • java.lang.NullPointerException exception in my controller file (using Spring Hibernate Maven)

    - by mrjayviper
    The problem doesn't seemed to have anything to do with Hibernate. As I've commented the Hibernate stuff but I'm still getting it. If I comment out this line message = staffDAO.searchForStaff(search); in my controller file, it goes through ok. But I don't see anything wrong with searchForStaff function. It's a very simple function that just returns the string "test" and run system.out.println("test"). Can you please help? thanks But this is the error that I'm getting: SEVERE: Servlet.service() for servlet [spring] in context with path [/directorymaven] threw exception [Request processing failed; nested exception is java.lang.NullPointerException] with root cause java.lang.NullPointerException at org.flinders.staffdirectory.controllers.SearchController.showSearchResults(SearchController.java:25) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at org.springframework.web.method.support.InvocableHandlerMethod.invoke(InvocableHandlerMethod.java:219) at org.springframework.web.method.support.InvocableHandlerMethod.invokeForRequest(InvocableHandlerMethod.java:132) at org.springframework.web.servlet.mvc.method.annotation.ServletInvocableHandlerMethod.invokeAndHandle(ServletInvocableHandlerMethod.java:100) at org.springframework.web.servlet.mvc.method.annotation.RequestMappingHandlerAdapter.invokeHandlerMethod(RequestMappingHandlerAdapter.java:604) at org.springframework.web.servlet.mvc.method.annotation.RequestMappingHandlerAdapter.handleInternal(RequestMappingHandlerAdapter.java:565) at org.springframework.web.servlet.mvc.method.AbstractHandlerMethodAdapter.handle(AbstractHandlerMethodAdapter.java:80) at org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:923) at org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:852) at org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:882) at org.springframework.web.servlet.FrameworkServlet.doGet(FrameworkServlet.java:778) at javax.servlet.http.HttpServlet.service(HttpServlet.java:621) at javax.servlet.http.HttpServlet.service(HttpServlet.java:728) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:305) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:210) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:222) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:123) at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:472) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:171) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:99) at org.apache.catalina.valves.AccessLogValve.invoke(AccessLogValve.java:931) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:118) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:407) at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1004) at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:589) at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:310) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603) at java.lang.Thread.run(Thread.java:722) My spring-servlet xml <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:context="http://www.springframework.org/schema/context" xmlns:mvc="http://www.springframework.org/schema/mvc" xmlns:p="http://www.springframework.org/schema/p" xmlns:tx="http://www.springframework.org/schema/tx" xsi:schemaLocation=" http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context.xsd http://www.springframework.org/schema/mvc http://www.springframework.org/schema/mvc/spring-mvc.xsd http://www.springframework.org/schema/tx http://www.springframework.org/schema/tx/spring-tx.xsd"> <context:component-scan base-package="org.flinders.staffdirectory.controllers" /> <mvc:annotation-driven /> <mvc:resources mapping="/resources/**" location="/resources/" /> <tx:annotation-driven /> <bean id="propertyConfigurer" class="org.springframework.beans.factory.config.PropertyPlaceholderConfigurer" p:location="/WEB-INF/spring.properties" /> <bean id="dataSource" class="org.apache.commons.dbcp.BasicDataSource" destroy-method="close" p:driverClassName="${jdbc.driverClassName}" p:url="${jdbc.databaseurl}" p:username="${jdbc.username}" p:password="${jdbc.password}" /> <bean id="sessionFactory" class="org.springframework.orm.hibernate4.LocalSessionFactoryBean" p:dataSource-ref="dataSource" p:configLocation="${hibernate.config}" p:packagesToScan="org.flinders.staffdirectory"/> <bean id="transactionManager" class="org.springframework.orm.hibernate4.HibernateTransactionManager" p:sessionFactory-ref="sessionFactory" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver" p:viewClass="org.springframework.web.servlet.view.tiles2.TilesView" /> <bean id="tilesConfigurer" class="org.springframework.web.servlet.view.tiles2.TilesConfigurer" p:definitions="/WEB-INF/tiles.xml" /> <bean id="staffDAO" class="org.flinders.staffdirectory.dao.StaffDAO" p:sessionFactory-ref="sessionFactory" /> <!-- <bean id="staffService" class="org.flinders.staffdirectory.services.StaffServiceImpl" p:staffDAO-ref="staffDAO" />--> </beans> This is my controller file package org.flinders.staffdirectory.controllers; import java.util.List; //import org.flinders.staffdirectory.models.database.SearchResult; import org.flinders.staffdirectory.models.misc.Search; import org.flinders.staffdirectory.dao.StaffDAO; //import org.springframework.beans.factory.annotation.Autowired; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.ModelAttribute; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class SearchController { //@Autowired private StaffDAO staffDAO; private String message; @RequestMapping("/SearchStaff") public ModelAndView showSearchResults(@ModelAttribute Search search) { //List<SearchResult> searchResults = message = staffDAO.searchForStaff(search); //System.out.println(search.getSurname()); return new ModelAndView("search/SearchForm", "Search", new Search()); //return new ModelAndView("search/SearchResults", "searchResults", searchResults); } @RequestMapping("/SearchForm") public ModelAndView showSearchForm() { return new ModelAndView("search/SearchForm", "search", new Search()); } } my dao class package org.flinders.staffdirectory.dao; import java.util.List; import org.hibernate.SessionFactory; //import org.springframework.beans.factory.annotation.Autowired; import org.flinders.staffdirectory.models.database.SearchResult; import org.flinders.staffdirectory.models.misc.Search; public class StaffDAO { //@Autowired private SessionFactory sessionFactory; public void setSessionFactory(SessionFactory sessionFactory) { this.sessionFactory = sessionFactory; } public String searchForStaff(Search search) { /*String SQL = "select distinct telsumm_id as id, telsumm_parent_id as parentId, telsumm_name_title as title, (case when substr(telsumm_surname, length(telsumm_surname) - 1, 1) = ',' then substr(telsumm_surname, 1, length(telsumm_surname) - 1) else telsumm_surname end) as surname, telsumm_preferred_name as firstname, nvl(telsumm_tele_number, '-') as telephoneNumber, nvl(telsumm_role, '-') as role, telsumm_display_department as department, lower(telsumm_entity_type) as entityType from teldirt.teld_summary where (telsumm_search_surname is not null) and not (nvl(telsumm_tele_directory,'xxx') IN ('N','S','D')) and not (telsumm_tele_number IS NULL AND telsumm_alias IS NULL) and (telsumm_alias_list = 'Y' OR (telsumm_tele_directory IN ('A','B'))) and ((nvl(telsumm_system_id_end,sysdate+1) > SYSDATE and telsumm_entity_type = 'P') or (telsumm_entity_type = 'N')) and (telsumm_search_department NOT like 'SPONSOR%')"; if (search.getSurname().length() > 0) { SQL += " and (telsumm_search_surname like '" + search.getSurname().toUpperCase() + "%')"; } if (search.getSurnameLike().length() > 0) { SQL += " and (telsumm_search_soundex like soundex(('%" + search.getSurnameLike().toUpperCase() + "%'))"; } if (search.getFirstname().length() > 0) { SQL += " and (telsumm_search_preferred_name like '" + search.getFirstname().toUpperCase() + "%' or telsumm_search_first_name like '" + search.getFirstname() + "%')"; } if (search.getTelephoneNumber().length() > 0) { SQL += " and (telsumm_tele_number like '" + search.getTelephoneNumber() + "%')"; } if (search.getDepartment().length() > 0) { SQL += " and (telsumm_search_department like '" + search.getDepartment().toUpperCase() + "%')"; } if (search.getRole().length() > 0) { SQL += " and (telsumm_search_role like '" + search.getRole().toUpperCase() + "%')"; } SQL += " order by surname, firstname"; List<Object[]> list = (List<Object[]>) sessionFactory.getCurrentSession().createQuery(SQL).list(); for(int j=0;j<list.size();j++){ Object [] obj= (Object[])list.get(j); for(int i=0;i<obj.length;i++) System.out.println(obj[i]); }*/ System.out.println("test"); return "test"; } }

    Read the article

  • user input of one php script pass to another php without modification in first php script

    - by ish12
    hi all.. Consider two php scripts(o.php & t.php) o.php contains both html and php. html here gets user input for eg:user name and password this information is passed to php using php-self. I want the user input of o.php passed to t.php without any modification in o.php. I ve used include and require in the t.php but the problem is it displays the output of o.php but i need only the user input values from o.php without displaying the output of o.php. Using functions or session in o.php we can pass user input but am in the situation tat i should not add or modify o.php. thanks in advance!!

    Read the article

  • jQuery Autocomplete plug-in search configuration

    - by dev.e.loper
    I'm looking into using jQuery autocomplete plug-in to implement user lookup by first or last name. It looks like by default autocomplete looks up words by character sequence no matter its occurrence in a word. So if you have data such as: javascript, asp, haskell and you type in 'as' you will get all three. I would like it to at least match beginning of the word. So in above example you get only 'asp'. Is there a way to configure jQuery Autocomplete plug-in to do this? Ultimately it would be even better to match by beginning of first or last name like it is in Gmail.

    Read the article

  • Breaking out of first element in IHTMLTxtRange

    - by XwipeoutX
    I'm trying to do a rich text editor for a web application, and I need to be able to mark some elements in the text as uneditable by the user. The reason for this is they're placeholders for dynamic content (like created date) that I want to have a live preview for. Take the following Code as an example - there's no toolbar or anything in this one, for light weightness, but the textarea and html are synchronized. <!-- DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd" --> <html> <head> <title>Hi</title> <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.min.js"></script> <script> $(function() { g = {}; g.iFrame = document.createElement("IFRAME"); $("#frameContainer").append(g.iFrame); g.iDoc = g.iFrame.contentWindow.document; g.iDoc.designMode = "on"; g.jTextArea = $("#textContainer textarea"); setTimeout(function() { g.iDoc.body.innerHTML = "<b class=\"notype\">Cannot type here</b>"; $(g.iDoc).trigger("keyup"); $(g.iDoc.body).focus(); }, 0); $(g.iDoc).keyup(function() { g.jTextArea.text(g.iDoc.body.innerHTML); }); g.jTextArea.keyup(function() { g.iDoc.body.innerHTML = this.innerText; }); var getSelection = function() { if (typeof g.iDoc.selection !== "undefined" && g.iDoc.selection.type !== "Text" && g.iDoc.selection.type !== "None") { g.iDoc.selection.clear(); } return g.iDoc.selection.createRange(); }; $(g.iDoc).keypress(function(event) { // If we're in a marked field, disable the operation. var sel = getSelection(); if ($(sel.parentElement()).hasClass('notype')) { sel.moveToElementText(sel.parentElement()); sel.collapse(); sel.move("character", -1); sel.select(); $("#log").append("<div>outside of thing</div>"); } }); $(testLink).click(function() { // Try and insert stuff at the front $(g.iDoc.body).focus(); var sel = getSelection(); sel.moveToElementText(sel.parentElement()); sel.collapse(); sel.move("character", -100); sel.pasteHTML("Before html?"); $(g.iDoc).trigger("keyup"); $(g.iDoc.body).focus(); }); }); </script> </head> <body id="#body"> <div id="container"> <div id="frameContainer"> <h1> Frame</h1> </div> <div id="textContainer"> <h1> Text</h1> <textarea rows="10" cols="80"></textarea> </div> <a href="#" id="testLink">Test</a> <div id="log"> </div> </div> </body> </html> In the keyup binding, I can successfuly detect if I'm inside another element, and move the cursor to the front of the text before inserting it no problem. However, since there is no text before the element marked as 'notype', it gets inserted inside the same element. This is double bad when the user presses "enter", as a new tag is genrated, and the "notype" tag is duplicated, obviously not required. I want the behaviour as follows: * If the user types while the cursor is in the 'notype' tag, the cursor is moved to front and the text goes there * If the cursor is at the last position inside the 'notype' tag, then the text appears after the tag * If the user types anywhere else, it's inserted as always. The link at the bottom tries to manually put the cursor at the front and insert the html. Obviously fails. I know this one can work by doing something like $(g.iDoc.body).prepend("before!"), but this obviously won't work in a real scenario (using keyup).

    Read the article

  • UIScrollView subviews not showing at first

    - by igul222
    I created a custom UIScrollView subclass that works a like a UITableView, keeping a collection of subviews and re-using them whenever the user scrolls. It's implemented like this: -(void)layoutSubviews { for(UIView *subview in [self subviews]) [subview removeFromSuperview]; // then re-add subviews after changing the frame and some attributes } This works fine with simple UIViews, but when I try to do it with a UIView that has a UILabel subview, the "base" view appears fine, but the UILabel doesn't show up at all. I can get the UILabel to show up by scrolling the entire UIView off screen and then bringing it back on. What could be causing this? So far, I've tried calling [myUIView setNeedsLayout], [myUIView setNeedsDisplay], and [myUIView layoutIfNeeded] from various places. None of them worked, and the last one crashed my app. I've also done the same thing to myUIScrollViewSubclass, with similar results.

    Read the article

  • Lucene.NET 2.9 and BitArray/DocIdSet

    - by Paul Knopf
    I found a great example on grabbing facet counts on a base query. It stores the bitarray of the base query to improve the performance each time the a facet gets counted. var genreQuery = new TermQuery(new Term("genre", genre)); var genreQueryFilter = new QueryFilter(genreQuery); BitArray genreBitArray = genreQueryFilter.Bits(searcher.GetIndexReader()); Console.WriteLine("There are " + GetCardinality(genreBitArray) + " document with the genre " + genre); // Next perform a regular search and get its BitArray result Query searchQuery = MultiFieldQueryParser.Parse(term, new[] {"title", "description"}, new[] {BooleanClause.Occur.SHOULD, BooleanClause.Occur.SHOULD}, new StandardAnalyzer()); var searchQueryFilter = new QueryFilter(searchQuery); BitArray searchBitArray = searchQueryFilter.Bits(searcher.GetIndexReader()); Console.WriteLine("There are " + GetCardinality(searchBitArray) + " document containing the term " + term); The only problem is that I am using a newer version of Lucene.NET (2.9) and Filter.Bits is obsolete. We are told to use DocIdSet instead (rather than BitArray). I cannot found out how to do the bitArray.And(bitArray) with a docIdSet. I looked in reflector and found OpenIdSet which has And operations. Not sure if OpenIdSet is the route to go, I'm just stating. Thanks in advance!

    Read the article

  • Getting Facebook Posts Permalink from Facebook Graph API Search

    - by Alexia
    I want to use the Facebook Graph API to search the public status updates concerning a keyword. For example, this works great: http://graph.facebook.com/search?q=obama&type=post It shows me all the posts with the word "obama" in it. If the post is a picture, it actually returns a field called "link" which is the permalink to the picture on the actual Facebook website, in the user's profile. Which is exactly what I want, but for pictures. But if the post in question is just a status update, i.e. just text, all it returns is the 3 fields: message, created_time, and updated_time. How do I view this actual status update on www.facebook.com? I realize I can view it on graph.facebook.com in JSON format, but I want to actually be able to show the permalink to the status update, or post. The final result I would like to retrieve might look something like this: http://www.facebook.com/[user id]/posts/[post id] With the [user id] and [post id] fields swapped out with the actual IDs, obviously. TIA!

    Read the article

  • Trigerring other animation after first ending Animation (Objetive-C)

    - by ludo
    Hi, I have a simple animation which simply modify the position of a button: [UIView beginAnimation:nil context:nil]; [UIView setAnimationsDuration:3.0]; [UIView setAnimationCurve:UIViewAnimationCurveEaseInOut]; mybutton.frame = CGREctMake(20, 233, 280, 46); [UIView commitAnimations]; I want to perform some other animations when this one is finish, how to do that?

    Read the article

  • First Test Crashes using MSTEST with ASP.NET MVC 1

    - by Trey Carroll
    I'm trying to start using Unit Testing and I want to test the following Controller: public class AjaxController : Controller { ... public JsonResult RateVideo( int userRating, long videoId ) { string userName = User.Identity.Name; ... } } I have a created a TestClass with the following method: [ TestMethod public void TestRateVideo() { //Arrange AjaxController c = new AjaxController(); //Act JsonResult jr = c.RateVideo(1, 1); //Assert //Not implemented yet } I select debug and run the test. When the code reaches the 1st statement: string username = User.Identity.Name; Debugging stops and I am presented with a message that says that the test failed. Any guidance you can offer would be appreciated.

    Read the article

  • Looking for feedback on a first SAML implementation.

    - by morgancodes
    Hello, I've been tasked with designing a very simple SSO (single sign-on) process. My employer has specified that it should be implimented in SAML. I'd like to create messages that are absolutely as simple as possible while confirming to the SAML spec. I'd be really grateful if some of you would look at my request and response messages and tell me if they make sense for my purpose, if they include anything that doesn't need to be there, and if they are missing anything that does need to be there. Addionally, I'd like to know where in the response I should put additional information about the subject; in particular, the subject's email address. The interaction needs to work as follows: 1) User requests service from service provider at this point, the service provider knows nothing about the user. 2) Service provider requests authentication for user from identity provider 3) User is authenticated/registered by identity provider 4) Identity provider responds to Service provider with authentication success message, PLUS user's email address. Here's what I think the request should be: <?xml version="1.0" encoding="UTF-8"?> <samlp:AuthnRequest xmlns:samlp="urn:oasis:names:tc:SAML:2.0:protocol" ID="abc" IssueInstant="1970-01-01T00:00:00.000Z" Version="2.0" AssertionConsumerServiceURL="http://www.IdentityProvider.com/loginPage"> <saml:Issuer xmlns:saml="urn:oasis:names:tc:SAML:2.0:assertion"> http://www.serviceprovider.com </saml:Issuer> <saml:Subject> <saml:NameID Format="urn:oasis:names:tc:SAML:2.0:nameid-format:transient">3f7b3dcf-1674-4ecd-92c8-1544f346baf8</saml:NameID> </saml:Subject> Here's what I think the response should be: <?xml version="1.0" encoding="UTF-8"?> <samlp:Response xmlns:samlp="urn:oasis:names:tc:SAML:2.0:protocol" Destination="http://www.serviceprovider.com/desitnationURL" ID="123" IssueInstant="2008-11-21T17:13:42.872Z" Version="2.0"> <samlp:Status> <samlp:StatusCode Value="urn:oasis:names:tc:SAML:2.0:status:Success"/> </samlp:Status> <saml:Assertion xmlns:saml="urn:oasis:names:tc:SAML:2.0:assertion" Version="2.0"> <saml:Subject> <saml:NameID Format="urn:oasis:names:tc:SAML:2.0:nameid-format:transient">3f7b3dcf-1674-4ecd-92c8-1544f346baf8</saml:NameID> <saml:SubjectConfirmation Method="urn:oasis:names:tc:SAML:2.0:profiles:SSO:browser"> <saml:SubjectConfirmationData InResponseTo="abc"/> </saml:SubjectConfirmation> </saml:Subject> <saml:AuthnStatement AuthnInstant="2008-11-21T17:13:42.899Z"> <saml:AuthnContext> <saml:AuthnContextClassRef>urn:oasis:names:tc:SAML:2.0:ac:classes:PasswordProtectedTransport</saml:AuthnContextClassRef> </saml:AuthnContext> </saml:AuthnStatement> </saml:Assertion> </samlp:Response> So, again, my questions are: 1) Is this a valid SAML interaction? 2) Can either the request or response xml be simplified? 3) Where in the response should I put the subject's email address? I really apprecaite your help. Thanks so much! -Morgan

    Read the article

  • SQL Server 2008 ContainsTable, CTE, and Paging

    - by David Murdoch
    I'd like to perform efficient paging using containstable. The following query selects the top 10 ranked results from my database using containstable when searching for a name (first or last) that begins with "Joh". DECLARE @Limit int; SET @Limit = 10; SELECT TOP @Limit c.ChildID, c.PersonID, c.DOB, c.Gender FROM [Person].[vFullName] AS v INNER JOIN CONTAINSTABLE( [Person].[vFullName], (FullName), IS ABOUT ( "Joh*" WEIGHT (.4), "Joh" WEIGHT (.6)) ) AS k3 ON v.PersonID = k3.[KEY] JOIN [Child].[Details] c ON c.PersonID = v.PersonID JOIN [Person].[Details] p ON p.PersonID = c.PersonID ORDER BY k3.RANK DESC, FullName ASC, p.Active DESC, c.ChildID ASC I'd like to combine it with the following CTE which returns the 10th-20th results ordered by ChildID (the primary key): DECLARE @Start int; DECLARE @Limit int; SET @Start = 10; SET @Limit = 10; WITH ChildEntities AS ( SELECT ROW_NUMBER() OVER (ORDER BY ChildID) AS Row, ChildID FROM Child.Details ) SELECT c.ChildID, c.PersonID, c.DOB, c.Gender FROM ChildEntities cte INNER JOIN Child.Details c ON cte.ChildID = c.ChildID WHERE cte.Row BETWEEN @Start+1 AND @Start+@Limit ORDER BY cte.Row ASC

    Read the article

  • How do I use .htaccess conditional redirects for multiple domains?

    - by John
    I'm managing about 15 or so domains for a particular promotion. Each domain has specific redirects in place, as shown below. Rather than make 15 different .htaccess files that I would later have to manage separately, I'd like to use a single .htaccess file and use a symbolic link into each website's directory. The trouble is that, I can't figure out how to make the rules apply only for a specific domain. Every time I visit www.redirectsite2.com, it sends me to www.targetsite.com/search.html?state=PA&id=75, when it should instead be sending me to www.targetsite.com/search.html?state=NJ&id=68. How exactly do I make multiple RewriteRules apply for a given domain and only that domain? Is this even possible to do within a single .htaccess file? Options +FollowSymlinks # redirectsite1.com RewriteEngine On RewriteBase / # start processing rules for www.redirectsite1.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite1\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,L] RewriteRule ^PGN$ http://targetsite.com/search.html?state=PA&id=26 [QSA,R,NC,L] RewriteRule ^NS$ http://targetsite.com/search.html?state=PA&id=27 [QSA,R,NC,L] RewriteRule ^INQ$ http://targetsite.com/search.html?state=PA&id=28 [QSA,R,NC,L] RewriteRule ^AA$ http://targetsite.com/search.html?state=PA&id=29 [QSA,R,NC,L] RewriteRule ^PI$ http://targetsite.com/search.html?state=PA&id=30 [QSA,R,NC,L] RewriteRule ^GV$ http://targetsite.com/search.html?state=PA&id=31 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,NC,L] # end processing rules for www.redirectsite1.com # begin rules for redirectsite2.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite2\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,L] RewriteRule ^SL$ http://targetsite.com/search.html?state=NJ&id=6 [QSA,R,NC,L] RewriteRule ^APP$ http://targetsite.com/search.html?state=NJ&id=8 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,NC,L] Thanks for any help you may be able to provide!

    Read the article

  • In search of a network file system with extended caching to speed up file access

    - by Brecht Machiels
    I'm running a small home server that stores my documents. The disks in this server are in a RAID 1 configuration (using Linux md) and it's also periodically being backup up to an external hard drive to make sure I don't lose them. However, I'm always accessing the files from other computers on the home network using an SMB share, and this results in a considerable speed penalty (especially when connected over WLAN). This is quite annoying when editing large files, such as digital camera RAWs, for example. I've been looking for a solution to this problem. It would have to offer some kind of local caching to speed up the file access. The client would preferably not keep a copy of all data on the server, as it consists of a very large collection of photographs, most of which I will not access frequently. Instead, it should only cache the accessed files and sync the changes back in the background. Ideally, it would also do some smart read-ahead (cache the files that are in the same directory as the currently opened file, for examples), but I suppose that's asking a bit much. Synchronization should be automatic (on file change). Conflicting file changes (at the same time on different clients) are unlikely to happen in my use case, but I would prefer if they are handled properly (notification to the user). I've come across the following options, so far: something similar to Dropbox. iFolder seems to be the only thing that comes close, but its reputation (stability) and requirements put me off. A distributed file system such as OpenAFS. I'm not sure this will speed up file access. It is probably overkill for what I need. Maybe NFS or even Samba offer these possibilities. I read a bit about Windows' Offline Files, but its operation seems limited (at least on Windows XP). As this is just for personal use, I'm not willing to spend a lot of money. A free solution would be preferred. Also, the server needs to run on Linux, and I need a client for at least Windows.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Replace text with other text in the same line

    - by skerit
    I don't know if I can use regex for this, but I want to replace something in this xml: <custom-attribute name="Attribute_1" dt:dt="string">Danny Boyle</custom-attribute> <custom-attribute name="DVD-releasedatum" dt:dt="string">06/10/1999</custom-attribute> should become <Attribute_1>Danny Boyle</Attribute_1> <DVD-releasedatum>06/10/1999</DVD-releasedatum> Removing this from the first tag isn't hard, but how can I close my newly formed tag?

    Read the article

  • Unexpected result in C algebra for search algorithm.

    - by Rhys
    Hi, I've implemented this search algorithm for an ordered array of integers. It works fine for the first data set I feed it (500 integers), but fails on longer searches. However, all of the sets work perfectly with the other four search algorithms I've implemented for the assignment. This is the function that returns a seg fault on line 178 (due to an unexpected negative m value). Any help would be greatly appreciated. CODE: 155 /* perform Algortihm 'InterPolationSearch' on the set 156 * and if 'key' is found in the set return it's index 157 * otherwise return -1 */ 158 int 159 interpolation_search(int *set, int len, int key) 160 { 161 int l = 0; 162 int r = len - 1; 163 int m; 164 165 while (set[l] < key && set[r] >= key) 166 { 167 168 printf ("m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l])\n"); 169 170 printf ("m = %d + ((%d - %d) * (%d - %d)) / (%d - %d);\n", l, key, set[l], r, l, set[r], set[l]); 171 m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]); 172 printf ("m = %d\n", m); 173 174 #ifdef COUNT_COMPARES 175 g_compares++; 176 #endif 177 178 if (set[m] < key) 179 l = m + 1; 180 else if (set[m] > key) 181 r = m - 1; 182 else 183 return m; 184 } 185 186 if (set[l] == key) 187 return l; 188 else 189 return -1; 190 } OUTPUT: m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]) m = 0 + ((68816 - 0) * (100000 - 0)) / (114836 - 0); m = -14876 Thankyou! Rhys

    Read the article

  • Only first table in create table statement being created

    - by Craig
    The table "credentials" does show up in the adb shell. I've checked logcat and it doesn't seem to report a problem... private static final String DATABASE_CREATE = "create table credentials (_id integer primary key autoincrement, " + "username text not null, password text not null, " + "lastupdate text);" + "create table user (_id integer primary key autoincrement, " + "firstname text not null, " + "lastname text not null);" + "create table phone (_phoneid integer primary key autoincrement, " + "userid integer not null, phonetype text not null, " + "phonenumber text not null);" + "create table email (_emailid integer primary key autoincrement, " + "userid integer not null, emailtype text not null, " + "emailaddress text not null);" + "create table address (_addressid integer primary key autoincrement," + "userid integer not null, addresstype text not null, " + "address text not null);" + "create table instantmessaging (_imid integer primary key autoincrement, " + "userid integer not null, imtype text not null, " + "imaccount text not null);"; I've been pouring over this and I bet its some silly syntax typo! Or, at least I hope it is something trivial ;-) Craig

    Read the article

< Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >