Search Results

Search found 39405 results on 1577 pages for 'zeta two'.

Page 183/1577 | < Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >

• Generating Java classes out of XMLSchema.xsd using JAXB

  - by Christian Schulz

  I'm using jaxb to generate java classes out of a xml schema. The schema imports XMLSchema.xsd and its content is used as an element in the document. If I remove the import and the reference to "xsd:schema" respectively then the binding compiler generates successfully the classes. If I do not then it would produce the following errors, which are the same if I would try to generate Java classes from the XMLSchema.xsd only! C:\Users\me"%JAXB%/xjc" -extension -d tmp/uisocketdesc -p uis.jaxb uisocketdesc.xsd -b xml_binding_test.xml -b xml_binding_test_2.xml -b xml_binding_test_3.xml parsing a schema... compiling a schema... [ERROR] A class/interface with the same name "uis.jaxb.ComplexType" is already in use. Use a class customization to resolve this conflict. line 612 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "ComplexType" is generated from here. line 440 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] A class/interface with the same name "uis.jaxb.Attribute" is already in use. Use a class customization to resolve this conflict. line 364 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "Attribute" is generated from here. line 1020 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] A class/interface with the same name "uis.jaxb.SimpleType" is already in use. Use a class customization to resolve this conflict. line 2278 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "SimpleType" is generated from here. line 2222 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] A class/interface with the same name "uis.jaxb.Group" is already in use. Use a class customization to resolve this conflict. line 930 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "Group" is generated from here. line 727 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] A class/interface with the same name "uis.jaxb.AttributeGroup" is already in use. Use a class customization to resolve this conflict. line 1062 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "AttributeGroup" is generated from here. line 1026 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] A class/interface with the same name "uis.jaxb.Element" is already in use. Use a class customization to resolve this conflict. line 721 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Relevant to above error) another "Element" is generated from here. line 647 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 1020 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 364 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 2278 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 2222 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 930 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 727 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 440 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 612 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 1026 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 1062 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] Two declarations cause a collision in the ObjectFactory class. line 647 of "http://www.w3.org/2001/XMLSchema.xsd" [ERROR] (Related to above error) This is the other declaration. line 721 of "http://www.w3.org/2001/XMLSchema.xsd" Failed to produce code.

  Read the article

• "Local transaction already has 1 non-XA Resource: cannot add more resources" error

  - by jthg

  After reading previous questions about this error, it seems like all of them conclude that you need to enable XA on all of the data sources. But: What if I don't want a distributed transaction? What would I do if I want to start transactions on two different databases at the same time, but commit the transaction on one database and roll back the transaction on the other? I'm wondering how my code actually initiated a distributed transaction. It looks to me like I'm starting completely separate transactions on each of the databases. Info about the application: The application is an EJB running on a Sun Java Application Server 9.1 I use something like the following spring context to set up the hibernate session factories: <bean id="dbADatasource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/dbA"/> </bean> <bean id="dbASessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource" ref="dbADatasource" /> <property name="hibernateProperties"> [hibernate properties...] </property> <property name="mappingResources"> [mapping resources...] </property> </bean> <bean id="dbBDatasource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/dbB"/> </bean> <bean id="dbBSessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource" ref="dbBDatasource" /> <property name="hibernateProperties"> [hibernate properties...] </property> <property name="mappingResources"> [mapping resources...] </property> </bean> Both of the JNDI resources are javax.sql.ConnectionPoolDatasoure's. They actually both point to the same connection pool, but we have two different JNDI resources because there's the possibility that the two groups of tables will move to different databases in the future. Then in code, I do: sessionA = dbASessionFactory.openSession(); sessionB = dbBSessionFactory.openSession(); sessionA.beginTransaction(); sessionB.beginTransaction(); The sessionB.beginTransaction() line produces the error in the title of this post - sometimes. I ran the app on two different sun application servers. On one runs it fine, the other throws the error. I don't see any difference in how the two servers are configured although they do connect to different, but equivalent databases. So the question is Why doesn't the above code start completely independent transactions? How can I force it to start independent transactions rather than a distributed transaction? What configuration could cause the difference in behavior between the two application servers? Thanks.

  Read the article

• Dynamic obfuscation by self-modifying code

  - by Fallout2

  Hi all, Here what's i am trying to do: assume you have two fonction void f1(int *v) { *v = 55; } void f2(int *v) { *v = 44; } char *template; template = allocExecutablePages(...); char *allocExecutablePages (int pages) { template = (char *) valloc (getpagesize () * pages); if (mprotect (template, getpagesize (), PROT_READ|PROT_EXEC|PROT_WRITE) == -1) { perror (“mprotect”); } } I would like to do a comparison between f1 and f2 (so tell what is identical and what is not) (so get the assembly lines of those function and make a line by line comparison) And then put those line in my template. Is there a way in C to do that? THanks Update Thank's for all you answers guys but maybe i haven't explained my need correctly. basically I'm trying to write a little obfuscation method. The idea consists in letting two or more functions share the same location in memory. A region of memory (which we will call a template) is set up containing some of the machine code bytes from the functions, more specifically, the ones they all have in common. Before a particular function is executed, an edit script is used to patch the template with the necessary machine code bytes to create a complete version of that function. When another function assigned to the same template is about to be executed, the process repeats, this time with a different edit script. To illustrate this, suppose you want to obfuscate a program that contains two functions f1 and f2. The first one (f1) has the following machine code bytes Address Machine code 0 10 1 5 2 6 3 20 and the second one (f2) has Address Machine code 0 10 1 9 2 3 3 20 At obfuscation time, one will replace f1 and f2 by the template Address Machine code 0 10 1 ? 2 ? 3 20 and by the two edit scripts e1 = {1 becomes 5, 2 becomes 6} and e2 = {1 becomes 9, 2 becomes 3}. #include <stdlib.h> #include <string.h> typedef unsigned int uint32; typedef char * addr_t; typedef struct { uint32 offset; char value; } EDIT; EDIT script1[200], script2[200]; char *template; int template_len, script_len = 0; typedef void(*FUN)(int *); int val, state = 0; void f1_stub () { if (state != 1) { patch (script1, script_len, template); state = 1; } ((FUN)template)(&val); } void f2_stub () { if (state != 2) { patch (script2, script_len, template); state = 2; } ((FUN)template)(&val); } int new_main (int argc, char **argv) { f1_stub (); f2_stub (); return 0; } void f1 (int *v) { *v = 99; } void f2 (int *v) { *v = 42; } int main (int argc, char **argv) { int f1SIZE, f2SIZE; /* makeCodeWritable (...); */ /* template = allocExecutablePages(...); */ /* Computed at obfuscation time */ diff ((addr_t)f1, f1SIZE, (addr_t)f2, f2SIZE, script1, script2, &script_len, template, &template_len); /* We hide the proper code */ memset (f1, 0, f1SIZE); memset (f2, 0, f2SIZE); return new_main (argc, argv); } So i need now to write the diff function. that will take the addresses of my two function and that will generate a template with the associated script. So that is why i would like to compare bytes by bytes my two function Sorry for my first post who was not very understandable! Thank you

  Read the article

• Can/should one disable namespace validation in Axis2 clients using ADB databinding?

  - by RJCantrell

  I have an document/literal Axis 1 service which I'm consuming with an Axis 2 client (ADB databinding, generated from WSDL2Java). It receives a valid XML response, but in parsing that XML, I get the error "Unexpected Subelement" for any type which doesn't have a namespace defined in the response. I can resolve the error by manually changing the (auto-generated by Axis2) type-validation line to only check the type name and not the namespace as well, but is there a non-manual way to skip this? This service is consumed properly by other Axis 1 clients. Here's the response, with bits in ALL CAPS having been anonymized. Some types have namespaces, some have empty-string namespaces, and some have none at all. Can I control this via the service's WSDL, or in Axis2's WSDL2Java handling of the WSDL? Is there a fundamental mismatch between Axis 1 and Axis2? The response below looks correct, except perhaps for where that type (anonymized as TWO below) is nested within itself. <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <soapenv:Body> <SERVICENAMEResponse xmlns="http://service.PROJECT.COMPANY.com"> <SERVICENAMEReturn xmlns=""> <ONE></ONE> <TWO><TWO> <THREE>2</THREE> <FOUR>-10</FOUR> <FIVE>6</FIVE> <SIX>1</SIX> </TWO></TWO> <fileName></fileName> </SERVICENAMEReturn></SERVICENAMEResponse> </soapenv:Body></soapenv:Envelope> I did not have to modify the validation of the "SERVICENAMEResponse" object because it has the correct namespace specified, but I have to so for all its subelements. The manual modification that I can make (one per type) to fix this is to change: if (reader.isStartElement() && new javax.xml.namespace.QName("http://dto.PROJECT.COMPANY.com","ONE").equals(reader.getName())){ to: if (reader.isStartElement() && new javax.xml.namespace.QName("ONE").equals(reader.getName())){

  Read the article

• iPad: Tables in Popover Views do not Scroll to Show Selected Row

  - by mahboudz

  I am having two problems with viewcontrollerss in landscape orientation on the iPad. (1) I have two popups which hold tables. The tables should scroll to a specific row to reflect a selection in the main view. Instead, the tables do scroll down some but the actual selected row remains off screen. (2) All my action sheets come up with a width of 320. In Interface Builder, all my views are created in landscape orientation. Only the main Window is not, but I don't see a way to change that. My Configuration: Upon launch, I get the following coordinates for my main window and the main viewcontroller view: Window frame {{0, 0}, {768, 1024}} mainView frame {{0, 0}, {748, 1024}} All other views after that show these coordinates when summoned (when loaded but before being presented): frame of keysig {{0, 0}, {1024, 768}} frame of instrumentSelect {{20, 0}, {1024, 768}} frame of settings {{0, 0}, {467, 300}} In all my viewControllers, i respond to shouldAutorotateToInterfaceOrientation with: return ((interfaceOrientation == UIInterfaceOrientationLandscapeLeft) || (interfaceOrientation == UIInterfaceOrientationLandscapeRight)); Everything (almost) functions as expected. The app launches into one of the two landscape modes. The views (and viewcontrollers) display everything where it belongs and taps work all across the screen as expected. However, I still have the two problems. Problem 1: I have two popups containing tables long enough to run off screen. The tables should scroll to a selected row. They do scroll i.e. they don't start visually at row 1 but they don't scroll enough to actually show the selected row. It almost seems like a UITable internal rect gets created with the wrong number and stays that way but I've checked both of the UITableView's scrollView content coordinates and they seemed reasonable. Problem 2: I think this is related to problem 1 because my actionsheets come up with a width of 320. I can only assume that the iPad allows actionSheets in only 320 or 480 widths and since it somehow thinks that the screen is oriented in portrait mode, it uses the narrower width. There you have it. I can't believe I am still getting hung up on orientation issues. I swear Apple doesn't make it easy to have a landscape app. Any ideas?

  Read the article

• Ray-Box Intersection during Scene traversal with matrix transforms

  - by Myx

  Hello: There are a few ways that I'm testing my ray-box intersections: Using the ComputeIntersectionBox(...) method, that takes a ray and a box as arguments and computes the closest intersection of the ray and the box. This method works by forming a plane with each of the faces of the box and finding an intersection with each of the planes. Once an intersection is found, a check is made whether or not the point is on the surface of the box by checking that the intersection point is between the corner points. When I look at rays after running this algorithm on two different boxes, I obtain the correct intersections. Using ComputeIntersectionScene(...) method without using the matrix transformations on a scene that has two spheres, a dodecahedron (a triangular mesh), and two boxes. ComputeIntersectionScene(...) recursively traverses all of the nodes of the scene graph and computes the closest intersection with the given ray. This test in particular does not apply any transformations that parent nodes may have that also need to be applied to their children. With this test, I also obtain the correct intersections. Using ComputeIntersectionScene(...) method WITH the matrix transformations. This test works like the one above except that before finding an intersection between the ray and a node in the scene, the ray is transformed into the node's coordinate frame using the inverse of the node's transformation matrix and after the intersection has been computed, this intersection is transformed back into the world coordinates by applying the transformation matrix to the intersection point. When testing with the third method on the same scene file as described in 2, testing with 4 rays (thus one ray intersects the one sphere, one ray the the other sphere, one ray one box, and one ray the other box), only the two spheres get intersected and the two boxes do not get intersections. When I debug looking into my ComputeIntersectionBox(...) method, it actually tells me that the ray intersects every plane on the box but each intersection point does not lie on the box. This seems to be strange behavior, since when using test 2 without transformations, I obtain the correct box intersections (thus, I believe my ray-box intersection to be correct) and when using test 3 WITH transformations, I obtain the correct sphere intersections (thus, I believe my transformed ray should be OK). Any suggestions where I could be going wrong? Thank you in advance.

  Read the article

• _heapwalk reports _HEAPBADNODE, causes breakpoint or loops endlessly

  - by Stefan Hubert

  I use _heapwalk to gather statistics about the Process' standard heap. Under certain circumstances i observe unexpected behaviours like: _HEAPBADNODE is returned some breakpoint is triggered inside _heapwalk, telling me the heap might got corrupted access violation inside _heapWalk. I saw different behaviours on different Computers. On one Windows XP 32 bit machine everything looked fine, whereas on two Windows XP 64 bit machines i saw the mentioned symptoms. I saw this behaviour only if LowFragmentationHeap was enabled. I played around a bit. I walked the heap several times right one after another inside my program. First time doing nothing in between the subsequent calls to _heapWalk (everything fine). Then again, this time doing some stuff (for gathering statistics) in between two subsequent calls to _heapWalk. Depending upon what I did there, I sometimes got the described symptoms. Here finally a question: What exactly is safe and what is not safe to do in between two subsequent calls to _heapWalk during a complete heap walk run? Naturally, i shall not manipulate the heap. Therefore i doublechecked that i don't call new and delete. However, my observation is that function calls with some parameter passing causes my heap walk run to fail already. I subsequently added function calls and increasing number of parameters passed to these. My feeling was two function calls with two paramters being passed did not work anymore. However I would like to know why. Any ideas why this does not happen on some machines? Any ideas why this only happens if LowFragmentationHeap is enabled? Sample Code finally: #include <malloc.h> void staticMethodB( int a, int b ) { } void staticMethodA( int a, int b, int c) { staticMethodB( 3, 6); return; } ... _HEAPINFO hinfo; hinfo._pentry = NULL; while( ( heapstatus = _heapwalk( &hinfo ) ) == _HEAPOK ) { //doing nothing here works fine //however if i call functions here with parameters, this causes //_HEAPBADNODE or something else staticMethodA( 3,4,5); } switch( heapstatus ) { ... case _HEAPBADNODE: assert( false ); /*ERROR - bad node in heap */ break; ...

  Read the article

• Armchair Linguists: 'code' vs. 'codes'--or why I write 'code' and my manager asks for 'codes'

  - by Ukko

  I wanted to tap into the collective wisdom here to see if I can get some insight into one of my pet peeves, people who thread "code" as a countable noun. Let me also preface this by saying that I am not talking about anyone who speaks english as a second language, this is a native phenomenon. For those of us who slept through grammar class there are two classes of nouns which basically refer to things that are countable and non-countable (sometimes referred to as count and noncount). For instance 'sand' is a non-count noun and 'apple' is count. You can talk about "two apples" but "two sands" does not parse. The bright students then would point out a word like "beer" where is looks like this is violated. Beer as a substance is certainly a non-count noun, but I can ask for "two beers" without offending the grammar police. The reason is that there are actually two words tied up in that one utterance, Definition #1 is a yummy golden substance and Definition #2 is a colloquial term for a container of said substance. #1 is non-count and #2 is countable. This gets to my problem with "codes" as a countable noun. In my mind the code that we programmers write is non-count, "I wrote some code today." When used in the plural like "Have you got the codes" I can only assume that you are asking if I have the cryptographically significant numbers for launching a missile or the like. Every time my peer in marketing asks about when we will have the new codes ready I have a vision of rooms of code breakers going over the latest Enigma coded message. I corrected the usage in all the documents I am asked to review, but then I noticed that our customer was also using the work "codes" when they meant "code". At this point I have realized that there is a significant sub-population that uses "codes" and they seem to be impervious to what I see as the dominant "correct" usage. This is the part I want some help on, has anyone else noticed this phenomenon? Do you know what group it is associated with, old Fortran programmer perhaps? Is it a regionalism? I have become quick to change my terms when I notice a customer's usage, but it would be nice to know if I am sending a proposal somewhere what style they expect. I would hate to get canned with a review of "Ha, these guy's must be morons they don't even know 'code' is plural!"

  Read the article

• In a DDD approach, is this example modelled correctly?

  - by Tag

  Just created an acc on SO to ask this :) Assuming this simplified example: building a web application to manage projects... The application has the following requirements/rules. 1) Users should be able to create projects inserting the project name. 2) Project names cannot be empty. 3) Two projects can't have the same name. I'm using a 4-layered architecture (User Interface, Application, Domain, Infrastructure). On my Application Layer i have the following ProjectService.cs class: public class ProjectService { private IProjectRepository ProjectRepo { get; set; } public ProjectService(IProjectRepository projectRepo) { ProjectRepo = projectRepo; } public void CreateNewProject(string name) { IList<Project> projects = ProjectRepo.GetProjectsByName(name); if (projects.Count > 0) throw new Exception("Project name already exists."); Project project = new Project(name); ProjectRepo.InsertProject(project); } } On my Domain Layer, i have the Project.cs class and the IProjectRepository.cs interface: public class Project { public int ProjectID { get; private set; } public string Name { get; private set; } public Project(string name) { ValidateName(name); Name = name; } private void ValidateName(string name) { if (name == null || name.Equals(string.Empty)) { throw new Exception("Project name cannot be empty or null."); } } } public interface IProjectRepository { void InsertProject(Project project); IList<Project> GetProjectsByName(string projectName); } On my Infrastructure layer, i have the implementation of IProjectRepository which does the actual querying (the code is irrelevant). I don't like two things about this design: 1) I've read that the repository interfaces should be a part of the domain but the implementations should not. That makes no sense to me since i think the domain shouldn't call the repository methods (persistence ignorance), that should be a responsability of the services in the application layer. (Something tells me i'm terribly wrong.) 2) The process of creating a new project involves two validations (not null and not duplicate). In my design above, those two validations are scattered in two different places making it harder (imho) to see whats going on. So, my question is, from a DDD perspective, is this modelled correctly or would you do it in a different way?

  Read the article

• Recommended textbook for machine-level programming?

  - by Norman Ramsey

  I'm looking at textbooks for an undergraduate course in machine-level programming. If the perfect book existed, this is what it would look like: Uses examples written in C or assembly language, or both. Covers machine-level operations such as two's-complement integer arithmetic, bitwise operations, and floating-point arithmetic. Explains how caches work and how they affect performance. Explains machine instructions or assembly instructions. Bonus if the example assembly language includes x86; triple bonus if it includes x86-64 (aka AMD64). Explains how C values and data structures are represented using hardware registers and memory. Explains how C control structures are translated into assembly language using conditional and unconditional branch instructions. Explains something about procedure calling conventions and how procedure calls are implemented at the machine level. Books I might be interested in would probably have the words "machine organization" or "computer architecture" in the title. Here are some books I'm considering but am not quite happy with: Computer Systems: A Programmer's Perspective by Randy Bryant and Dave O'Hallaron. This is quite a nice book, but it's a book for a broad, shallow course in systems programming, and it contains a great deal of material my students don't need. Also, it is just out in a second edition, which will make it expensive. Computer Organization and Design: The Hardware/Software Interface by Dave Patterson and John Hennessy. This is also a very nice book, but it contains way more information about how the hardware works than my students need. Also, the exercises look boring. Finally, it has a show-stopping bug: it is based very heavily on MIPS hardware and the use of a MIPS simulator. My students need to learn how to use DDD, and I can't see getting this to work on a simulator. Not to mention that I can't see them cross-compiling their code for the simulator, and so on and so forth. Another flaw is that the book mentions the x86 architecture only to sneer at it. I am entirely sympathetic to this point of view, but news flash! You guys lost! Write Great Code Vol I: Understanding the Machine by Randall Hyde. I haven't evaluated this book as thoroughly as the other two. It has a lot of what I need, but the translation from high-level language to assembler is deferred to Volume Two, which has mixed reviews. My students will be annoyed if I make them buy a two-volume series, even if the price of those two volumes is smaller than the price of other books. I would really welcome other suggestions of books that would help students in a class where they are to learn how C-language data structures and code are translated to machine-level data structures and code and where they learn how to think about performance, with an emphasis on the cache.

  Read the article

• Information Gain and Entropy

  - by dhorn

  I recently read this question regarding information gain and entropy. I think I have a semi-decent grasp on the main idea, but I'm curious as what to do with situations such as follows: If we have a bag of 7 coins, 1 of which is heavier than the others, and 1 of which is lighter than the others, and we know the heavier coin + the lighter coin is the same as 2 normal coins, what is the information gain associated with picking two random coins and weighing them against each other? Our goal here is to identify the two odd coins. I've been thinking this problem over for a while, and can't frame it correctly in a decision tree, or any other way for that matter. Any help? EDIT: I understand the formula for entropy and the formula for information gain. What I don't understand is how to frame this problem in a decision tree format. EDIT 2: Here is where I'm at so far: Assuming we pick two coins and they both end up weighing the same, we can assume our new chances of picking H+L come out to 1/5 * 1/4 = 1/20 , easy enough. Assuming we pick two coins and the left side is heavier. There are three different cases where this can occur: HM: Which gives us 1/2 chance of picking H and a 1/4 chance of picking L: 1/8 HL: 1/2 chance of picking high, 1/1 chance of picking low: 1/1 ML: 1/2 chance of picking low, 1/4 chance of picking high: 1/8 However, the odds of us picking HM are 1/7 * 5/6 which is 5/42 The odds of us picking HL are 1/7 * 1/6 which is 1/42 And the odds of us picking ML are 1/7 * 5/6 which is 5/42 If we weight the overall probabilities with these odds, we are given: (1/8) * (5/42) + (1/1) * (1/42) + (1/8) * (5/42) = 3/56. The same holds true for option B. option A = 3/56 option B = 3/56 option C = 1/20 However, option C should be weighted heavier because there is a 5/7 * 4/6 chance to pick two mediums. So I'm assuming from here I weight THOSE odds. I am pretty sure I've messed up somewhere along the way, but I think I'm on the right path! EDIT 3: More stuff. Assuming the scale is unbalanced, the odds are (10/11) that only one of the coins is the H or L coin, and (1/11) that both coins are H/L Therefore we can conclude: (10 / 11) * (1/2 * 1/5) and (1 / 11) * (1/2) EDIT 4: Going to go ahead and say that it is a total 4/42 increase.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Calculate total time between Dates in Hours and Minutes

  - by matthew parkes

  Hi I’m trying to resolve a problem using VB and I need some assistance. I’m very new to the language (1 week). The problem is I have created a user form to show how many hours and minutes has elapsed between two different times similar to a time sheet. The user form consists of two calendars, and under each calendar there are two text boxes; one box each to record the Hour and Minute they left and two further boxes to record the time they arrived back. I have used the code to minus the calendars together (e.g calendar in – calendar out) then times this by 24 to indicate the hours away. Then under the calendar out I have a text box for the user to type in the hour they left. Then I minus the 24 by the Hour out e.g. if it was 24 -15 it will appear 9 ( 9 hours of that day ) then I would add that to the figure they inserted in the text box Hour in (Return Time). e.g 14. Then I would add them to together e.g. 9 + 14 = 23 and have this displayed in another text box Total Hours. Therefore it would display 23 meaning 23 hours. I have then want to show another two text boxes to indicate minutes. One for Minutes Out then Minutes In. I have the problem to convert these minutes for instance if it is the out time is 15:50 and the in time the next day is at 15:55 it displays as 24 (in one text box) and 105 minutes (in the other text box). I would like the minutes added to the hour and have the balance of the remaining minutes in the minute text box. This should display 24 (in one text box) and 5 (in another text box). The ultimate aim is to get a result that shows a person was absent for a number of days, hours and minutes, eg, 2 days, 5 hours and 10 minutes. Any ideas on how I can modify my code to achieve this? Here’s my code. Please Help Dim number1 As Date Dim number2 As Date Dim number3 As Integer Dim number4 As Integer Dim Number5 As Integer Dim Number6 As Integer Dim answer As Integer Dim answer2 As Integer Dim answer3 As Integer Dim answer4 As Integer Dim answer5 As String number1 = DTPicker1 number2 = DTPicker2 number3 = Txthourout number4 = TxtHourin Number5 = TxtMinuteout Number6 = TxtMinuetIn answer = number2 - number1 answer2 = answer * 24 answer3 = answer2 - number3 answer4 = answer3 + number4 answer5 = Number5 + Number6 TextBox1.Text = answer4 TextBox2.Text = answer5 End Sub

  Read the article

• JavaScript regular expression literal persists between function calls

  - by Charles Anderson

  I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

  Read the article

• mod_rewrite not working for a specific directory

  - by punkish

  This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

  Read the article

• Oracle Coherence, Split-Brain and Recovery Protocols In Detail

  - by Ricardo Ferreira

  This article provides a high level conceptual overview of Split-Brain scenarios in distributed systems. It will focus on a specific example of cluster communication failure and recovery in Oracle Coherence. This includes a discussion on the witness protocol (used to remove failed cluster members) and the panic protocol (used to resolve Split-Brain scenarios). Note that the removal of cluster members does not necessarily indicate a Split-Brain condition. Oracle Coherence does not (and cannot) detect a Split-Brain as it occurs, the condition is only detected when cluster members that previously lost contact with each other regain contact. Cluster Topology and Configuration In order to create an good didactic for the article, let's assume a cluster topology and configuration. In this example we have a six member cluster, consisting of one JVM on each physical machine. The member IDs are as follows: Member ID  IP Address  1  10.149.155.76  2  10.149.155.77  3  10.149.155.236  4  10.149.155.75  5  10.149.155.79  6  10.149.155.78 Members 1, 2, and 3 are connected to a switch, and members 4, 5, and 6 are connected to a second switch. There is a link between the two switches, which provides network connectivity between all of the machines. Member 1 is the first member to join this cluster, thus making it the senior member. Member 6 is the last member to join this cluster. Here is a log snippet from Member 6 showing the complete member set: 2010-02-26 15:27:57.390/3.062 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=main, member=6): Started DefaultCacheServer... SafeCluster: Name=cluster:0xDDEB Group{Address=224.3.5.3, Port=35465, TTL=4} MasterMemberSet ( ThisMember=Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) OldestMember=Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) ActualMemberSet=MemberSet(Size=6, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=5, Timestamp=2010-02-26 15:27:49.095, Address=10.149.155.79:8088, MachineId=1103, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:3229, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) RecycleMillis=120000 RecycleSet=MemberSet(Size=0, BitSetCount=0 ) ) At approximately 15:30, the connection between the two switches is severed: Thirty seconds later (the default packet timeout in development mode) the logs indicate communication failures across the cluster. In this example, the communication failure was caused by a network failure. In a production setting, this type of communication failure can have many root causes, including (but not limited to) network failures, excessive GC, high CPU utilization, swapping/virtual memory, and exceeding maximum network bandwidth. In addition, this type of failure is not necessarily indicative of a split brain. Any communication failure will be logged in this fashion. Member 2 logs a communication failure with Member 5: 2010-02-26 15:30:32.638/196.928 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=2): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=5, Timestamp=2010-02-26 15:27:49.095, Address=10.149.155.79:8088, MachineId=1103, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:3229, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) ) The Coherence clustering protocol (TCMP) is a reliable transport mechanism built on UDP. In order for the protocol to be reliable, it requires an acknowledgement (ACK) for each packet delivered. If a packet fails to be acknowledged within the configured timeout period, the Coherence cluster member will log a packet timeout (as seen in the log message above). When this occurs, the cluster member will consult with other members to determine who is at fault for the communication failure. If the witness members agree that the suspect member is at fault, the suspect is removed from the cluster. If the witnesses unanimously disagree, the accuser is removed. This process is known as the witness protocol. Since Member 2 cannot communicate with Member 5, it selects two witnesses (Members 1 and 4) to determine if the communication issue is with Member 5 or with itself (Member 2). However, Member 4 is on the switch that is no longer accessible by Members 1, 2 and 3; thus a packet timeout for member 4 is recorded as well: 2010-02-26 15:30:35.648/199.938 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=2): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) Member 1 has the ability to confirm the departure of member 4, however Member 6 cannot as it is also inaccessible. At the same time, Member 3 sends a request to remove Member 6, which is followed by a report from Member 3 indicating that Member 6 has departed the cluster: 2010-02-26 15:30:35.706/199.996 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=2): MemberLeft request for Member 6 received from Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) 2010-02-26 15:30:35.709/199.999 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=2): MemberLeft notification for Member 6 received from Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) The log for Member 3 determines how Member 6 departed the cluster: 2010-02-26 15:30:35.161/191.694 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=3): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) ) 2010-02-26 15:30:35.165/191.698 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=3): Member departure confirmed by MemberSet(Size=2, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) Member(Id=2, Timestamp=2010-02-26 15:27:17.847, Address=10.149.155.77:8088, MachineId=1101, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:296, Role=CoherenceServer) ); removing Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) In this case, Member 3 happened to select two witnesses that it still had connectivity with (Members 1 and 2) thus resulting in a simple decision to remove Member 6. Given the departure of Member 6, Member 2 is left with a single witness to confirm the departure of Member 4: 2010-02-26 15:30:35.713/200.003 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=2): Member departure confirmed by MemberSet(Size=1, BitSetCount=2 Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) ); removing Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) In the meantime, Member 4 logs a missing heartbeat from the senior member. This message is also logged on Members 5 and 6. 2010-02-26 15:30:07.906/150.453 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=PacketListenerN, member=4): Scheduled senior member heartbeat is overdue; rejoining multicast group. Next, Member 4 logs a TcpRing failure with Member 2, thus resulting in the termination of Member 2: 2010-02-26 15:30:21.421/163.968 Oracle Coherence GE 3.5.3/465p2 <D4> (thread=Cluster, member=4): TcpRing: Number of socket exceptions exceeded maximum; last was "java.net.SocketTimeoutException: connect timed out"; removing the member: 2 For quick process termination detection, Oracle Coherence utilizes a feature called TcpRing which is a sparse collection of TCP/IP-based connections between different members in the cluster. Each member in the cluster is connected to at least one other member, which (if at all possible) is running on a different physical box. This connection is not used for any data transfer, only heartbeat communications are sent once a second per each link. If a certain number of exceptions are thrown while trying to re-establish a connection, the member throwing the exceptions is removed from the cluster. Member 5 logs a packet timeout with Member 3 and cites witnesses Members 4 and 6: 2010-02-26 15:30:29.791/165.037 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=PacketPublisher, member=5): Timeout while delivering a packet; requesting the departure confirmation for Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) by MemberSet(Size=2, BitSetCount=2 Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ) 2010-02-26 15:30:29.798/165.044 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=5): Member departure confirmed by MemberSet(Size=2, BitSetCount=2 Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member(Id=6, Timestamp=2010-02-26 15:27:58.635, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) ); removing Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer) Eventually we are left with two distinct clusters consisting of Members 1, 2, 3 and Members 4, 5, 6, respectively. In the latter cluster, Member 4 is promoted to senior member. The connection between the two switches is restored at 15:33. Upon the restoration of the connection, the cluster members immediately receive cluster heartbeats from the two senior members. In the case of Members 1, 2, and 3, the following is logged: 2010-02-26 15:33:14.970/369.066 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=1): The member formerly known as Member(Id=4, Timestamp=2010-02-26 15:30:35.341, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) has been forcefully evicted from the cluster, but continues to emit a cluster heartbeat; henceforth, the member will be shunned and its messages will be ignored. Likewise for Members 4, 5, and 6: 2010-02-26 15:33:14.343/336.890 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=4): The member formerly known as Member(Id=1, Timestamp=2010-02-26 15:30:31.64, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) has been forcefully evicted from the cluster, but continues to emit a cluster heartbeat; henceforth, the member will be shunned and its messages will be ignored. This message indicates that a senior heartbeat is being received from members that were previously removed from the cluster, in other words, something that should not be possible. For this reason, the recipients of these messages will initially ignore them. After several iterations of these messages, the existence of multiple clusters is acknowledged, thus triggering the panic protocol to reconcile this situation. When the presence of more than one cluster (i.e. Split-Brain) is detected by a Coherence member, the panic protocol is invoked in order to resolve the conflicting clusters and consolidate into a single cluster. The protocol consists of the removal of smaller clusters until there is one cluster remaining. In the case of equal size clusters, the one with the older Senior Member will survive. Member 1, being the oldest member, initiates the protocol: 2010-02-26 15:33:45.970/400.066 Oracle Coherence GE 3.5.3/465p2 <Warning> (thread=Cluster, member=1): An existence of a cluster island with senior Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) containing 3 nodes have been detected. Since this Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) is the senior of an older cluster island, the panic protocol is being activated to stop the other island's senior and all junior nodes that belong to it. Member 3 receives the panic: 2010-02-26 15:33:45.803/382.336 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=3): Received panic from senior Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer) caused by Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer) Member 4, the senior member of the younger cluster, receives the kill message from Member 3: 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. In turn, Member 4 requests the departure of its junior members 5 and 6: 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. 2010-02-26 15:33:43.343/349.015 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=6): Received a Kill message from a valid Member(Id=4, Timestamp=2010-02-26 15:27:39.574, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer); stopping cluster service. Once Members 4, 5, and 6 restart, they rejoin the original cluster with senior member 1. The log below is from Member 4. Note that it receives a different member id when it rejoins the cluster. 2010-02-26 15:33:44.921/367.468 Oracle Coherence GE 3.5.3/465p2 <Error> (thread=Cluster, member=4): Received a Kill message from a valid Member(Id=3, Timestamp=2010-02-26 15:27:24.892, Address=10.149.155.236:8088, MachineId=1260, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:32459, Role=CoherenceServer); stopping cluster service. 2010-02-26 15:33:46.921/369.468 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Service Cluster left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Invocation:InvocationService, member=4): Service InvocationService left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=OptimisticCache, member=4): Service OptimisticCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=ReplicatedCache, member=4): Service ReplicatedCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=DistributedCache, member=4): Service DistributedCache left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Invocation:Management, member=4): Service Management left the cluster 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service Management with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service DistributedCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service ReplicatedCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service OptimisticCache with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member 6 left service InvocationService with senior member 5 2010-02-26 15:33:47.046/369.593 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=4): Member(Id=6, Timestamp=2010-02-26 15:33:47.046, Address=10.149.155.78:8088, MachineId=1102, Location=process:228, Role=CoherenceServer) left Cluster with senior member 4 2010-02-26 15:33:49.218/371.765 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=main, member=n/a): Restarting cluster 2010-02-26 15:33:49.421/371.968 Oracle Coherence GE 3.5.3/465p2 <D5> (thread=Cluster, member=n/a): Service Cluster joined the cluster with senior service member n/a 2010-02-26 15:33:49.625/372.172 Oracle Coherence GE 3.5.3/465p2 <Info> (thread=Cluster, member=n/a): This Member(Id=5, Timestamp=2010-02-26 15:33:50.499, Address=10.149.155.75:8088, MachineId=1099, Location=process:800, Role=CoherenceServer, Edition=Grid Edition, Mode=Development, CpuCount=2, SocketCount=1) joined cluster "cluster:0xDDEB" with senior Member(Id=1, Timestamp=2010-02-26 15:27:06.931, Address=10.149.155.76:8088, MachineId=1100, Location=site:usdhcp.oraclecorp.com,machine:dhcp-burlington6-4fl-east-10-149,process:511, Role=CoherenceServer, Edition=Grid Edition, Mode=Development, CpuCount=2, SocketCount=2) Cool isn't it?

  Read the article

• What Every Developer Should Know About MSI Components

  - by Alois Kraus

  Hopefully nothing. But if you have to do more than simple XCopy deployment and you need to support updates, upgrades and perhaps side by side scenarios there is no way around MSI. You can create Msi files with a Visual Studio Setup project which is severely limited or you can use the Windows Installer Toolset. I cannot talk about WIX with my German colleagues because WIX has a very special meaning. It is funny to always use the long name when I talk about deployment possibilities. Alternatively you can buy commercial tools which help you to author Msi files but I am not sure how good they are. Given enough pain with existing solutions you can also learn the MSI Apis and create your own packaging solution. If I were you I would use either a commercial visual tool when you do easy deployments or use the free Windows Installer Toolset. Once you know the WIX schema you can create well formed wix xml files easily with any editor. Then you can “compile” from the wxs files your Msi package. Recently I had the “pleasure” to get my hands dirty with C++ (again) and the MSI technology. Installation is a complex topic but after several month of digging into arcane MSI issues I can safely say that there should exist an easier way to install and update files as today. I am not alone with this statement as John Robbins (creator of the cool tool Paraffin) states: “.. It's a brittle and scary API in Windows …”. To help other people struggling with installation issues I present you the advice I (and others) found useful and what will happen if you ignore this advice. What is a MSI file? A MSI file is basically a database with tables which reference each other to control how your un/installation should work. The basic idea is that you declare via these tables what you want to install and MSI controls the how to get your stuff onto or off your machine. Your “stuff” consists usually of files, registry keys, shortcuts and environment variables. Therefore the most important tables are File, Registry, Environment and Shortcut table which define what will be un/installed. The key to master MSI is that every resource (file, registry key ,…) is associated with a MSI component. The actual payload consists of compressed files in the CAB format which can either be embedded into the MSI file or reside beside the MSI file or in a subdirectory below it. To examine MSI files you need Orca a free MSI editor provided by MS. There is also another free editor called Super Orca which does support diffs between MSI and it does not lock the MSI files. But since Orca comes with a shell extension I tend to use only Orca because it is so easy to right click on a MSI file and open it with this tool. How Do I Install It? Double click it. This does work for fresh installations as well as major upgrades. Updates need to be installed via the command line via msiexec /i <msi> REINSTALL=ALL REINSTALLMODE=vomus   This tells the installer to reinstall all already installed features (new features will NOT be installed). The reinstallmode letters do force an overwrite of the old cached package in the %WINDIR%\Installer folder. All files, shortcuts and registry keys are redeployed if they are missing or need to be replaced with a newer version. When things did go really wrong and you want to overwrite everything unconditionally use REINSTALLMODE=vamus. How To Enable MSI Logs? You can download a MSI from Microsoft which installs some registry keys to enable full MSI logging. The log files can be found in your %TEMP% folder and are called MSIxxxx.log. Alternatively you can add to your msiexec command line the option msiexec …. /l*vx <LogFileName> Personally I find it rather strange that * does not mean full logging. To really get all logs I need to add v and x which is documented in the msiexec help but I still find this behavior unintuitive. What are MSI components? The whole MSI logic is bound to the concept of MSI components. Nearly every msi table has a Component column which binds an installable resource to a component. Below are the screenshots of the FeatureComponents and Component table of an example MSI. The Feature table defines basically the feature hierarchy.  To find out what belongs to a feature you need to look at the FeatureComponents table where for each feature the components are listed which will be installed when a feature is installed. The MSI components are defined in the  Component table. This table has as first column the component name and as second column the component id which is a GUID. All resources you want to install belong to a MSI component. Therefore nearly all MSI tables have a Component_ column which contains the component name. If you look e.g. a the File table you see that every file belongs to a component which is true for all other tables which install resources. The component table is the glue between all other tables which contain the resources you want to install. So far so easy. Why is MSI then so complex? Most MSI problems arise from the fact that you did violate a MSI component rule in one or the other way. When you install a feature the reference count for all components belonging to this feature will increase by one. If your component is installed by more than one feature it will get a higher refcount. When you uninstall a feature its refcount will drop by one. Interesting things happen if the component reference count reaches zero: Then all associated resources will be deleted. That looks like a reasonable thing and it is. What it makes complex are the strange component rules you have to follow. Below are some important component rules from the Tao of the Windows Installer … Rule 16: Follow Component Rules Components are a very important part of the Installer technology. They are the means whereby the Installer manages the resources that make up your application. The SDK provides the following guidelines for creating components in your package: Never create two components that install a resource under the same name and target location. If a resource must be duplicated in multiple components, change its name or target location in each component. This rule should be applied across applications, products, product versions, and companies. Two components must not have the same key path file. This is a consequence of the previous rule. The key path value points to a particular file or folder belonging to the component that the installer uses to detect the component. If two components had the same key path file, the installer would be unable to distinguish which component is installed. Two components however may share a key path folder. Do not create a version of a component that is incompatible with all previous versions of the component. This rule should be applied across applications, products, product versions, and companies. Do not create components containing resources that will need to be installed into more than one directory on the user’s system. The installer installs all of the resources in a component into the same directory. It is not possible to install some resources into subdirectories. Do not include more than one COM server per component. If a component contains a COM server, this must be the key path for the component. Do not specify more than one file per component as a target for the Start menu or a Desktop shortcut. … And these rules do not even talk about component ids, update packages and upgrades which you need to understand as well. Lets suppose you install two MSIs (MSI1 and MSI2) which have the same ComponentId but different component names. Both do install the same file. What will happen when you uninstall MSI2?   Hm the file should stay there. But the component names are different. Yes and yes. But MSI uses not use the component name as key for the refcount. Instead the ComponentId column of the Component table which contains a GUID is used as identifier under which the refcount is stored. The components Comp1 and Comp2 are identical from the MSI perspective. After the installation of both MSIs the Component with the Id {100000….} has a refcount of two. After uninstallation of one MSI there is still a refcount of one which drops to zero just as expected when we uninstall the last msi. Then the file which was the same for both MSIs is deleted. You should remember that MSI keeps a refcount across MSIs for components with the same component id. MSI does manage components not the resources you did install. The resources associated with a component are then and only then deleted when the refcount of the component reaches zero.   The dependencies between features, components and resources can be described as relations. m,k are numbers >= 1, n can be 0. Inside a MSI the following relations are valid Feature    1  –> n Components Component    1 –> m Features Component      1  –>  k Resources These relations express that one feature can install several components and features can share components between them. Every (meaningful) component will install at least one resource which means that its name (primary key to stay in database speak) does occur in some other table in the Component column as value which installs some resource. Lets make it clear with an example. We want to install with the feature MainFeature some files a registry key and a shortcut. We can then create components Comp1..3 which are referenced by the resources defined in the corresponding tables.   Feature Component Registry File Shortcuts MainFeature Comp1 RegistryKey1     MainFeature Comp2   File.txt   MainFeature Comp3   File2.txt Shortcut to File2.txt   It is illegal that the same resource is part of more than one component since this would break the refcount mechanism. Lets illustrate this:            Feature ComponentId Resource Reference Count Feature1 {1000-…} File1.txt 1 Feature2 {2000-….} File1.txt 1 The installation part works well but what happens when you uninstall Feature2? Component {20000…} gets a refcount of zero where MSI deletes all resources belonging to this component. In this case File1.txt will be deleted. But Feature1 still has another component {10000…} with a refcount of one which means that the file was deleted too early. You just have ruined your installation. To fix it you then need to click on the Repair button under Add/Remove Programs to let MSI reinstall any missing registry keys, files or shortcuts. The vigilant reader might has noticed that there is more in the Component table. Beside its name and GUID it has also an installation directory, attributes and a KeyPath. The KeyPath is a reference to a file or registry key which is used to detect if the component is already installed. This becomes important when you repair or uninstall a component. To find out if the component is already installed MSI checks if the registry key or file referenced by the KeyPath property does exist. When it does not exist it assumes that it was either already uninstalled (can lead to problems during uninstall) or that it is already installed and all is fine. Why is this detail so important? Lets put all files into one component. The KeyPath should be then one of the files of your component to check if it was installed or not. When your installation becomes corrupt because a file was deleted you cannot repair it with the Repair button under Add/Remove Programs because MSI checks the component integrity via the Resource referenced by its KeyPath. As long as you did not delete the KeyPath file MSI thinks all resources with your component are installed and never executes any repair action. You get even more trouble when you try to remove files during an upgrade (you cannot remove files during an update) from your super component which contains all files. The only way out and therefore best practice is to assign for every resource you want to install an extra component. This ensures painless updatability and repairs and you have much less effort to remove specific files during an upgrade. In effect you get this best practice relation Feature 1  –> n Components Component   1  –>  1 Resources MSI Component Rules Rule 1 – One component per resource Every resource you want to install (file, registry key, value, environment value, shortcut, directory, …) must get its own component which does never change between versions as long as the install location is the same. Penalty If you add more than one resources to a component you will break the repair capability of MSI because the KeyPath is used to check if the component needs repair. MSI ComponentId Files MSI 1.0 {1000} File1-5 MSI 2.0 {2000} File2-5 You want to remove File1 in version 2.0 of your MSI. Since you want to keep the other files you create a new component and add them there. MSI will delete all files if the component refcount of {1000} drops to zero. The files you want to keep are added to the new component {2000}. Ok that does work if your upgrade does uninstall the old MSI first. This will cause the refcount of all previously installed components to reach zero which means that all files present in version 1.0 are deleted. But there is a faster way to perform your upgrade by first installing your new MSI and then remove the old one.  If you choose this upgrade path then you will loose File1-5 after your upgrade and not only File1 as intended by your new component design.   Rule 2 – Only add, never remove resources from a component If you did follow rule 1 you will not need Rule 2. You can add in a patch more resources to one component. That is ok. But you can never remove anything from it. There are tricky ways around that but I do not want to encourage bad component design. Penalty Lets assume you have 2 MSI files which install under the same component one file   MSI1 MSI2 {1000} - ComponentId {1000} – ComponentId File1.txt File2.txt   When you install and uninstall both MSIs you will end up with an installation where either File1 or File2 will be left. Why? It seems that MSI does not store the resources associated with each component in its internal database. Instead Windows will simply query the MSI that is currently uninstalled for all resources belonging to this component. Since it will find only one file and not two it will only uninstall one file. That is the main reason why you never can remove resources from a component!   Rule 3 Never Remove A Component From an Update MSI. This is the same as if you change the GUID of a component by accident for your new update package. The resulting update package will not contain all components from the previously installed package. Penalty When you remove a component from a feature MSI will set the feature state during update to Advertised and log a warning message into its log file when you did enable MSI logging. SELMGR: ComponentId '{2DCEA1BA-3E27-E222-484C-D0D66AEA4F62}' is registered to feature 'xxxxxxx, but is not present in the Component table.  Removal of components from a feature is not supported! MSI (c) (24:44) [07:53:13:436]: SELMGR: Removal of a component from a feature is not supported Advertised means that MSI treats all components of this feature as not installed. As a consequence during uninstall nothing will be removed since it is not installed! This is not only bad because uninstall does no longer work but this feature will also not get the required patches. All other features which have followed component versioning rules for update packages will be updated but the one faulty feature will not. This results in very hard to find bugs why an update was only partially successful. Things got better with Windows Installer 4.5 but you cannot rely on that nobody will use an older installer. It is a good idea to add to your update msiexec call MSIENFORCEUPGRADECOMPONENTRULES=1 which will abort the installation if you did violate this rule.

  Read the article

• Developing Spring Portlet for use inside Weblogic Portal / Webcenter Portal

  - by Murali Veligeti

  We need to understand the main difference between portlet workflow and servlet workflow.The main difference between portlet workflow and servlet workflow is that, the request to the portlet can have two distinct phases: 1) Action phase 2) Render phase. The Action phase is executed only once and is where any 'backend' changes or actions occur, such as making changes in a database. The Render phase then produces what is displayed to the user each time the display is refreshed. The critical point here is that for a single overall request, the action phase is executed only once, but the render phase may be executed multiple times. This provides a clean separation between the activities that modify the persistent state of your system and the activities that generate what is displayed to the user.The dual phases of portlet requests are one of the real strengths of the JSR-168 specification. For example, dynamic search results can be updated routinely on the display without the user explicitly re-running the search. Most other portlet MVC frameworks attempt to completely hide the two phases from the developer and make it look as much like traditional servlet development as possible - we think this approach removes one of the main benefits of using portlets. So, the separation of the two phases is preserved throughout the Spring Portlet MVC framework. The primary manifestation of this approach is that where the servlet version of the MVC classes will have one method that deals with the request, the portlet version of the MVC classes will have two methods that deal with the request: one for the action phase and one for the render phase. For example, where the servlet version of AbstractController has the handleRequestInternal(..) method, the portlet version of AbstractController has handleActionRequestInternal(..) and handleRenderRequestInternal(..) methods.The Spring Portlet Framework is designed around a DispatcherPortlet that dispatches requests to handlers, with configurable handler mappings and view resolution, just as the DispatcherServlet in the Spring Web Framework does.  Developing portlet.xml Let's start the sample development by creating the portlet.xml file in the /WebContent/WEB-INF/ folder as shown below: <?xml version="1.0" encoding="UTF-8"?> <portlet-app version="2.0" xmlns="http://java.sun.com/xml/ns/portlet/portlet-app_2_0.xsd" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <portlet> <portlet-name>SpringPortletName</portlet-name> <portlet-class>org.springframework.web.portlet.DispatcherPortlet</portlet-class> <supports> <mime-type>text/html</mime-type> <portlet-mode>view</portlet-mode> </supports> <portlet-info> <title>SpringPortlet</title> </portlet-info> </portlet> </portlet-app> DispatcherPortlet is responsible for handling every client request. When it receives a request, it finds out which Controller class should be used for handling this request, and then it calls its handleActionRequest() or handleRenderRequest() method based on the request processing phase. The Controller class executes business logic and returns a View name that should be used for rendering markup to the user. The DispatcherPortlet then forwards control to that View for actual markup generation. As you can see, DispatcherPortlet is the central dispatcher for use within Spring Portlet MVC Framework. Note that your portlet application can define more than one DispatcherPortlet. If it does so, then each of these portlets operates its own namespace, loading its application context and handler mapping. The DispatcherPortlet is also responsible for loading application context (Spring configuration file) for this portlet. First, it tries to check the value of the configLocation portlet initialization parameter. If that parameter is not specified, it takes the portlet name (that is, the value of the <portlet-name> element), appends "-portlet.xml" to it, and tries to load that file from the /WEB-INF folder. In the portlet.xml file, we did not specify the configLocation initialization parameter, so let's create SpringPortletName-portlet.xml file in the next section. Developing SpringPortletName-portlet.xml Create the SpringPortletName-portlet.xml file in the /WebContent/WEB-INF folder of your application as shown below: <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.0.xsd"> <bean id="viewResolver" class="org.springframework.web.servlet.view.InternalResourceViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView"/> <property name="prefix" value="/jsp/"/> <property name="suffix" value=".jsp"/> </bean> <bean id="pointManager" class="com.wlp.spring.bo.internal.PointManagerImpl"> <property name="users"> <list> <ref bean="point1"/> <ref bean="point2"/> <ref bean="point3"/> <ref bean="point4"/> </list> </property> </bean> <bean id="point1" class="com.wlp.spring.bean.User"> <property name="name" value="Murali"/> <property name="points" value="6"/> </bean> <bean id="point2" class="com.wlp.spring.bean.User"> <property name="name" value="Sai"/> <property name="points" value="13"/> </bean> <bean id="point3" class="com.wlp.spring.bean.User"> <property name="name" value="Rama"/> <property name="points" value="43"/> </bean> <bean id="point4" class="com.wlp.spring.bean.User"> <property name="name" value="Krishna"/> <property name="points" value="23"/> </bean> <bean id="messageSource" class="org.springframework.context.support.ResourceBundleMessageSource"> <property name="basename" value="messages"/> </bean> <bean name="/users.htm" id="userController" class="com.wlp.spring.controller.UserController"> <property name="pointManager" ref="pointManager"/> </bean> <bean name="/pointincrease.htm" id="pointIncreaseController" class="com.wlp.spring.controller.IncreasePointsFormController"> <property name="sessionForm" value="true"/> <property name="pointManager" ref="pointManager"/> <property name="commandName" value="pointIncrease"/> <property name="commandClass" value="com.wlp.spring.bean.PointIncrease"/> <property name="formView" value="pointincrease"/> <property name="successView" value="users"/> </bean> <bean id="parameterMappingInterceptor" class="org.springframework.web.portlet.handler.ParameterMappingInterceptor" /> <bean id="portletModeParameterHandlerMapping" class="org.springframework.web.portlet.handler.PortletModeParameterHandlerMapping"> <property name="order" value="1" /> <property name="interceptors"> <list> <ref bean="parameterMappingInterceptor" /> </list> </property> <property name="portletModeParameterMap"> <map> <entry key="view"> <map> <entry key="pointincrease"> <ref bean="pointIncreaseController" /> </entry> <entry key="users"> <ref bean="userController" /> </entry> </map> </entry> </map> </property> </bean> <bean id="portletModeHandlerMapping" class="org.springframework.web.portlet.handler.PortletModeHandlerMapping"> <property name="order" value="2" /> <property name="portletModeMap"> <map> <entry key="view"> <ref bean="userController" /> </entry> </map> </property> </bean> </beans> The SpringPortletName-portlet.xml file is an application context file for your MVC portlet. It has a couple of bean definitions: viewController. At this point, remember that the viewController bean definition points to the com.ibm.developerworks.springmvc.ViewController.java class. portletModeHandlerMapping. As we discussed in the last section, whenever DispatcherPortlet gets a client request, it tries to find a suitable Controller class for handling that request. That is where PortletModeHandlerMapping comes into the picture. The PortletModeHandlerMapping class is a simple implementation of the HandlerMapping interface and is used by DispatcherPortlet to find a suitable Controller for every request. The PortletModeHandlerMapping class uses Portlet mode for the current request to find a suitable Controller class to use for handling the request. The portletModeMap property of portletModeHandlerMapping bean is the place where we map the Portlet mode name against the Controller class. In the sample code, we show that viewController is responsible for handling View mode requests. Developing UserController.java In the preceding section, you learned that the viewController bean is responsible for handling all the View mode requests. Your next step is to create the UserController.java class as shown below: public class UserController extends AbstractController { private PointManager pointManager; public void handleActionRequest(ActionRequest request, ActionResponse response) throws Exception { } public ModelAndView handleRenderRequest(RenderRequest request, RenderResponse response) throws ServletException, IOException { String now = (new java.util.Date()).toString(); Map<String, Object> myModel = new HashMap<String, Object>(); myModel.put("now", now); myModel.put("users", this.pointManager.getUsers()); return new ModelAndView("users", "model", myModel); } public void setPointManager(PointManager pointManager) { this.pointManager = pointManager; } } Every controller class in Spring Portlet MVC Framework must implement the org.springframework.web. portlet.mvc.Controller interface directly or indirectly. To make things easier, Spring Framework provides AbstractController class, which is the default implementation of the Controller interface. As a developer, you should always extend your controller from either AbstractController or one of its more specific subclasses. Any implementation of the Controller class should be reusable, thread-safe, and capable of handling multiple requests throughout the lifecycle of the portlet. In the sample code, we create the ViewController class by extending it from AbstractController. Because we don't want to do any action processing in the HelloSpringPortletMVC portlet, we override only the handleRenderRequest() method of AbstractController. Now, the only thing that HelloWorldPortletMVC should do is render the markup of View.jsp to the user when it receives a user request to do so. To do that, return the object of ModelAndView with a value of view equal to View. Developing web.xml According to Portlet Specification 1.0, every portlet application is also a Servlet Specification 2.3-compliant Web application, and it needs a Web application deployment descriptor (that is, web.xml). Let’s create the web.xml file in the /WEB-INF/ folder as shown in listing 4. Follow these steps: Open the existing web.xml file located at /WebContent/WEB-INF/web.xml. Replace the contents of this file with the code as shown below: <servlet> <servlet-name>ViewRendererServlet</servlet-name> <servlet-class>org.springframework.web.servlet.ViewRendererServlet</servlet-class> </servlet> <servlet-mapping> <servlet-name>ViewRendererServlet</servlet-name> <url-pattern>/WEB-INF/servlet/view</url-pattern> </servlet-mapping> <context-param> <param-name>contextConfigLocation</param-name> <param-value>/WEB-INF/applicationContext.xml</param-value> </context-param> <listener> <listener-class>org.springframework.web.context.ContextLoaderListener</listener-class> </listener> The web.xml file for the sample portlet declares two things: ViewRendererServlet. The ViewRendererServlet is the bridge servlet for portlet support. During the render phase, DispatcherPortlet wraps PortletRequest into ServletRequest and forwards control to ViewRendererServlet for actual rendering. This process allows Spring Portlet MVC Framework to use the same View infrastructure as that of its servlet version, that is, Spring Web MVC Framework. ContextLoaderListener. The ContextLoaderListener class takes care of loading Web application context at the time of the Web application startup. The Web application context is shared by all the portlets in the portlet application. In case of duplicate bean definition, the bean definition in the portlet application context takes precedence over the Web application context. The ContextLoader class tries to read the value of the contextConfigLocation Web context parameter to find out the location of the context file. If the contextConfigLocation parameter is not set, then it uses the default value, which is /WEB-INF/applicationContext.xml, to load the context file. The Portlet Controller interface requires two methods that handle the two phases of a portlet request: the action request and the render request. The action phase should be capable of handling an action request and the render phase should be capable of handling a render request and returning an appropriate model and view. While the Controller interface is quite abstract, Spring Portlet MVC offers a lot of controllers that already contain a lot of the functionality you might need – most of these are very similar to controllers from Spring Web MVC. The Controller interface just defines the most common functionality required of every controller - handling an action request, handling a render request, and returning a model and a view. How rendering works As you know, when the user tries to access a page with PointSystemPortletMVC portlet on it or when the user performs some action on any other portlet on that page or tries to refresh that page, a render request is sent to the PointSystemPortletMVC portlet. In the sample code, because DispatcherPortlet is the main portlet class, Weblogic Portal / Webcenter Portal calls its render() method and then the following sequence of events occurs: The render() method of DispatcherPortlet calls the doDispatch() method, which in turn calls the doRender() method. After the doRenderService() method gets control, first it tries to find out the locale of the request by calling the PortletRequest.getLocale() method. This locale is used while making all the locale-related decisions for choices such as which resource bundle should be loaded or which JSP should be displayed to the user based on the locale. After that, the doRenderService() method starts iterating through all the HandlerMapping classes configured for this portlet, calling their getHandler() method to identify the appropriate Controller for handling this request. In the sample code, we have configured only PortletModeHandlerMapping as a HandlerMapping class. The PortletModeHandlerMapping class reads the value of the current portlet mode, and based on that, it finds out, the Controller class that should be used to handle this request. In the sample code, ViewController is configured to handle the View mode request so that the PortletModeHandlerMapping class returns the object of ViewController. After the object of ViewController is returned, the doRenderService() method calls its handleRenderRequestInternal() method. Implementation of the handleRenderRequestInternal() method in ViewController.java is very simple. It logs a message saying that it got control, and then it creates an instance of ModelAndView with a value equal to View and returns it to DispatcherPortlet. After control returns to doRenderService(), the next task is to figure out how to render View. For that, DispatcherPortlet starts iterating through all the ViewResolvers configured in your portlet application, calling their resolveViewName() method. In the sample code we have configured only one ViewResolver, InternalResourceViewResolver. When its resolveViewName() method is called with viewName, it tries to add /WEB-INF/jsp as a prefix to the view name and to add JSP as a suffix. And it checks if /WEB-INF/jsp/View.jsp exists. If it does exist, it returns the object of JstlView wrapping View.jsp. After control is returned to the doRenderService() method, it creates the object PortletRequestDispatcher, which points to /WEB-INF/servlet/view – that is, ViewRendererServlet. Then it sets the object of JstlView in the request and dispatches the request to ViewRendererServlet. After ViewRendererServlet gets control, it reads the JstlView object from the request attribute and creates another RequestDispatcher pointing to the /WEB-INF/jsp/View.jsp URL and passes control to it for actual markup generation. The markup generated by View.jsp is returned to user. At this point, you may question the need for ViewRendererServlet. Why can't DispatcherPortlet directly forward control to View.jsp? Adding ViewRendererServlet in between allows Spring Portlet MVC Framework to reuse the existing View infrastructure. You may appreciate this more when we discuss how easy it is to integrate Apache Tiles Framework with your Spring Portlet MVC Framework. The attached project SpringPortlet.zip should be used to import the project in to your OEPE Workspace. SpringPortlet_Jars.zip contains jar files required for the application. Project is written on Spring 2.5.  The same JSR 168 portlet should work on Webcenter Portal as well.  Downloads: Download WeblogicPotal Project which consists of Spring Portlet. Download Spring Jars In-addition to above you need to download Spring.jar (Spring2.5)

  Read the article

• Improved appointment rendering in RadScheduler for ASP.NET AJAX, Q1 2010

  Now that Q1 2010 release is out in the wild, we can sit down and discuss some of the changes we decided to make in the new release. One of them is the new appointment rendering of RadScheduler - a potentially breaking change, but a much needed one. If you have problems with your old custom skins, include the old base stylesheet along with your RadScheduler and set EnableEmbeddedBaseStylesheet=false in your RadScheduler. You can find the said base stylesheet attached to this post.   While trying to improve the performance of RadScheduler, I noticed that the number of resources slows down the rendering and overall performance considerably. This had to be expected - the images to support the appointment rounded corners (and the predefined resources) were quite large. However, I didnt take into account that all browsers keep for performance reasons their images uncompressed in memory and with the color depth of the current desktop. A simple calculation later I discovered that the appointment sprite itself is taking 25MB memory when loaded. Add 5 resources to the fray and you have 150MB memory down with a single blow. As it turns out - a sprite image is not a panacea, if it gets too big - dont be afraid to break it in two. The loading time may suffer, but your browser suffers more while rendering a 25MB monster. First I thought of undertaking the aforementioned solution - breaking the appointment sprite in two and thus reducing the two appointment sprites to mere 2MB uncompressed. Then I thought - the rounded corners are small - I can use borders and backgrounds to simulate rounded appointment borders while still keeping the same HTML structure. The gradients can be done with a single 10x50px image plus we have a gain - border colors and backgrounds can be changed on the fly.  I started with five rendering elements at first, then tried with four and finally I settled on only three elements.  Behold the new appointment rendering (quite simple really):       On the left you can see that the first container has only top and bottom borders and a background. In fact, the background isnt even needed since it will be obscured by the elements on top of it. The whole first container is only needed for the four dots that reside in the four corners of the appointment. On top of this container is another one that holds the left and right borders and slightly lighter background to create the illusion of a second lighter border beside the other two. At last on top of all others is placed the text container that also holds the top and bottom borders and the gradient background. On the right you can see the final result - Im quite happy with it and I hope you will be too. After creating the new rendering we took another step further - we decided to use alpha gradients for the resource rendering, thus supporting any color appointments with rounded corners and gradients. You can see some examples below:We plan on adding BorderColor and BackColor properties  to the ResourceStyles definitions for Q1 SP1. However with the new rendering in Q1 2010 we do support BackColor and BorderColor appointment properties - you only need to set AppointmentStyleMode=Default to keep RadScheduler from switching to Simple appointment rendering. Here is one screenshot of RadScheduler with appointments set to different colors: I hope that you will enjoy working with the new appointments in RadScheduler. RadScheduler base stylesheet Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

  Read the article

• Improved appointment rendering in RadScheduler for ASP.NET AJAX, Q1 2010

  Now that Q1 2010 release is out in the wild, we can sit down and discuss some of the changes we decided to make in the new release. One of them is the new appointment rendering of RadScheduler - a potentially breaking change, but a much needed one. If you have problems with your old custom skins, include the old base stylesheet along with your RadScheduler and set EnableEmbeddedBaseStylesheet=false in your RadScheduler. You can find the said base stylesheet attached to this post.   While trying to improve the performance of RadScheduler, I noticed that the number of resources slows down the rendering and overall performance considerably. This had to be expected - the images to support the appointment rounded corners (and the predefined resources) were quite large. However, I didnt take into account that all browsers keep for performance reasons their images uncompressed in memory and with the color depth of the current desktop. A simple calculation later I discovered that the appointment sprite itself is taking 25MB memory when loaded. Add 5 resources to the fray and you have 150MB memory down with a single blow. As it turns out - a sprite image is not a panacea, if it gets too big - dont be afraid to break it in two. The loading time may suffer, but your browser suffers more while rendering a 25MB monster. First I thought of undertaking the aforementioned solution - breaking the appointment sprite in two and thus reducing the two appointment sprites to mere 2MB uncompressed. Then I thought - the rounded corners are small - I can use borders and backgrounds to simulate rounded appointment borders while still keeping the same HTML structure. The gradients can be done with a single 10x50px image plus we have a gain - border colors and backgrounds can be changed on the fly.  I started with five rendering elements at first, then tried with four and finally I settled on only three elements.  Behold the new appointment rendering (quite simple really):       On the left you can see that the first container has only top and bottom borders and a background. In fact, the background isnt even needed since it will be obscured by the elements on top of it. The whole first container is only needed for the four dots that reside in the four corners of the appointment. On top of this container is another one that holds the left and right borders and slightly lighter background to create the illusion of a second lighter border beside the other two. At last on top of all others is placed the text container that also holds the top and bottom borders and the gradient background. On the right you can see the final result - Im quite happy with it and I hope you will be too. After creating the new rendering we took another step further - we decided to use alpha gradients for the resource rendering, thus supporting any color appointments with rounded corners and gradients. You can see some examples below:We plan on adding BorderColor and BackColor properties  to the ResourceStyles definitions for Q1 SP1. However with the new rendering in Q1 2010 we do support BackColor and BorderColor appointment properties - you only need to set AppointmentStyleMode=Default to keep RadScheduler from switching to Simple appointment rendering. Here is one screenshot of RadScheduler with appointments set to different colors: I hope that you will enjoy working with the new appointments in RadScheduler. RadScheduler base stylesheet Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

  Read the article

• Search Alternative Search Engines from within Bing’s Search Page

  - by Asian Angel

  So you love using Bing Search but may still be curious to see what another search engine will provide if used. Now you can search using another search engine from within the Bing Search page and enjoy numbered results using two simple user scripts. Note: These user scripts may also be added to other browsers as well (i.e. Iron, Opera, etc.). Before Bing Search does nicely on searches but what if you would like to try the same search with another search engine? Having to manually open a new tab, navigate to the appropriate website, and then start a new search is not too convenient. Another possible frustration for some people may be knowing just how many search results that they have looked through. Well, both of these small problems are easy to fix with two wonderful user scripts. Installing the Scripts The first script that we installed (you may do either one first) was for adding alternative search engine links. Click “Install” to get started… Note: For our example we had the Greasemonkey extension installed. When the confirmation window pops up click on “Install” to finish adding the user script to Firefox. Repeating the same procedure as above add your second script to Firefox. Confirm the second user script installation and you are ready to enjoy nicer Bing Search results. After As you can see there are two small unobtrusive differences in our search results. The alternative search engine links are conveniently located at the top of the page and now you can easily know just how many search results that you have looked through. The results when we decided to try the search in a transfer over to Yahoo. Our search transferred to Ask Search. The alternative search links can be very helpful if Bing is not providing the kind of search results that you are hoping for. Still going very nicely past the 100 mark… Conclusion If you have been wanting a small booster to searching with Bing then these two scripts will get you on your way. Using Opera Browser? See our how-to for adding user scripts to Opera here. Links Install the Bing (Alternate Search Engine Links) User Script Install the Bing Numbered Search Results User Script Download the Greasemonkey extension for Firefox (Mozilla Add-ons) Download the Stylish extension for Firefox (Mozilla Add-ons) Similar Articles Productive Geek Tips Organize Your Firefox Search Engines Into FoldersFix for Slow "Instant Search" In Outlook 2007Gain Access to a Search Box in Google ChromeManage Web Searches In SafariModify Firefox’s Search Bar Behavior with SearchLoad Options TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Heaven & Hell Finder Icon Using TrueCrypt to Secure Your Data Quickly Schedule Meetings With NeedtoMeet Share Flickr Photos On Facebook Automatically Are You Blocked On Gtalk? Find out Discover Latest Android Apps On AppBrain

  Read the article

• Build Explorer version 1.1 for Visual Studio Team Explorer is released

  - by terje

  Our free extension to Visual Studio , the folder based Build Explorer Version 1.1 has now been released, and uploaded to the Visual Studio Gallery and Codeplex. We have collected up a few changes and some bugs, as follows: Changes: Queue Default Builds can now be optionally fully enabled, fully disabled or enabled just for leaf nodes (=disabled for folders).  If you got a large number of builds it was pretty scary to be able to launch all of them with just one click.  However, it is nice to avoid having the dialog box up when you want to just run off a single build.  That’s the reasoning between the 3rd choice here. Auto fill-in of the builds at start up and refresh  This was a request that came up a lot, and which was also irritating to us.  When the Team Project is opened, the Build explorer will start by itself and fill up it’s tree. So you don’t need to click the node anymore. There was also quite a bit of flashing when the tree filled up, this has been reduced to just a single top level fill before it collapses the node. The speed of the buildup of the tree has also been increased. The “All Build Definitions” node is now shown on top of the list Login box appeared in certain cross domain situations. This was a fix for the TF30063 authentication problem we had in the beginning.  Hopefully the new code has that fixed properly so that both the login box and the TF30063 are gone forever.  Our testing so far seems to indicate it works.  If anyone gets a real problem here there are two workarounds: 1) Turn off the auto refresh to reduce the issue. If this doesn’t fix it, then 2) please reinstall the former version (go to the codeplex download site if you don’t have it anymore)  Write a comment to this blog post with a description of what happens, and I will send a temporary fix asap. Bug fixes: The folder name matching was case sensitive, so “Application.CI” and “application.CI” created two different folders.  View all builds not shown for leaf odes, and view builds didn’t work in all cases.  There was some inconsistencies here which have been fixed. Partly fixed:  The context menu to queue a new build for disabled builds should be removed, but that was a difficult one, and is still on the list, but the command will not do anything for a disabled build. Using the Queue Default Builds on a folder, and if it had some disabled builds below an error box appeared and ruined the whole experience. As a result of these fixes there has been introduced some new options, as shown below:   The two first settings, the Separator symbol and the options for how to handle Queuing of default builds are set per Team Project, and is stored in the TFS source control under the BuildProcessTemplates folder, with the name Inmeta.VisualStudio.BuildExplorer.Settings.xml The next two settings need some explanations.  They handle the behavior for the auto update of the build folders.  First, these are stored in the local registry per user, at the key HKEY_CURRENT_USER/Software\Inmeta\BuildExplorer. The first option Use Timed Refresh at Startup, if turned off, you will need to click the node as it is done in Version 1.0.  The second option is a timed value, the time after the Build explorer node is created and until the scanning of the Build folders start.  It is assumed that this is enough, and the tests so far indicates this.  If you have very many builds and you see that the explorer don’t get them all, try to increase this value, and of course, notify me of your case, either here or on the Visual Gallery site.

  Read the article

• Long pause when accessing DFS namespace

  - by Matt

  We've recently migrated our Windows network to use DFS for shared files. DFS is working well, except for one annoying problem: users experience a significant delay when they try to access a DFS namespace that they have not accessed for some time. I have tried to troubleshoot the issue but have not had any success so far, and I was hoping someone here may have some pointers to help resolve the problem. Firstly, some background on our network: The network uses a Windows 2008 functional level Active Directory domain with two Windows 2008 DCs and two DNS servers (one on each of the DCs). The network is DNS only - no WINS. All computers are located at the same site and connected by Gigabit Ethernet. We have approximately 20 Domain-based DFS namespaces in Windows 2008 mode, and each DFS namespace has two Windows 2008 DFS namespace servers (the same two servers for all namespaces). All namespace servers are in FQDN mode and all folder targets are specified using their FQDN. All computers are up-to-date with Service Packs and patches. The actual folder targets (i.e. the SMB shares our DFS folders point to) are scattered across several file and application servers, all running Windows 2008 bar two application servers which run Windows 2003 R2, with no replication setup at all (e.g. all DFS folders currently only have one folder target). Some more detail on the problem: The namespace access delay is generally 1 - 10 seconds long and seems to occur when a particular computer has not accessed the requested namespace for approximately five minutes or more. For example, if the user has not accessed \\domain.name\namespace1\ for more than five minutes and attempts to access \\domain.name\namespace1\ via Windows Explorer, the Explorer window will freeze for 1 - 10 seconds before finally resuming and displaying the folders that exist in \\domain.name\namespace1. If they then close the Explorer window and attempt to access \\domain.name\namespace1\ again within five minutes the contents will be displayed almost instantly - if they wait longer than five minutes it will go through the 1 - 10 second pause again. Once "inside" the namespace everything is nice and snappy, it's just the initial connection to the namespace that is slow. The browsing delays seem to affect all variants of Windows that we use (Windows 2008 x64 SP2, Windows 2003 R2 x86 SP2, Windows XP Pro x86 SP3) - it is possibly a bit worse in Windows XP / 2003 than in Windows 2008, but I'm not sure if the difference isn't just psychological. Accessing the underlying folder targets directly exhibits no delay at all - i.e. if the SMB shares pointed to by DFS are accessed directly (bypassing DFS) then there is no pause. During trouble-shooting I noticed that the "Cache duration" for all of our DFS roots is set to 300 seconds - 5 minutes. Given that this is the same amount of time required to trigger the pause I assume that this caching is somehow related, although I am unsure exactly what is cached on the client and hence what needs to be looked up again after 5 minutes have elapsed. In trying to resolve the problem I have already tried / checked the following (without success): Run dcdiag on both Domain Controllers - no problems found Done some basic DNS server checks without finding any problems - I don't know how to check the DNS servers in detail, but I would add that the network is not exhibiting any other strange behavior that may point to a DNS problem Disabled Anti-virus on clients and servers Removing one of the namespace servers from a couple of namespaces - no difference So that's where I'm up to - and I'm out of ideas. Can anyone suggest what may be causing the delays and/or what I should be trying next?

  Read the article

• SQL SERVER – Error: Fix – Msg 208 – Invalid object name ‘dbo.backupset’ – Invalid object name ‘dbo.backupfile’

  - by pinaldave

  Just a day before I got a very interesting email. Here is the email (modified a bit to make it relevant to this blog post). “Pinal, We are facing a very strange issue. One of our query  related to backup files and backup set has stopped working suddenly in SSMS. It works fine in application where we have and in the stored procedure but when we have it in our SSMS it gives following error. Msg 208, Level 16, State 1, Line 1 Invalid object name ‘dbo.backupfile’. Here are our queries which we are trying to execute. SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM dbo.backupset; SELECT logical_name, backup_size, file_type FROM dbo.backupfile; This query gives us details related to backupset and backup files when the backup was taken.” When I receive this kind of email, usually I have no answers directly. The claim that it works in stored procedure and in application but not in SSMS gives me no real data. I have requested him to very first check following two things: If he is connected to correct server? His answer was yes. If he has enough permissions? His answer was he was logged in as an admin. This means there was something more to it and I requested him to send me a screenshot of the his SSMS. He promptly sends that to me and as soon as I receive the screen shot I knew what was going on. Before I say anything take a look at the screenshot yourself and see if you can figure out why his queries are not working in SSMS. Just to make your life a bit easy, I have already given a hint in the image. The answer is very simple, the context of the database is master database. To execute above two queries the context of the database has to be msdb. Tables backupset and backupfile belong to the database msdb only. Here are two workaround or solution to above problem: 1) Change context to MSDB Above two queries when they will run as following they will not error out and will give the accurate desired result. USE msdb GO SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM dbo.backupset; SELECT logical_name, backup_size, file_type FROM dbo.backupfile; 2) Prefix the query with msdb There are cases above script used in stored procedure or part of big query, it is not possible to change the context of the whole query to any specific database. Use three part naming convention and prefix them with msdb. SELECT name, database_name, backup_size, TYPE, compatibility_level, backup_set_id FROM msdb.dbo.backupset; SELECT logical_name, backup_size, file_type FROM msdb.dbo.backupfile; Very simple solution but sometime keeps people wondering for an answer. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Error Messages, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

  Read the article

• Pet Store Loyalty Programs: I'm Not Loyal Yet!

  - by ruth.donohue

  After two years of constantly being asked (aka "pestered) by my now eight-year-old daughter for a dog (or any pet that is more interactive than a goldfish), I've finally compromised with a hamster purely by chance. Friends of ours had recently brought home a female hamster, and (surprise, surprise) two weeks later, they were looking for homes for 11 baby hamster pups. Since the pups were not yet ready to be weaned from their mother, my daughter and I had several weeks to get ready -- and we spent that extra time visiting a number of local pet stores and purchasing an assortment of hamster books, toys, exercise equipment, food, bedding, and cage -- not cheap! Now, I'm usually an online shopper (i.e. I love reading user reviews and comparing prices), but for kids, there is absolutely no online substitute for actually walking into a store and physically picking out something you want. We have two competing pet shops within close proximity to where we live, and I signed up for their rewards programs to get discounts on select items. I'm sure it takes a while to get my data into the system (after all, I did fill out a form the old-fashioned way), but as it has been more than two weeks for one store and over a week for the other, the window of opportunity is getting smaller as we by now pretty much have most of what we think we need. Everything I've purchased has been purely hamster or small animal related, so in an ideal world, the stores would have me easily figured out as a hamster owner. Here is what I would be expecting of a loyalty rewards program: Point me to some useful links, either information provied by the company or external websites where I can learn more. Any value-add a business can provide to make my life easier makes me a much more loyal customer. What things can I expect as a new pet owner? Any hamster communities? Any hamster-related events? Any vets that specialize in small animals in the vicinity? Send me an email with other related products I may be interested in. Upsell and cross-sell to me. We've go the basics and a couple of luxuries, but at this point, I'm pretty excited (surprisingly) about the hamster, and my daughter is footing the bill with her birthday and Christmas money. She and I would be more than happy to spend her money! Get this information to me faster. As I mentioned, my window of opportunity is getting smaller, as eithe rmy daughter's money will run out on other things or we'll start losing the thrill of buying new hamster toys and treats. I realize this is easier said than done, and undoubtedly, the stores are getting value knowing my basic customer information and purchase history. Buth, they could really benefit by delivering a loyalty program that really earned my loyalty. "Goldeen" needs a new water bottle, yogurt chips, and chew toys as he doesn't seem to like the ones we bought. So for now, I'll just go to whichever store is the most convenient. Oh, and just for fun (not related to this post), here are a couple of videos my daughter really got a kick out of watching: Hamster on a Piano Tic in a Spin-Dryer

  Read the article

< Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >