Search Results

Search found 39398 results on 1576 pages for 'onet two'.

Page 183/1576 | < Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >

  • Recommended textbook for machine-level programming?

    - by Norman Ramsey
    I'm looking at textbooks for an undergraduate course in machine-level programming. If the perfect book existed, this is what it would look like: Uses examples written in C or assembly language, or both. Covers machine-level operations such as two's-complement integer arithmetic, bitwise operations, and floating-point arithmetic. Explains how caches work and how they affect performance. Explains machine instructions or assembly instructions. Bonus if the example assembly language includes x86; triple bonus if it includes x86-64 (aka AMD64). Explains how C values and data structures are represented using hardware registers and memory. Explains how C control structures are translated into assembly language using conditional and unconditional branch instructions. Explains something about procedure calling conventions and how procedure calls are implemented at the machine level. Books I might be interested in would probably have the words "machine organization" or "computer architecture" in the title. Here are some books I'm considering but am not quite happy with: Computer Systems: A Programmer's Perspective by Randy Bryant and Dave O'Hallaron. This is quite a nice book, but it's a book for a broad, shallow course in systems programming, and it contains a great deal of material my students don't need. Also, it is just out in a second edition, which will make it expensive. Computer Organization and Design: The Hardware/Software Interface by Dave Patterson and John Hennessy. This is also a very nice book, but it contains way more information about how the hardware works than my students need. Also, the exercises look boring. Finally, it has a show-stopping bug: it is based very heavily on MIPS hardware and the use of a MIPS simulator. My students need to learn how to use DDD, and I can't see getting this to work on a simulator. Not to mention that I can't see them cross-compiling their code for the simulator, and so on and so forth. Another flaw is that the book mentions the x86 architecture only to sneer at it. I am entirely sympathetic to this point of view, but news flash! You guys lost! Write Great Code Vol I: Understanding the Machine by Randall Hyde. I haven't evaluated this book as thoroughly as the other two. It has a lot of what I need, but the translation from high-level language to assembler is deferred to Volume Two, which has mixed reviews. My students will be annoyed if I make them buy a two-volume series, even if the price of those two volumes is smaller than the price of other books. I would really welcome other suggestions of books that would help students in a class where they are to learn how C-language data structures and code are translated to machine-level data structures and code and where they learn how to think about performance, with an emphasis on the cache.

    Read the article

  • Information Gain and Entropy

    - by dhorn
    I recently read this question regarding information gain and entropy. I think I have a semi-decent grasp on the main idea, but I'm curious as what to do with situations such as follows: If we have a bag of 7 coins, 1 of which is heavier than the others, and 1 of which is lighter than the others, and we know the heavier coin + the lighter coin is the same as 2 normal coins, what is the information gain associated with picking two random coins and weighing them against each other? Our goal here is to identify the two odd coins. I've been thinking this problem over for a while, and can't frame it correctly in a decision tree, or any other way for that matter. Any help? EDIT: I understand the formula for entropy and the formula for information gain. What I don't understand is how to frame this problem in a decision tree format. EDIT 2: Here is where I'm at so far: Assuming we pick two coins and they both end up weighing the same, we can assume our new chances of picking H+L come out to 1/5 * 1/4 = 1/20 , easy enough. Assuming we pick two coins and the left side is heavier. There are three different cases where this can occur: HM: Which gives us 1/2 chance of picking H and a 1/4 chance of picking L: 1/8 HL: 1/2 chance of picking high, 1/1 chance of picking low: 1/1 ML: 1/2 chance of picking low, 1/4 chance of picking high: 1/8 However, the odds of us picking HM are 1/7 * 5/6 which is 5/42 The odds of us picking HL are 1/7 * 1/6 which is 1/42 And the odds of us picking ML are 1/7 * 5/6 which is 5/42 If we weight the overall probabilities with these odds, we are given: (1/8) * (5/42) + (1/1) * (1/42) + (1/8) * (5/42) = 3/56. The same holds true for option B. option A = 3/56 option B = 3/56 option C = 1/20 However, option C should be weighted heavier because there is a 5/7 * 4/6 chance to pick two mediums. So I'm assuming from here I weight THOSE odds. I am pretty sure I've messed up somewhere along the way, but I think I'm on the right path! EDIT 3: More stuff. Assuming the scale is unbalanced, the odds are (10/11) that only one of the coins is the H or L coin, and (1/11) that both coins are H/L Therefore we can conclude: (10 / 11) * (1/2 * 1/5) and (1 / 11) * (1/2) EDIT 4: Going to go ahead and say that it is a total 4/42 increase.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Calculate total time between Dates in Hours and Minutes

    - by matthew parkes
    Hi I’m trying to resolve a problem using VB and I need some assistance. I’m very new to the language (1 week). The problem is I have created a user form to show how many hours and minutes has elapsed between two different times similar to a time sheet. The user form consists of two calendars, and under each calendar there are two text boxes; one box each to record the Hour and Minute they left and two further boxes to record the time they arrived back. I have used the code to minus the calendars together (e.g calendar in – calendar out) then times this by 24 to indicate the hours away. Then under the calendar out I have a text box for the user to type in the hour they left. Then I minus the 24 by the Hour out e.g. if it was 24 -15 it will appear 9 ( 9 hours of that day ) then I would add that to the figure they inserted in the text box Hour in (Return Time). e.g 14. Then I would add them to together e.g. 9 + 14 = 23 and have this displayed in another text box Total Hours. Therefore it would display 23 meaning 23 hours. I have then want to show another two text boxes to indicate minutes. One for Minutes Out then Minutes In. I have the problem to convert these minutes for instance if it is the out time is 15:50 and the in time the next day is at 15:55 it displays as 24 (in one text box) and 105 minutes (in the other text box). I would like the minutes added to the hour and have the balance of the remaining minutes in the minute text box. This should display 24 (in one text box) and 5 (in another text box). The ultimate aim is to get a result that shows a person was absent for a number of days, hours and minutes, eg, 2 days, 5 hours and 10 minutes. Any ideas on how I can modify my code to achieve this? Here’s my code. Please Help Dim number1 As Date Dim number2 As Date Dim number3 As Integer Dim number4 As Integer Dim Number5 As Integer Dim Number6 As Integer Dim answer As Integer Dim answer2 As Integer Dim answer3 As Integer Dim answer4 As Integer Dim answer5 As String number1 = DTPicker1 number2 = DTPicker2 number3 = Txthourout number4 = TxtHourin Number5 = TxtMinuteout Number6 = TxtMinuetIn answer = number2 - number1 answer2 = answer * 24 answer3 = answer2 - number3 answer4 = answer3 + number4 answer5 = Number5 + Number6 TextBox1.Text = answer4 TextBox2.Text = answer5 End Sub

    Read the article

  • mod_rewrite not working for a specific directory

    - by punkish
    This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

    Read the article

  • Oracle Coherence, Split-Brain and Recovery Protocols In Detail

    - by Ricardo Ferreira
    This article provides a high level conceptual overview of Split-Brain scenarios in distributed systems. It will focus on a specific example of cluster communication failure and recovery in Oracle Coherence. This includes a discussion on the witness protocol (used to remove failed cluster members) and the panic protocol (used to resolve Split-Brain scenarios). Note that the removal of cluster members does not necessarily indicate a Split-Brain condition. Oracle Coherence does not (and cannot) detect a Split-Brain as it occurs, the condition is only detected when cluster members that previously lost contact with each other regain contact. Cluster Topology and Configuration In order to create an good didactic for the article, let's assume a cluster topology and configuration. In this example we have a six member cluster, consisting of one JVM on each physical machine. The member IDs are as follows: Member ID  IP Address  1  10.149.155.76  2  10.149.155.77  3  10.149.155.236  4  10.149.155.75  5  10.149.155.79  6  10.149.155.78 Members 1, 2, and 3 are connected to a switch, and members 4, 5, and 6 are connected to a second switch. There is a link between the two switches, which provides network connectivity between all of the machines. Member 1 is the first member to join this cluster, thus making it the senior member. Member 6 is the last member to join this cluster. Here is a log snippet from Member 6 showing the complete member set: 2010-02-26 15:27:57.390/3.062 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=main, member=6): Started DefaultCacheServer... SafeCluster: Name=cluster:0xDDEB Group{Address=224.3.5.3, Port=35465, TTL=4} MasterMemberSet ( ThisMember=Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) OldestMember=Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) ActualMemberSet=MemberSet(Size=6, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=5, Timestamp=2010-02-26 15:27:49.095, Address=10.149.155.79:8088, MachineId=1103, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:3229, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) RecycleMillis=120000 RecycleSet=MemberSet(Size=0, BitSetCount=0 ) ) At approximately 15:30, the connection between the two switches is severed: Thirty seconds later (the default packet timeout in development mode) the logs indicate communication failures across the cluster. In this example, the communication failure was caused by a network failure. In a production setting, this type of communication failure can have many root causes, including (but not limited to) network failures, excessive GC, high CPU utilization, swapping/virtual memory, and exceeding maximum network bandwidth. In addition, this type of failure is not necessarily indicative of a split brain. Any communication failure will be logged in this fashion. Member 2 logs a communication failure with Member 5: 2010-02-26 15:30:32.638/196.928 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=2): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=5, Timestamp=2010-02-26 15:27:49.095, Address=10.149.155.79:8088, MachineId=1103, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:3229, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) ) The Coherence clustering protocol (TCMP) is a reliable transport mechanism built on UDP. In order for the protocol to be reliable, it requires an acknowledgement (ACK) for each packet delivered. If a packet fails to be acknowledged within the configured timeout period, the Coherence cluster member will log a packet timeout (as seen in the log message above). When this occurs, the cluster member will consult with other members to determine who is at fault for the communication failure. If the witness members agree that the suspect member is at fault, the suspect is removed from the cluster. If the witnesses unanimously disagree, the accuser is removed. This process is known as the witness protocol. Since Member 2 cannot communicate with Member 5, it selects two witnesses (Members 1 and 4) to determine if the communication issue is with Member 5 or with itself (Member 2). However, Member 4 is on the switch that is no longer accessible by Members 1, 2 and 3; thus a packet timeout for member 4 is recorded as well: 2010-02-26 15:30:35.648/199.938 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=2): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) Member 1 has the ability to confirm the departure of member 4, however Member 6 cannot as it is also inaccessible. At the same time, Member 3 sends a request to remove Member 6, which is followed by a report from Member 3 indicating that Member 6 has departed the cluster: 2010-02-26 15:30:35.706/199.996 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=2): MemberLeft request for Member 6 received from Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) 2010-02-26 15:30:35.709/199.999 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=2): MemberLeft notification for Member 6 received from Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) The log for Member 3 determines how Member 6 departed the cluster: 2010-02-26 15:30:35.161/191.694 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=3): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) ) 2010-02-26 15:30:35.165/191.698 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=3): Member departure confirmed by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) ); removing Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) In this case, Member 3 happened to select two witnesses that it still had connectivity with (Members 1 and 2) thus resulting in a simple decision to remove Member 6. Given the departure of Member 6, Member 2 is left with a single witness to confirm the departure of Member 4: 2010-02-26 15:30:35.713/200.003 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=2): Member departure confirmed by MemberSet(Size=1, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) ); removing Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) In the meantime, Member 4 logs a missing heartbeat from the senior member. This message is also logged on Members 5 and 6. 2010-02-26 15:30:07.906/150.453 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=PacketListenerN, member=4): Scheduled senior member heartbeat is overdue; rejoining multicast group. Next, Member 4 logs a TcpRing failure with Member 2, thus resulting in the termination of Member 2: 2010-02-26 15:30:21.421/163.968 Oracle Coherence GE 3.5.3/465p2 <D4> (thread=Cluster, member=4): TcpRing: Number of socket exceptions exceeded maximum; last was "java.net.SocketTimeoutException: connect timed out"; removing the member: 2 For quick process termination detection, Oracle Coherence utilizes a feature called TcpRing which is a sparse collection of TCP/IP-based connections between different members in the cluster. Each member in the cluster is connected to at least one other member, which (if at all possible) is running on a different physical box. This connection is not used for any data transfer, only heartbeat communications are sent once a second per each link. If a certain number of exceptions are thrown while trying to re-establish a connection, the member throwing the exceptions is removed from the cluster. Member 5 logs a packet timeout with Member 3 and cites witnesses Members 4 and 6: 2010-02-26 15:30:29.791/165.037 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=5): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) 2010-02-26 15:30:29.798/165.044 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=5): Member departure confirmed by MemberSet(Size=2, BitSetCount=2 Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ); removing Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) Eventually we are left with two distinct clusters consisting of Members 1, 2, 3 and Members 4, 5, 6, respectively. In the latter cluster, Member 4 is promoted to senior member. The connection between the two switches is restored at 15:33. Upon the restoration of the connection, the cluster members immediately receive cluster heartbeats from the two senior members. In the case of Members 1, 2, and 3, the following is logged: 2010-02-26 15:33:14.970/369.066 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=1): The member formerly known as Member(Id=4, Timestamp=2010-02-26 15:30:35.341, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) has been forcefully evicted from the cluster, but continues to emit a cluster heartbeat; henceforth, the member will be shunned and its messages will be ignored. Likewise for Members 4, 5, and 6: 2010-02-26 15:33:14.343/336.890 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=4): The member formerly known as Member(Id=1, Timestamp=2010-02-26 15:30:31.64, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) has been forcefully evicted from the cluster, but continues to emit a cluster heartbeat; henceforth, the member will be shunned and its messages will be ignored. This message indicates that a senior heartbeat is being received from members that were previously removed from the cluster, in other words, something that should not be possible. For this reason, the recipients of these messages will initially ignore them. After several iterations of these messages, the existence of multiple clusters is acknowledged, thus triggering the panic protocol to reconcile this situation. When the presence of more than one cluster (i.e. Split-Brain) is detected by a Coherence member, the panic protocol is invoked in order to resolve the conflicting clusters and consolidate into a single cluster. The protocol consists of the removal of smaller clusters until there is one cluster remaining. In the case of equal size clusters, the one with the older Senior Member will survive. Member 1, being the oldest member, initiates the protocol: 2010-02-26 15:33:45.970/400.066 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=1): An existence of a cluster island with senior Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) containing 3 nodes have been detected. Since this Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) is the senior of an older cluster island, the panic protocol is being activated to stop the other island's senior and all junior nodes that belong to it. Member 3 receives the panic: 2010-02-26 15:33:45.803/382.336 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=3): Received panic from senior Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) caused by Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member 4, the senior member of the younger cluster, receives the kill message from Member 3: 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. In turn, Member 4 requests the departure of its junior members 5 and 6: 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. 2010-02-26 15:33:43.343/349.015 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=6): Received a Kill message from a valid Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer); stopping cluster service. Once Members 4, 5, and 6 restart, they rejoin the original cluster with senior member 1. The log below is from Member 4. Note that it receives a different member id when it rejoins the cluster. 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. 2010-02-26 15:33:46.921/369.468 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Service Cluster left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Invocation:InvocationService, member=4): Service InvocationService left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=OptimisticCache, member=4): Service OptimisticCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=ReplicatedCache, member=4): Service ReplicatedCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=DistributedCache, member=4): Service DistributedCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Invocation:Management, member=4): Service Management left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service Management with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service DistributedCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service ReplicatedCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service OptimisticCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service InvocationService with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member(Id=6, Timestamp=2010-02-26 15:33:47.046, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) left Cluster with senior member 4 2010-02-26 15:33:49.218/371.765 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=main, member=n/a): Restarting cluster 2010-02-26 15:33:49.421/371.968 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=n/a): Service Cluster joined the cluster with senior service member n/a 2010-02-26 15:33:49.625/372.172 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=n/a): This Member(Id=5, Timestamp=2010-02-26 15:33:50.499, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer, Edition=Grid Edition, Mode=Development, CpuCount=2, SocketCount=1) joined cluster "cluster:0xDDEB" with senior Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer, Edition=Grid Edition, Mode=Development, CpuCount=2, SocketCount=2) Cool isn't it?

    Read the article

  • What Every Developer Should Know About MSI Components

    - by Alois Kraus
    Hopefully nothing. But if you have to do more than simple XCopy deployment and you need to support updates, upgrades and perhaps side by side scenarios there is no way around MSI. You can create Msi files with a Visual Studio Setup project which is severely limited or you can use the Windows Installer Toolset. I cannot talk about WIX with my German colleagues because WIX has a very special meaning. It is funny to always use the long name when I talk about deployment possibilities. Alternatively you can buy commercial tools which help you to author Msi files but I am not sure how good they are. Given enough pain with existing solutions you can also learn the MSI Apis and create your own packaging solution. If I were you I would use either a commercial visual tool when you do easy deployments or use the free Windows Installer Toolset. Once you know the WIX schema you can create well formed wix xml files easily with any editor. Then you can “compile” from the wxs files your Msi package. Recently I had the “pleasure” to get my hands dirty with C++ (again) and the MSI technology. Installation is a complex topic but after several month of digging into arcane MSI issues I can safely say that there should exist an easier way to install and update files as today. I am not alone with this statement as John Robbins (creator of the cool tool Paraffin) states: “.. It's a brittle and scary API in Windows …”. To help other people struggling with installation issues I present you the advice I (and others) found useful and what will happen if you ignore this advice. What is a MSI file? A MSI file is basically a database with tables which reference each other to control how your un/installation should work. The basic idea is that you declare via these tables what you want to install and MSI controls the how to get your stuff onto or off your machine. Your “stuff” consists usually of files, registry keys, shortcuts and environment variables. Therefore the most important tables are File, Registry, Environment and Shortcut table which define what will be un/installed. The key to master MSI is that every resource (file, registry key ,…) is associated with a MSI component. The actual payload consists of compressed files in the CAB format which can either be embedded into the MSI file or reside beside the MSI file or in a subdirectory below it. To examine MSI files you need Orca a free MSI editor provided by MS. There is also another free editor called Super Orca which does support diffs between MSI and it does not lock the MSI files. But since Orca comes with a shell extension I tend to use only Orca because it is so easy to right click on a MSI file and open it with this tool. How Do I Install It? Double click it. This does work for fresh installations as well as major upgrades. Updates need to be installed via the command line via msiexec /i <msi> REINSTALL=ALL REINSTALLMODE=vomus   This tells the installer to reinstall all already installed features (new features will NOT be installed). The reinstallmode letters do force an overwrite of the old cached package in the %WINDIR%\Installer folder. All files, shortcuts and registry keys are redeployed if they are missing or need to be replaced with a newer version. When things did go really wrong and you want to overwrite everything unconditionally use REINSTALLMODE=vamus. How To Enable MSI Logs? You can download a MSI from Microsoft which installs some registry keys to enable full MSI logging. The log files can be found in your %TEMP% folder and are called MSIxxxx.log. Alternatively you can add to your msiexec command line the option msiexec …. /l*vx <LogFileName> Personally I find it rather strange that * does not mean full logging. To really get all logs I need to add v and x which is documented in the msiexec help but I still find this behavior unintuitive. What are MSI components? The whole MSI logic is bound to the concept of MSI components. Nearly every msi table has a Component column which binds an installable resource to a component. Below are the screenshots of the FeatureComponents and Component table of an example MSI. The Feature table defines basically the feature hierarchy.  To find out what belongs to a feature you need to look at the FeatureComponents table where for each feature the components are listed which will be installed when a feature is installed. The MSI components are defined in the  Component table. This table has as first column the component name and as second column the component id which is a GUID. All resources you want to install belong to a MSI component. Therefore nearly all MSI tables have a Component_ column which contains the component name. If you look e.g. a the File table you see that every file belongs to a component which is true for all other tables which install resources. The component table is the glue between all other tables which contain the resources you want to install. So far so easy. Why is MSI then so complex? Most MSI problems arise from the fact that you did violate a MSI component rule in one or the other way. When you install a feature the reference count for all components belonging to this feature will increase by one. If your component is installed by more than one feature it will get a higher refcount. When you uninstall a feature its refcount will drop by one. Interesting things happen if the component reference count reaches zero: Then all associated resources will be deleted. That looks like a reasonable thing and it is. What it makes complex are the strange component rules you have to follow. Below are some important component rules from the Tao of the Windows Installer … Rule 16: Follow Component Rules Components are a very important part of the Installer technology. They are the means whereby the Installer manages the resources that make up your application. The SDK provides the following guidelines for creating components in your package: Never create two components that install a resource under the same name and target location. If a resource must be duplicated in multiple components, change its name or target location in each component. This rule should be applied across applications, products, product versions, and companies. Two components must not have the same key path file. This is a consequence of the previous rule. The key path value points to a particular file or folder belonging to the component that the installer uses to detect the component. If two components had the same key path file, the installer would be unable to distinguish which component is installed. Two components however may share a key path folder. Do not create a version of a component that is incompatible with all previous versions of the component. This rule should be applied across applications, products, product versions, and companies. Do not create components containing resources that will need to be installed into more than one directory on the user’s system. The installer installs all of the resources in a component into the same directory. It is not possible to install some resources into subdirectories. Do not include more than one COM server per component. If a component contains a COM server, this must be the key path for the component. Do not specify more than one file per component as a target for the Start menu or a Desktop shortcut. … And these rules do not even talk about component ids, update packages and upgrades which you need to understand as well. Lets suppose you install two MSIs (MSI1 and MSI2) which have the same ComponentId but different component names. Both do install the same file. What will happen when you uninstall MSI2?   Hm the file should stay there. But the component names are different. Yes and yes. But MSI uses not use the component name as key for the refcount. Instead the ComponentId column of the Component table which contains a GUID is used as identifier under which the refcount is stored. The components Comp1 and Comp2 are identical from the MSI perspective. After the installation of both MSIs the Component with the Id {100000….} has a refcount of two. After uninstallation of one MSI there is still a refcount of one which drops to zero just as expected when we uninstall the last msi. Then the file which was the same for both MSIs is deleted. You should remember that MSI keeps a refcount across MSIs for components with the same component id. MSI does manage components not the resources you did install. The resources associated with a component are then and only then deleted when the refcount of the component reaches zero.   The dependencies between features, components and resources can be described as relations. m,k are numbers >= 1, n can be 0. Inside a MSI the following relations are valid Feature    1  –> n Components Component    1 –> m Features Component      1  –>  k Resources These relations express that one feature can install several components and features can share components between them. Every (meaningful) component will install at least one resource which means that its name (primary key to stay in database speak) does occur in some other table in the Component column as value which installs some resource. Lets make it clear with an example. We want to install with the feature MainFeature some files a registry key and a shortcut. We can then create components Comp1..3 which are referenced by the resources defined in the corresponding tables.   Feature Component Registry File Shortcuts MainFeature Comp1 RegistryKey1     MainFeature Comp2   File.txt   MainFeature Comp3   File2.txt Shortcut to File2.txt   It is illegal that the same resource is part of more than one component since this would break the refcount mechanism. Lets illustrate this:            Feature ComponentId Resource Reference Count Feature1 {1000-…} File1.txt 1 Feature2 {2000-….} File1.txt 1 The installation part works well but what happens when you uninstall Feature2? Component {20000…} gets a refcount of zero where MSI deletes all resources belonging to this component. In this case File1.txt will be deleted. But Feature1 still has another component {10000…} with a refcount of one which means that the file was deleted too early. You just have ruined your installation. To fix it you then need to click on the Repair button under Add/Remove Programs to let MSI reinstall any missing registry keys, files or shortcuts. The vigilant reader might has noticed that there is more in the Component table. Beside its name and GUID it has also an installation directory, attributes and a KeyPath. The KeyPath is a reference to a file or registry key which is used to detect if the component is already installed. This becomes important when you repair or uninstall a component. To find out if the component is already installed MSI checks if the registry key or file referenced by the KeyPath property does exist. When it does not exist it assumes that it was either already uninstalled (can lead to problems during uninstall) or that it is already installed and all is fine. Why is this detail so important? Lets put all files into one component. The KeyPath should be then one of the files of your component to check if it was installed or not. When your installation becomes corrupt because a file was deleted you cannot repair it with the Repair button under Add/Remove Programs because MSI checks the component integrity via the Resource referenced by its KeyPath. As long as you did not delete the KeyPath file MSI thinks all resources with your component are installed and never executes any repair action. You get even more trouble when you try to remove files during an upgrade (you cannot remove files during an update) from your super component which contains all files. The only way out and therefore best practice is to assign for every resource you want to install an extra component. This ensures painless updatability and repairs and you have much less effort to remove specific files during an upgrade. In effect you get this best practice relation Feature 1  –> n Components Component   1  –>  1 Resources MSI Component Rules Rule 1 – One component per resource Every resource you want to install (file, registry key, value, environment value, shortcut, directory, …) must get its own component which does never change between versions as long as the install location is the same. Penalty If you add more than one resources to a component you will break the repair capability of MSI because the KeyPath is used to check if the component needs repair. MSI ComponentId Files MSI 1.0 {1000} File1-5 MSI 2.0 {2000} File2-5 You want to remove File1 in version 2.0 of your MSI. Since you want to keep the other files you create a new component and add them there. MSI will delete all files if the component refcount of {1000} drops to zero. The files you want to keep are added to the new component {2000}. Ok that does work if your upgrade does uninstall the old MSI first. This will cause the refcount of all previously installed components to reach zero which means that all files present in version 1.0 are deleted. But there is a faster way to perform your upgrade by first installing your new MSI and then remove the old one.  If you choose this upgrade path then you will loose File1-5 after your upgrade and not only File1 as intended by your new component design.   Rule 2 – Only add, never remove resources from a component If you did follow rule 1 you will not need Rule 2. You can add in a patch more resources to one component. That is ok. But you can never remove anything from it. There are tricky ways around that but I do not want to encourage bad component design. Penalty Lets assume you have 2 MSI files which install under the same component one file   MSI1 MSI2 {1000} - ComponentId {1000} – ComponentId File1.txt File2.txt   When you install and uninstall both MSIs you will end up with an installation where either File1 or File2 will be left. Why? It seems that MSI does not store the resources associated with each component in its internal database. Instead Windows will simply query the MSI that is currently uninstalled for all resources belonging to this component. Since it will find only one file and not two it will only uninstall one file. That is the main reason why you never can remove resources from a component!   Rule 3 Never Remove A Component From an Update MSI. This is the same as if you change the GUID of a component by accident for your new update package. The resulting update package will not contain all components from the previously installed package. Penalty When you remove a component from a feature MSI will set the feature state during update to Advertised and log a warning message into its log file when you did enable MSI logging. SELMGR: ComponentId '{2DCEA1BA-3E27-E222-484C-D0D66AEA4F62}' is registered to feature 'xxxxxxx, but is not present in the Component table.  Removal of components from a feature is not supported! MSI (c) (24:44) [07:53:13:436]: SELMGR: Removal of a component from a feature is not supported Advertised means that MSI treats all components of this feature as not installed. As a consequence during uninstall nothing will be removed since it is not installed! This is not only bad because uninstall does no longer work but this feature will also not get the required patches. All other features which have followed component versioning rules for update packages will be updated but the one faulty feature will not. This results in very hard to find bugs why an update was only partially successful. Things got better with Windows Installer 4.5 but you cannot rely on that nobody will use an older installer. It is a good idea to add to your update msiexec call MSIENFORCEUPGRADECOMPONENTRULES=1 which will abort the installation if you did violate this rule.

    Read the article

  • Developing Spring Portlet for use inside Weblogic Portal / Webcenter Portal

    - by Murali Veligeti
    We need to understand the main difference between portlet workflow and servlet workflow.The main difference between portlet workflow and servlet workflow is that, the request to the portlet can have two distinct phases: 1) Action phase 2) Render phase. The Action phase is executed only once and is where any 'backend' changes or actions occur, such as making changes in a database. The Render phase then produces what is displayed to the user each time the display is refreshed. The critical point here is that for a single overall request, the action phase is executed only once, but the render phase may be executed multiple times. This provides a clean separation between the activities that modify the persistent state of your system and the activities that generate what is displayed to the user.The dual phases of portlet requests are one of the real strengths of the JSR-168 specification. For example, dynamic search results can be updated routinely on the display without the user explicitly re-running the search. Most other portlet MVC frameworks attempt to completely hide the two phases from the developer and make it look as much like traditional servlet development as possible - we think this approach removes one of the main benefits of using portlets. So, the separation of the two phases is preserved throughout the Spring Portlet MVC framework. The primary manifestation of this approach is that where the servlet version of the MVC classes will have one method that deals with the request, the portlet version of the MVC classes will have two methods that deal with the request: one for the action phase and one for the render phase. For example, where the servlet version of AbstractController has the handleRequestInternal(..) method, the portlet version of AbstractController has handleActionRequestInternal(..) and handleRenderRequestInternal(..) methods.The Spring Portlet Framework is designed around a DispatcherPortlet that dispatches requests to handlers, with configurable handler mappings and view resolution, just as the DispatcherServlet in the Spring Web Framework does.  Developing portlet.xml Let's start the sample development by creating the portlet.xml file in the /WebContent/WEB-INF/ folder as shown below: <?xml version="1.0" encoding="UTF-8"?> <portlet-app version="2.0" xmlns="http://java.sun.com/xml/ns/portlet/portlet-app_2_0.xsd" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <portlet> <portlet-name>SpringPortletName</portlet-name> <portlet-class>org.springframework.web.portlet.DispatcherPortlet</portlet-class> <supports> <mime-type>text/html</mime-type> <portlet-mode>view</portlet-mode> </supports> <portlet-info> <title>SpringPortlet</title> </portlet-info> </portlet> </portlet-app> DispatcherPortlet is responsible for handling every client request. When it receives a request, it finds out which Controller class should be used for handling this request, and then it calls its handleActionRequest() or handleRenderRequest() method based on the request processing phase. The Controller class executes business logic and returns a View name that should be used for rendering markup to the user. The DispatcherPortlet then forwards control to that View for actual markup generation. As you can see, DispatcherPortlet is the central dispatcher for use within Spring Portlet MVC Framework. Note that your portlet application can define more than one DispatcherPortlet. If it does so, then each of these portlets operates its own namespace, loading its application context and handler mapping. The DispatcherPortlet is also responsible for loading application context (Spring configuration file) for this portlet. First, it tries to check the value of the configLocation portlet initialization parameter. If that parameter is not specified, it takes the portlet name (that is, the value of the <portlet-name> element), appends "-portlet.xml" to it, and tries to load that file from the /WEB-INF folder. In the portlet.xml file, we did not specify the configLocation initialization parameter, so let's create SpringPortletName-portlet.xml file in the next section. Developing SpringPortletName-portlet.xml Create the SpringPortletName-portlet.xml file in the /WebContent/WEB-INF folder of your application as shown below: <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.0.xsd"> <bean id="viewResolver" class="org.springframework.web.servlet.view.InternalResourceViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView"/> <property name="prefix" value="/jsp/"/> <property name="suffix" value=".jsp"/> </bean> <bean id="pointManager" class="com.wlp.spring.bo.internal.PointManagerImpl"> <property name="users"> <list> <ref bean="point1"/> <ref bean="point2"/> <ref bean="point3"/> <ref bean="point4"/> </list> </property> </bean> <bean id="point1" class="com.wlp.spring.bean.User"> <property name="name" value="Murali"/> <property name="points" value="6"/> </bean> <bean id="point2" class="com.wlp.spring.bean.User"> <property name="name" value="Sai"/> <property name="points" value="13"/> </bean> <bean id="point3" class="com.wlp.spring.bean.User"> <property name="name" value="Rama"/> <property name="points" value="43"/> </bean> <bean id="point4" class="com.wlp.spring.bean.User"> <property name="name" value="Krishna"/> <property name="points" value="23"/> </bean> <bean id="messageSource" class="org.springframework.context.support.ResourceBundleMessageSource"> <property name="basename" value="messages"/> </bean> <bean name="/users.htm" id="userController" class="com.wlp.spring.controller.UserController"> <property name="pointManager" ref="pointManager"/> </bean> <bean name="/pointincrease.htm" id="pointIncreaseController" class="com.wlp.spring.controller.IncreasePointsFormController"> <property name="sessionForm" value="true"/> <property name="pointManager" ref="pointManager"/> <property name="commandName" value="pointIncrease"/> <property name="commandClass" value="com.wlp.spring.bean.PointIncrease"/> <property name="formView" value="pointincrease"/> <property name="successView" value="users"/> </bean> <bean id="parameterMappingInterceptor" class="org.springframework.web.portlet.handler.ParameterMappingInterceptor" /> <bean id="portletModeParameterHandlerMapping" class="org.springframework.web.portlet.handler.PortletModeParameterHandlerMapping"> <property name="order" value="1" /> <property name="interceptors"> <list> <ref bean="parameterMappingInterceptor" /> </list> </property> <property name="portletModeParameterMap"> <map> <entry key="view"> <map> <entry key="pointincrease"> <ref bean="pointIncreaseController" /> </entry> <entry key="users"> <ref bean="userController" /> </entry> </map> </entry> </map> </property> </bean> <bean id="portletModeHandlerMapping" class="org.springframework.web.portlet.handler.PortletModeHandlerMapping"> <property name="order" value="2" /> <property name="portletModeMap"> <map> <entry key="view"> <ref bean="userController" /> </entry> </map> </property> </bean> </beans> The SpringPortletName-portlet.xml file is an application context file for your MVC portlet. It has a couple of bean definitions: viewController. At this point, remember that the viewController bean definition points to the com.ibm.developerworks.springmvc.ViewController.java class. portletModeHandlerMapping. As we discussed in the last section, whenever DispatcherPortlet gets a client request, it tries to find a suitable Controller class for handling that request. That is where PortletModeHandlerMapping comes into the picture. The PortletModeHandlerMapping class is a simple implementation of the HandlerMapping interface and is used by DispatcherPortlet to find a suitable Controller for every request. The PortletModeHandlerMapping class uses Portlet mode for the current request to find a suitable Controller class to use for handling the request. The portletModeMap property of portletModeHandlerMapping bean is the place where we map the Portlet mode name against the Controller class. In the sample code, we show that viewController is responsible for handling View mode requests. Developing UserController.java In the preceding section, you learned that the viewController bean is responsible for handling all the View mode requests. Your next step is to create the UserController.java class as shown below: public class UserController extends AbstractController { private PointManager pointManager; public void handleActionRequest(ActionRequest request, ActionResponse response) throws Exception { } public ModelAndView handleRenderRequest(RenderRequest request, RenderResponse response) throws ServletException, IOException { String now = (new java.util.Date()).toString(); Map<String, Object> myModel = new HashMap<String, Object>(); myModel.put("now", now); myModel.put("users", this.pointManager.getUsers()); return new ModelAndView("users", "model", myModel); } public void setPointManager(PointManager pointManager) { this.pointManager = pointManager; } } Every controller class in Spring Portlet MVC Framework must implement the org.springframework.web. portlet.mvc.Controller interface directly or indirectly. To make things easier, Spring Framework provides AbstractController class, which is the default implementation of the Controller interface. As a developer, you should always extend your controller from either AbstractController or one of its more specific subclasses. Any implementation of the Controller class should be reusable, thread-safe, and capable of handling multiple requests throughout the lifecycle of the portlet. In the sample code, we create the ViewController class by extending it from AbstractController. Because we don't want to do any action processing in the HelloSpringPortletMVC portlet, we override only the handleRenderRequest() method of AbstractController. Now, the only thing that HelloWorldPortletMVC should do is render the markup of View.jsp to the user when it receives a user request to do so. To do that, return the object of ModelAndView with a value of view equal to View. Developing web.xml According to Portlet Specification 1.0, every portlet application is also a Servlet Specification 2.3-compliant Web application, and it needs a Web application deployment descriptor (that is, web.xml). Let’s create the web.xml file in the /WEB-INF/ folder as shown in listing 4. Follow these steps: Open the existing web.xml file located at /WebContent/WEB-INF/web.xml. Replace the contents of this file with the code as shown below: <servlet> <servlet-name>ViewRendererServlet</servlet-name> <servlet-class>org.springframework.web.servlet.ViewRendererServlet</servlet-class> </servlet> <servlet-mapping> <servlet-name>ViewRendererServlet</servlet-name> <url-pattern>/WEB-INF/servlet/view</url-pattern> </servlet-mapping> <context-param> <param-name>contextConfigLocation</param-name> <param-value>/WEB-INF/applicationContext.xml</param-value> </context-param> <listener> <listener-class>org.springframework.web.context.ContextLoaderListener</listener-class> </listener> The web.xml file for the sample portlet declares two things: ViewRendererServlet. The ViewRendererServlet is the bridge servlet for portlet support. During the render phase, DispatcherPortlet wraps PortletRequest into ServletRequest and forwards control to ViewRendererServlet for actual rendering. This process allows Spring Portlet MVC Framework to use the same View infrastructure as that of its servlet version, that is, Spring Web MVC Framework. ContextLoaderListener. The ContextLoaderListener class takes care of loading Web application context at the time of the Web application startup. The Web application context is shared by all the portlets in the portlet application. In case of duplicate bean definition, the bean definition in the portlet application context takes precedence over the Web application context. The ContextLoader class tries to read the value of the contextConfigLocation Web context parameter to find out the location of the context file. If the contextConfigLocation parameter is not set, then it uses the default value, which is /WEB-INF/applicationContext.xml, to load the context file. The Portlet Controller interface requires two methods that handle the two phases of a portlet request: the action request and the render request. The action phase should be capable of handling an action request and the render phase should be capable of handling a render request and returning an appropriate model and view. While the Controller interface is quite abstract, Spring Portlet MVC offers a lot of controllers that already contain a lot of the functionality you might need – most of these are very similar to controllers from Spring Web MVC. The Controller interface just defines the most common functionality required of every controller - handling an action request, handling a render request, and returning a model and a view. How rendering works As you know, when the user tries to access a page with PointSystemPortletMVC portlet on it or when the user performs some action on any other portlet on that page or tries to refresh that page, a render request is sent to the PointSystemPortletMVC portlet. In the sample code, because DispatcherPortlet is the main portlet class, Weblogic Portal / Webcenter Portal calls its render() method and then the following sequence of events occurs: The render() method of DispatcherPortlet calls the doDispatch() method, which in turn calls the doRender() method. After the doRenderService() method gets control, first it tries to find out the locale of the request by calling the PortletRequest.getLocale() method. This locale is used while making all the locale-related decisions for choices such as which resource bundle should be loaded or which JSP should be displayed to the user based on the locale. After that, the doRenderService() method starts iterating through all the HandlerMapping classes configured for this portlet, calling their getHandler() method to identify the appropriate Controller for handling this request. In the sample code, we have configured only PortletModeHandlerMapping as a HandlerMapping class. The PortletModeHandlerMapping class reads the value of the current portlet mode, and based on that, it finds out, the Controller class that should be used to handle this request. In the sample code, ViewController is configured to handle the View mode request so that the PortletModeHandlerMapping class returns the object of ViewController. After the object of ViewController is returned, the doRenderService() method calls its handleRenderRequestInternal() method. Implementation of the handleRenderRequestInternal() method in ViewController.java is very simple. It logs a message saying that it got control, and then it creates an instance of ModelAndView with a value equal to View and returns it to DispatcherPortlet. After control returns to doRenderService(), the next task is to figure out how to render View. For that, DispatcherPortlet starts iterating through all the ViewResolvers configured in your portlet application, calling their resolveViewName() method. In the sample code we have configured only one ViewResolver, InternalResourceViewResolver. When its resolveViewName() method is called with viewName, it tries to add /WEB-INF/jsp as a prefix to the view name and to add JSP as a suffix. And it checks if /WEB-INF/jsp/View.jsp exists. If it does exist, it returns the object of JstlView wrapping View.jsp. After control is returned to the doRenderService() method, it creates the object PortletRequestDispatcher, which points to /WEB-INF/servlet/view – that is, ViewRendererServlet. Then it sets the object of JstlView in the request and dispatches the request to ViewRendererServlet. After ViewRendererServlet gets control, it reads the JstlView object from the request attribute and creates another RequestDispatcher pointing to the /WEB-INF/jsp/View.jsp URL and passes control to it for actual markup generation. The markup generated by View.jsp is returned to user. At this point, you may question the need for ViewRendererServlet. Why can't DispatcherPortlet directly forward control to View.jsp? Adding ViewRendererServlet in between allows Spring Portlet MVC Framework to reuse the existing View infrastructure. You may appreciate this more when we discuss how easy it is to integrate Apache Tiles Framework with your Spring Portlet MVC Framework. The attached project SpringPortlet.zip should be used to import the project in to your OEPE Workspace. SpringPortlet_Jars.zip contains jar files required for the application. Project is written on Spring 2.5.  The same JSR 168 portlet should work on Webcenter Portal as well.  Downloads: Download WeblogicPotal Project which consists of Spring Portlet. Download Spring Jars In-addition to above you need to download Spring.jar (Spring2.5)

    Read the article

  • Improved appointment rendering in RadScheduler for ASP.NET AJAX, Q1 2010

    Now that Q1 2010 release is out in the wild, we can sit down and discuss some of the changes we decided to make in the new release. One of them is the new appointment rendering of RadScheduler - a potentially breaking change, but a much needed one. If you have problems with your old custom skins, include the old base stylesheet along with your RadScheduler and set EnableEmbeddedBaseStylesheet=false in your RadScheduler. You can find the said base stylesheet attached to this post.   While trying to improve the performance of RadScheduler, I noticed that the number of resources slows down the rendering and overall performance considerably. This had to be expected - the images to support the appointment rounded corners (and the predefined resources) were quite large. However, I didnt take into account that all browsers keep for performance reasons their images uncompressed in memory and with the color depth of the current desktop. A simple calculation later I discovered that the appointment sprite itself is taking 25MB memory when loaded. Add 5 resources to the fray and you have 150MB memory down with a single blow. As it turns out - a sprite image is not a panacea, if it gets too big - dont be afraid to break it in two. The loading time may suffer, but your browser suffers more while rendering a 25MB monster. First I thought of undertaking the aforementioned solution - breaking the appointment sprite in two and thus reducing the two appointment sprites to mere 2MB uncompressed. Then I thought - the rounded corners are small - I can use borders and backgrounds to simulate rounded appointment borders while still keeping the same HTML structure. The gradients can be done with a single 10x50px image plus we have a gain - border colors and backgrounds can be changed on the fly.  I started with five rendering elements at first, then tried with four and finally I settled on only three elements.  Behold the new appointment rendering (quite simple really):       On the left you can see that the first container has only top and bottom borders and a background. In fact, the background isnt even needed since it will be obscured by the elements on top of it. The whole first container is only needed for the four dots that reside in the four corners of the appointment. On top of this container is another one that holds the left and right borders and slightly lighter background to create the illusion of a second lighter border beside the other two. At last on top of all others is placed the text container that also holds the top and bottom borders and the gradient background. On the right you can see the final result - Im quite happy with it and I hope you will be too. After creating the new rendering we took another step further - we decided to use alpha gradients for the resource rendering, thus supporting any color appointments with rounded corners and gradients. You can see some examples below:We plan on adding BorderColor and BackColor properties  to the ResourceStyles definitions for Q1 SP1. However with the new rendering in Q1 2010 we do support BackColor and BorderColor appointment properties - you only need to set AppointmentStyleMode=Default to keep RadScheduler from switching to Simple appointment rendering. Here is one screenshot of RadScheduler with appointments set to different colors: I hope that you will enjoy working with the new appointments in RadScheduler. RadScheduler base stylesheet Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Improved appointment rendering in RadScheduler for ASP.NET AJAX, Q1 2010

    Now that Q1 2010 release is out in the wild, we can sit down and discuss some of the changes we decided to make in the new release. One of them is the new appointment rendering of RadScheduler - a potentially breaking change, but a much needed one. If you have problems with your old custom skins, include the old base stylesheet along with your RadScheduler and set EnableEmbeddedBaseStylesheet=false in your RadScheduler. You can find the said base stylesheet attached to this post.   While trying to improve the performance of RadScheduler, I noticed that the number of resources slows down the rendering and overall performance considerably. This had to be expected - the images to support the appointment rounded corners (and the predefined resources) were quite large. However, I didnt take into account that all browsers keep for performance reasons their images uncompressed in memory and with the color depth of the current desktop. A simple calculation later I discovered that the appointment sprite itself is taking 25MB memory when loaded. Add 5 resources to the fray and you have 150MB memory down with a single blow. As it turns out - a sprite image is not a panacea, if it gets too big - dont be afraid to break it in two. The loading time may suffer, but your browser suffers more while rendering a 25MB monster. First I thought of undertaking the aforementioned solution - breaking the appointment sprite in two and thus reducing the two appointment sprites to mere 2MB uncompressed. Then I thought - the rounded corners are small - I can use borders and backgrounds to simulate rounded appointment borders while still keeping the same HTML structure. The gradients can be done with a single 10x50px image plus we have a gain - border colors and backgrounds can be changed on the fly.  I started with five rendering elements at first, then tried with four and finally I settled on only three elements.  Behold the new appointment rendering (quite simple really):       On the left you can see that the first container has only top and bottom borders and a background. In fact, the background isnt even needed since it will be obscured by the elements on top of it. The whole first container is only needed for the four dots that reside in the four corners of the appointment. On top of this container is another one that holds the left and right borders and slightly lighter background to create the illusion of a second lighter border beside the other two. At last on top of all others is placed the text container that also holds the top and bottom borders and the gradient background. On the right you can see the final result - Im quite happy with it and I hope you will be too. After creating the new rendering we took another step further - we decided to use alpha gradients for the resource rendering, thus supporting any color appointments with rounded corners and gradients. You can see some examples below:We plan on adding BorderColor and BackColor properties  to the ResourceStyles definitions for Q1 SP1. However with the new rendering in Q1 2010 we do support BackColor and BorderColor appointment properties - you only need to set AppointmentStyleMode=Default to keep RadScheduler from switching to Simple appointment rendering. Here is one screenshot of RadScheduler with appointments set to different colors: I hope that you will enjoy working with the new appointments in RadScheduler. RadScheduler base stylesheet Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Search Alternative Search Engines from within Bing’s Search Page

    - by Asian Angel
    So you love using Bing Search but may still be curious to see what another search engine will provide if used. Now you can search using another search engine from within the Bing Search page and enjoy numbered results using two simple user scripts. Note: These user scripts may also be added to other browsers as well (i.e. Iron, Opera, etc.). Before Bing Search does nicely on searches but what if you would like to try the same search with another search engine? Having to manually open a new tab, navigate to the appropriate website, and then start a new search is not too convenient. Another possible frustration for some people may be knowing just how many search results that they have looked through. Well, both of these small problems are easy to fix with two wonderful user scripts. Installing the Scripts The first script that we installed (you may do either one first) was for adding alternative search engine links. Click “Install” to get started… Note: For our example we had the Greasemonkey extension installed. When the confirmation window pops up click on “Install” to finish adding the user script to Firefox. Repeating the same procedure as above add your second script to Firefox. Confirm the second user script installation and you are ready to enjoy nicer Bing Search results. After As you can see there are two small unobtrusive differences in our search results. The alternative search engine links are conveniently located at the top of the page and now you can easily know just how many search results that you have looked through. The results when we decided to try the search in a transfer over to Yahoo. Our search transferred to Ask Search. The alternative search links can be very helpful if Bing is not providing the kind of search results that you are hoping for. Still going very nicely past the 100 mark… Conclusion If you have been wanting a small booster to searching with Bing then these two scripts will get you on your way. Using Opera Browser? See our how-to for adding user scripts to Opera here. Links Install the Bing (Alternate Search Engine Links) User Script Install the Bing Numbered Search Results User Script Download the Greasemonkey extension for Firefox (Mozilla Add-ons) Download the Stylish extension for Firefox (Mozilla Add-ons) Similar Articles Productive Geek Tips Organize Your Firefox Search Engines Into FoldersFix for Slow "Instant Search" In Outlook 2007Gain Access to a Search Box in Google ChromeManage Web Searches In SafariModify Firefox’s Search Bar Behavior with SearchLoad Options TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Heaven & Hell Finder Icon Using TrueCrypt to Secure Your Data Quickly Schedule Meetings With NeedtoMeet Share Flickr Photos On Facebook Automatically Are You Blocked On Gtalk? Find out Discover Latest Android Apps On AppBrain

    Read the article

  • Build Explorer version 1.1 for Visual Studio Team Explorer is released

    - by terje
    Our free extension to Visual Studio , the folder based Build Explorer Version 1.1 has now been released, and uploaded to the Visual Studio Gallery and Codeplex. We have collected up a few changes and some bugs, as follows: Changes: Queue Default Builds can now be optionally fully enabled, fully disabled or enabled just for leaf nodes (=disabled for folders).  If you got a large number of builds it was pretty scary to be able to launch all of them with just one click.  However, it is nice to avoid having the dialog box up when you want to just run off a single build.  That’s the reasoning between the 3rd choice here. Auto fill-in of the builds at start up and refresh  This was a request that came up a lot, and which was also irritating to us.  When the Team Project is opened, the Build explorer will start by itself and fill up it’s tree. So you don’t need to click the node anymore. There was also quite a bit of flashing when the tree filled up, this has been reduced to just a single top level fill before it collapses the node. The speed of the buildup of the tree has also been increased. The “All Build Definitions” node is now shown on top of the list Login box appeared in certain cross domain situations. This was a fix for the TF30063 authentication problem we had in the beginning.  Hopefully the new code has that fixed properly so that both the login box and the TF30063 are gone forever.  Our testing so far seems to indicate it works.  If anyone gets a real problem here there are two workarounds: 1) Turn off the auto refresh to reduce the issue. If this doesn’t fix it, then 2) please reinstall the former version (go to the codeplex download site if you don’t have it anymore)  Write a comment to this blog post with a description of what happens, and I will send a temporary fix asap. Bug fixes: The folder name matching was case sensitive, so “Application.CI” and “application.CI” created two different folders.  View all builds not shown for leaf odes, and view builds didn’t work in all cases.  There was some inconsistencies here which have been fixed. Partly fixed:  The context menu to queue a new build for disabled builds should be removed, but that was a difficult one, and is still on the list, but the command will not do anything for a disabled build. Using the Queue Default Builds on a folder, and if it had some disabled builds below an error box appeared and ruined the whole experience. As a result of these fixes there has been introduced some new options, as shown below:   The two first settings, the Separator symbol and the options for how to handle Queuing of default builds are set per Team Project, and is stored in the TFS source control under the BuildProcessTemplates folder, with the name Inmeta.VisualStudio.BuildExplorer.Settings.xml The next two settings need some explanations.  They handle the behavior for the auto update of the build folders.  First, these are stored in the local registry per user, at the key HKEY_CURRENT_USER/Software\Inmeta\BuildExplorer. The first option Use Timed Refresh at Startup, if turned off, you will need to click the node as it is done in Version 1.0.  The second option is a timed value, the time after the Build explorer node is created and until the scanning of the Build folders start.  It is assumed that this is enough, and the tests so far indicates this.  If you have very many builds and you see that the explorer don’t get them all, try to increase this value, and of course, notify me of your case, either here or on the Visual Gallery site.

    Read the article

  • SQL SERVER – Error: Fix – Msg 208 – Invalid object name ‘dbo.backupset’ – Invalid object name ‘dbo.backupfile’

    - by pinaldave
    Just a day before I got a very interesting email. Here is the email (modified a bit to make it relevant to this blog post). “Pinal, We are facing a very strange issue. One of our query  related to backup files and backup set has stopped working suddenly in SSMS. It works fine in application where we have and in the stored procedure but when we have it in our SSMS it gives following error. Msg 208, Level 16, State 1, Line 1 Invalid object name ‘dbo.backupfile’. Here are our queries which we are trying to execute. SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM dbo.backupset; SELECT logical_name, backup_size, file_type FROM dbo.backupfile; This query gives us details related to backupset and backup files when the backup was taken.” When I receive this kind of email, usually I have no answers directly. The claim that it works in stored procedure and in application but not in SSMS gives me no real data. I have requested him to very first check following two things: If he is connected to correct server? His answer was yes. If he has enough permissions? His answer was he was logged in as an admin. This means there was something more to it and I requested him to send me a screenshot of the his SSMS. He promptly sends that to me and as soon as I receive the screen shot I knew what was going on. Before I say anything take a look at the screenshot yourself and see if you can figure out why his queries are not working in SSMS. Just to make your life a bit easy, I have already given a hint in the image. The answer is very simple, the context of the database is master database. To execute above two queries the context of the database has to be msdb. Tables backupset and backupfile belong to the database msdb only. Here are two workaround or solution to above problem: 1) Change context to MSDB Above two queries when they will run as following they will not error out and will give the accurate desired result. USE msdb GO SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM dbo.backupset; SELECT logical_name, backup_size, file_type FROM dbo.backupfile; 2) Prefix the query with msdb There are cases above script used in stored procedure or part of big query, it is not possible to change the context of the whole query to any specific database. Use three part naming convention and prefix them with msdb. SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM msdb.dbo.backupset; SELECT logical_name, backup_size, file_type FROM msdb.dbo.backupfile; Very simple solution but sometime keeps people wondering for an answer. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Error Messages, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Long pause when accessing DFS namespace

    - by Matt
    We've recently migrated our Windows network to use DFS for shared files. DFS is working well, except for one annoying problem: users experience a significant delay when they try to access a DFS namespace that they have not accessed for some time. I have tried to troubleshoot the issue but have not had any success so far, and I was hoping someone here may have some pointers to help resolve the problem. Firstly, some background on our network: The network uses a Windows 2008 functional level Active Directory domain with two Windows 2008 DCs and two DNS servers (one on each of the DCs). The network is DNS only - no WINS. All computers are located at the same site and connected by Gigabit Ethernet. We have approximately 20 Domain-based DFS namespaces in Windows 2008 mode, and each DFS namespace has two Windows 2008 DFS namespace servers (the same two servers for all namespaces). All namespace servers are in FQDN mode and all folder targets are specified using their FQDN. All computers are up-to-date with Service Packs and patches. The actual folder targets (i.e. the SMB shares our DFS folders point to) are scattered across several file and application servers, all running Windows 2008 bar two application servers which run Windows 2003 R2, with no replication setup at all (e.g. all DFS folders currently only have one folder target). Some more detail on the problem: The namespace access delay is generally 1 - 10 seconds long and seems to occur when a particular computer has not accessed the requested namespace for approximately five minutes or more. For example, if the user has not accessed \\domain.name\namespace1\ for more than five minutes and attempts to access \\domain.name\namespace1\ via Windows Explorer, the Explorer window will freeze for 1 - 10 seconds before finally resuming and displaying the folders that exist in \\domain.name\namespace1. If they then close the Explorer window and attempt to access \\domain.name\namespace1\ again within five minutes the contents will be displayed almost instantly - if they wait longer than five minutes it will go through the 1 - 10 second pause again. Once "inside" the namespace everything is nice and snappy, it's just the initial connection to the namespace that is slow. The browsing delays seem to affect all variants of Windows that we use (Windows 2008 x64 SP2, Windows 2003 R2 x86 SP2, Windows XP Pro x86 SP3) - it is possibly a bit worse in Windows XP / 2003 than in Windows 2008, but I'm not sure if the difference isn't just psychological. Accessing the underlying folder targets directly exhibits no delay at all - i.e. if the SMB shares pointed to by DFS are accessed directly (bypassing DFS) then there is no pause. During trouble-shooting I noticed that the "Cache duration" for all of our DFS roots is set to 300 seconds - 5 minutes. Given that this is the same amount of time required to trigger the pause I assume that this caching is somehow related, although I am unsure exactly what is cached on the client and hence what needs to be looked up again after 5 minutes have elapsed. In trying to resolve the problem I have already tried / checked the following (without success): Run dcdiag on both Domain Controllers - no problems found Done some basic DNS server checks without finding any problems - I don't know how to check the DNS servers in detail, but I would add that the network is not exhibiting any other strange behavior that may point to a DNS problem Disabled Anti-virus on clients and servers Removing one of the namespace servers from a couple of namespaces - no difference So that's where I'm up to - and I'm out of ideas. Can anyone suggest what may be causing the delays and/or what I should be trying next?

    Read the article

  • Pet Store Loyalty Programs: I'm Not Loyal Yet!

    - by ruth.donohue
    After two years of constantly being asked (aka "pestered) by my now eight-year-old daughter for a dog (or any pet that is more interactive than a goldfish), I've finally compromised with a hamster purely by chance. Friends of ours had recently brought home a female hamster, and (surprise, surprise) two weeks later, they were looking for homes for 11 baby hamster pups. Since the pups were not yet ready to be weaned from their mother, my daughter and I had several weeks to get ready -- and we spent that extra time visiting a number of local pet stores and purchasing an assortment of hamster books, toys, exercise equipment, food, bedding, and cage -- not cheap! Now, I'm usually an online shopper (i.e. I love reading user reviews and comparing prices), but for kids, there is absolutely no online substitute for actually walking into a store and physically picking out something you want. We have two competing pet shops within close proximity to where we live, and I signed up for their rewards programs to get discounts on select items. I'm sure it takes a while to get my data into the system (after all, I did fill out a form the old-fashioned way), but as it has been more than two weeks for one store and over a week for the other, the window of opportunity is getting smaller as we by now pretty much have most of what we think we need. Everything I've purchased has been purely hamster or small animal related, so in an ideal world, the stores would have me easily figured out as a hamster owner. Here is what I would be expecting of a loyalty rewards program: Point me to some useful links, either information provied by the company or external websites where I can learn more. Any value-add a business can provide to make my life easier makes me a much more loyal customer. What things can I expect as a new pet owner? Any hamster communities? Any hamster-related events? Any vets that specialize in small animals in the vicinity? Send me an email with other related products I may be interested in. Upsell and cross-sell to me. We've go the basics and a couple of luxuries, but at this point, I'm pretty excited (surprisingly) about the hamster, and my daughter is footing the bill with her birthday and Christmas money. She and I would be more than happy to spend her money! Get this information to me faster. As I mentioned, my window of opportunity is getting smaller, as eithe rmy daughter's money will run out on other things or we'll start losing the thrill of buying new hamster toys and treats. I realize this is easier said than done, and undoubtedly, the stores are getting value knowing my basic customer information and purchase history. Buth, they could really benefit by delivering a loyalty program that really earned my loyalty. "Goldeen" needs a new water bottle, yogurt chips, and chew toys as he doesn't seem to like the ones we bought. So for now, I'll just go to whichever store is the most convenient. Oh, and just for fun (not related to this post), here are a couple of videos my daughter really got a kick out of watching: Hamster on a Piano Tic in a Spin-Dryer

    Read the article

  • PARTNER WEBCAST- ORACLE COMPETENCE - PROGRAM (COMPETENCE VIRTUAL)

    - by mseika
    I am pleased to invite you to join the second (Competence Virtual). In Competence - program we will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Competencewill be presented on 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Competence is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A Document covering all questions and answers will be made available two weeks after the webcast. What are the Benefits for Partners? Find out how Competence helps you to improve your after sales Discover new functions and features so you can enrich your Customer’s solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleagues alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Applications portfolio – for your and your Customer’s benefit.   Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations. Product breakout sessions:- Fusion CRM: Effective, Efficient and Easy- Fusion HCM: Talent management overview performance, goals, talent review- Distributed Order Management - Fusion SCM Solution- Oracle Transportation Management- Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management- Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences- EPM 11.1.2.2 Overview- Oracle Hyperion Profitability and Cost Management, 11.1.2.1 For more details please visit and other breakout sessions on OPN page. Delivery FormatCompetence- program (Competence Virtual) is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the cast via chat and subject matter experts will provide verbal answers live. Competence consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available two weeks after the webcast. You can also see Competence afterwards as its content will be available online for the next 6-12 months.The next Competence web casts will be presented as follows: June the 4th  2012 September the 3rd  2012 December the 3rd  2012 March the 4th  2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. DurationMaximum 1 hour For further information please contact me at [email protected]. Best regards Markku RouhiainenDirector, Applications Partner EnablementWestern Europe

    Read the article

  • PARTNER WEBCAST- ORACLE COMPETENCE - PROGRAM (COMPETENCE VIRTUAL)

    - by mseika
    I am pleased to invite you to join the second (Competence Virtual). In Competence - program we will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Competencewill be presented on 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Competence is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A Document covering all questions and answers will be made available two weeks after the webcast. What are the Benefits for Partners? Find out how Competence helps you to improve your after sales Discover new functions and features so you can enrich your Customer’s solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleagues alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Applications portfolio – for your and your Customer’s benefit.   Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations.   Product breakout sessions:- Fusion CRM: Effective, Efficient and Easy- Fusion HCM: Talent management overview performance, goals, talent review- Distributed Order Management - Fusion SCM Solution- Oracle Transportation Management- Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management- Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences- EPM 11.1.2.2 Overview- Oracle Hyperion Profitability and Cost Management, 11.1.2.1 For more details please visit and other breakout sessions on OPN page. Delivery FormatCompetence- program (Competence Virtual) is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the cast via chat and subject matter experts will provide verbal answers live. Competence consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available two weeks after the webcast. You can also see Competence afterwards as its content will be available online for the next 6-12 months.The next Competence web casts will be presented as follows: June the 4th  2012 September the 3rd  2012 December the 3rd  2012 March the 4th  2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. DurationMaximum 1 hour For further information please contact me at [email protected]. Best regards Markku RouhiainenDirector, Applications Partner EnablementWestern Europe

    Read the article

  • PARTNER WEBCAST- ORACLE COMPETENCE - PROGRAM (COMPETENCE VIRTUAL)

    - by mseika
    I am pleased to invite you to join the second (Competence Virtual). In Competence - program we will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Competencewill be presented on 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Competence is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A Document covering all questions and answers will be made available two weeks after the webcast. What are the Benefits for Partners? Find out how Competence helps you to improve your after sales Discover new functions and features so you can enrich your Customer’s solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleagues alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Applications portfolio – for your and your Customer’s benefit.   Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations.   Product breakout sessions:- Fusion CRM: Effective, Efficient and Easy- Fusion HCM: Talent management overview performance, goals, talent review- Distributed Order Management - Fusion SCM Solution- Oracle Transportation Management- Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management- Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences- EPM 11.1.2.2 Overview- Oracle Hyperion Profitability and Cost Management, 11.1.2.1 For more details please visit and other breakout sessions on OPN page. Delivery FormatCompetence- program (Competence Virtual) is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the cast via chat and subject matter experts will provide verbal answers live. Competence consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available two weeks after the webcast. You can also see Competence afterwards as its content will be available online for the next 6-12 months.The next Competence web casts will be presented as follows: June the 4th  2012 September the 3rd  2012 December the 3rd  2012 March the 4th  2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. DurationMaximum 1 hour For further information please contact me at [email protected]. Best regards Markku RouhiainenDirector, Applications Partner EnablementWestern Europe

    Read the article

  • PARTNER WEBCAST- ORACLE COMPETENCE - PROGRAM (COMPETENCE VIRTUAL)

    - by mseika
    I am pleased to invite you to join the second (Competence Virtual). In Competence - program we will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Competencewill be presented on 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Competence is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A Document covering all questions and answers will be made available two weeks after the webcast. What are the Benefits for Partners? Find out how Competence helps you to improve your after sales Discover new functions and features so you can enrich your Customer’s solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleagues alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Applications portfolio – for your and your Customer’s benefit.   Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations. Product breakout sessions:- Fusion CRM: Effective, Efficient and Easy- Fusion HCM: Talent management overview performance, goals, talent review- Distributed Order Management - Fusion SCM Solution- Oracle Transportation Management- Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management- Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences- EPM 11.1.2.2 Overview- Oracle Hyperion Profitability and Cost Management, 11.1.2.1 For more details please visit and other breakout sessions on OPN page. Delivery FormatCompetence- program (Competence Virtual) is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the cast via chat and subject matter experts will provide verbal answers live. Competence consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available two weeks after the webcast. You can also see Competence afterwards as its content will be available online for the next 6-12 months.The next Competence web casts will be presented as follows: June the 4th  2012 September the 3rd  2012 December the 3rd  2012 March the 4th  2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. DurationMaximum 1 hour For further information please contact me at [email protected]. Best regards Markku RouhiainenDirector, Applications Partner EnablementWestern Europe

    Read the article

  • How to make the constructor for the following exercise in c++?

    - by user40630
    This is the exercise I?m trying to solve. It's from C++, How to program book from Deitel and it's my homework. (Card Shuffling and Dealing) Create a program to shuffle and deal a deck of cards. The program should consist of class Card, class DeckOfCards and a driver program. Class Card should provide: a) Data members face and suit of type int. b) A constructor that receives two ints representing the face and suit and uses them to initialize the data members. c) Two static arrays of strings representing the faces and suits. d) A toString function that returns the Card as a string in the form “face of suit.” You can use the + operator to concatenate strings. Class DeckOfCards should contain: a) A vector of Cards named deck to store the Cards. b) An integer currentCard representing the next card to deal. c) A default constructor that initializes the Cards in the deck. The constructor should use vector function push_back to add each Card to the end of the vector after the Card is created and initialized. This should be done for each of the 52 Cards in the deck. d) A shuffle function that shuffles the Cards in the deck. The shuffle algorithm should iterate through the vector of Cards. For each Card, randomly select another Card in the deck and swap the two Cards. e) A dealCard function that returns the next Card object from the deck. f) A moreCards function that returns a bool value indicating whether there are more Cards to deal. The driver program should create a DeckOfCards object, shuffle the cards, then deal the 52 cards. The problem I'm facing is that I don't know exactly how to make the constructor for the second class. See description commented in the code bellow. #include <iostream> #include <vector> using namespace std; /* * */ //Class card. No problems here. class Card { public: Card(int, int); string toString(); private: int suit, face; static string faceNames[13]; static string suitNames[4]; }; string Card::faceNames[13] = {"Ace","Two","Three","Four","Five","Six","Seven","Eight","Nine","Ten","Queen","Jack","King"}; string Card::suitNames[4] = {"Diamonds","Clubs","Hearts","Spades"}; string Card::toString() { return faceNames[face]+" of "+suitNames[suit]; } Card::Card(int f, int s) :face(f), suit(s) { } /*The problem begins here. This class should create(when and object for it is created) a copy of the vector deck, right? But how exactly are these vector cards be initialized? I'll explain better in the constructor definition bellow.*/ class DeckOfCards { public: DeckOfCards(); void shuffleCards(); Card dealCard(); bool moreCards(); private: vector<Card> deck(52); int currentCard; }; int main(int argc, char** argv) { return 0; } DeckOfCards::DeckOfCards() { //This is where I'm stuck. I can't figure out how to set each of the 52 cards of the vector deck to have a specific suit and face every one of them, by using only the constructor of the Card class. //What you see bellow was one of my attempts to solve this problem but I blocked pretty soon in the middle of it. for(int i=0; i<deck.size(); i++) { deck[i]//....There is no function to set them. They must be set when initialized. But how?? } } For easier reading: http://pastebin.com/pJeXMH0f

    Read the article

  • MacGyver Moments

    - by Geoff N. Hiten
    Denny Cherry tagged me to write about my best MacGyver Moment.  Usually I ignore blogosphere fluff and just use this space to write what I think is important.  However, #MVP10 just ended and I have a stronger sense of community.  Besides, where else would I mention my second best Macgyver moment was making a BIOS jumper out of a soda can.  Aluminum is conductive and I didn't have any real jumpers lying around. My best moment is probably my entire home computer network.  Every system but one is hand-built, usually cobbled together out of spare parts and 'adapted' from its original purpose. My Primary Domain Controller is a Dell 2300.   The Service Tag indicates it was shipped to the original owner in 1999.  Box has a PERC/1 RAID controller.  I acquired this from a previous employer for $50.  It runs Windows Server 2003 Enterprise Edition.  Does DNS, DHCP, and RADIUS services as a bonus.  RADIUS authentication is used for VPN and Wireless access.  It is nice to sign in once and be done with it. The Secondary Domain Controller is an old desktop.  Dual P-III 933 with some extra drives. My VPN box is a P-II 250 with 384MB of RAM and a 21 GB hard drive.  I did a P-to-V to my Hyper-V box a year or so ago and retired the hardware again.  Dynamic DNS lets me connect no matter how often Comcast shuffles my IP. The Hyper-V box is a desktop system with 8GB RAM and an AMD Athlon 5000+ processor.  Cost me less than $500 to put together nearly two years ago.  I reasoned that if Vista and Windows 2008 were the same code then Vista 64-bit certified meant the drivers for Vista would load into Windows 2008.  Turns out I was right. Later I added three 1TB drives but wasn't too happy with how that turned out.  I recovered two of the drives yesterday and am building an iSCSI storage unit. (Much thanks to Starwind.  Great product).  I am using an old AMD 1.1GhZ box with 1.5 GB RAM (cobbled together from three old PCs) as my storave server.  The Hyper-V box is slated for an OS rebuild to 2008 R2 once I get the storage system worked out.  maybe in a week or two. A couple of DLink Gigabit switches ties everything together. Add in the Vonage box, the three PCs, the Wireless-N Access Point, the two notebooks and the XBox and you have gone from MacGyver to darn near Rube Goldberg. The only thing I really spend money on is power supplies and fans.  I buy top-of-the-line for both. I even pull and crimp my own cables. Oh, and if my kids hose up a PC, I have all of their data on a server elsewhere.  Every PC and laptop is pretty much interchangable for email and basic workstation tasks.  That helps a lot too. Of course I will tag SQLVariant.

    Read the article

  • Oracle OpenWorld Update: Oracle GoldenGate Customer Panels

    - by Doug Reid
    0 false 18 pt 18 pt 0 0 false false false /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:12.0pt; font-family:"Times New Roman"; mso-ascii-font-family:Cambria; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Cambria; mso-hansi-theme-font:minor-latin;} We are two weeks out from the start of Oracle OpenWorld 2012. The Data Integration team has a solid line-up of product and customer sessions for you to attend this year, plus five hands-on labs, and numerous demonstration pods in Moscone South. On Monday we kick the track off with Brad Adelberg’s Future Strategy, Direction and Roadmap for Oracle’s Data Integration Platform at 10:45AM in Moscone West 3005. Over the rest of the week we have a number of deep dive sessions that build out the themes that Brad discusses in his keynote, but the two that I would like to highlight today are our Oracle GoldenGate customer panels. The first customer panel is on Zero Downtime Operations and is on Monday at 1:45 in Moscone West 3005. The theme of this session is how to reduce downtime for critical must-succeed systems. Here’s a rundown of the session: Bank of America, TALX, and St. Jude Medical all have users communities that expect systems to be available around the clock. In this customer panel session, Bank of America discusses how it will be leveraging Oracle GoldenGate. St. Jude Medical shares how it is using Oracle GoldenGate to achieve a zero-downtime migration for a 5 TB Oracle online transaction processing (OLTP) 24/7 mission-critical database. TALX discusses how Equifax Workforce Information Services used Oracle GoldenGate to move from processing online transactions in a single site to processing concurrently from two geographically disparate data centers, providing a highly available solution with significant burst capacity. On Tuesday at 11:45 in Moscone West 3005 we switch gears and host a customer panel on Operational Reporting. The theme of this customer panel is all around reporting and how Oracle GoldenGate raises the bar on reporting by enabling real-time access to real-time data. Here’s a rundown of the session: Turk Telekom and Comcast are half a world away from each other, but these two powerhouse companies have both drastically improved performance and access to real-time data by using Oracle GoldenGate. During this panel discussion, Turk Telekom will explain its evaluation and implementation of Oracle GoldenGate, how the business has experienced significant improvements in the core database and reporting platform, and how it plans to expand its usage into its SOA architecture and its architecture based on Oracle’s Siebel platform. Comcast will explain its implementation of Oracle GoldenGate and how it moves data in real time from its mission-critical HP NonStop database to a Teradata data warehouse. Join us at our sessions to learn what other customers are doing with our products or stop by our demo pods in Moscone south and meet the product management and development teams.

    Read the article

  • Enjoy How-To Geek User Style Script Goodness

    - by Asian Angel
    Most people may not be aware of it but there are two user style scripts that have been created just for use with the How-To Geek website. If you are curious then join us as we look at these two scripts at work. Note: User Style Scripts & User Scripts can be added to most browsers but we are using Firefox for our examples here. The How-to Geek Wide User Style Script The first of the two scripts affects the viewing width of the website’s news content. Here you can see everything set at the normal width. When you visit the UserStyles website you will be able to view basic information about the script and see the code itself if desired. On the right side of the page is the good part though. Since we are using Firefox with Greasemonkey installed we chose the the “install as a user script option”. Notice that the script is available for other browsers as well (very nice!) Within a few moments of clicking on the “install as a user script button” you will see the following window asking confirmation for installing the script. After installing the user style script and refreshing the page it has now stretched out to fill 90% of the browser window’s area. Definitely nice! The How-To Geek – News and Comments (600px) User Style Script The second script can be very useful for anyone with the limited screen real-estate of a netbook. You can see another of the articles from here at the site viewed in a  “normal mode”. Once again you can view basic information about this particular user style script and view the code if desired. As above we have the Firefox/Greasemonkey combination at work so we installed as a user script. This is one of the great things about using Greasemonkey…it always checks with you to make certain that no unauthorized scripts are added. Once the script was installed and we refreshed the page things looked very very different. All the focus has been placed on the article itself and any comments attached to the article. For those who may be curious this is what the homepage looks like using this script. Conclusion If you have been wanting to add a little bit of “viewing spice” to your browser for the How-To Geek website then definitely pop over to the User Styles website and give these two scripts a try. Using Opera Browser? See our how-to for adding user scripts to Opera here. Links Install the How-to Geek Wide User Style Script Install the How-To Geek – News and Comments (600px) User Style Script Download the Greasemonkey extension for Firefox (Mozilla Add-ons) Download the Stylish extension for Firefox (Mozilla Add-ons) Similar Articles Productive Geek Tips Set Up User Scripts in Opera BrowserSet Gmail as Default Mail Client in UbuntuHide Flash Animations in Google ChromeShell Script to Upload a File to the Same Subdirectory on a Remote ServerAutomate Adding Bookmarks to del.icio.us TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Quickly Schedule Meetings With NeedtoMeet Share Flickr Photos On Facebook Automatically Are You Blocked On Gtalk? Find out Discover Latest Android Apps On AppBrain The Ultimate Guide For YouTube Lovers Will it Blend? iPad Edition

    Read the article

  • PARTNER WEBCAST- ORACLE COMPETENCE - PROGRAM (COMPETENCE VIRTUAL)

    - by mseika
    I am pleased to invite you to join the second (Competence Virtual). In Competence - program we will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Competencewill be presented on 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Competence is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A Document covering all questions and answers will be made available two weeks after the webcast. What are the Benefits for Partners? Find out how Competence helps you to improve your after sales Discover new functions and features so you can enrich your Customer’s solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleagues alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Applications portfolio – for your and your Customer’s benefit.   Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations. Product breakout sessions:- Fusion CRM: Effective, Efficient and Easy- Fusion HCM: Talent management overview performance, goals, talent review- Distributed Order Management - Fusion SCM Solution- Oracle Transportation Management- Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management- Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences- EPM 11.1.2.2 Overview- Oracle Hyperion Profitability and Cost Management, 11.1.2.1 For more details please visit and other breakout sessions on OPN page. Delivery FormatCompetence- program (Competence Virtual) is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the cast via chat and subject matter experts will provide verbal answers live. Competence consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available two weeks after the webcast. You can also see Competence afterwards as its content will be available online for the next 6-12 months.The next Competence web casts will be presented as follows: June the 4th  2012 September the 3rd  2012 December the 3rd  2012 March the 4th  2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. DurationMaximum 1 hour For further information please contact me at [email protected]. Best regards Markku RouhiainenDirector, Applications Partner EnablementWestern Europe

    Read the article

< Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >