Search Results

Search found 21589 results on 864 pages for 'primary key'.

Page 185/864 | < Previous Page | 181 182 183 184 185 186 187 188 189 190 191 192  | Next Page >

  • PHP Mcrypt - Encrypting / Decrypting file

    - by whitman6732
    Trying to write a couple of functions that will encrypt or decrypt a file and am using the class found here to try and accomplish this: http://www.itnewb.com/v/PHP-Encryption-Decryption-Using-the-MCrypt-Library-libmcrypt The encryption function below seems to work, in that it appears to encrypt the file and place it in the intended directory. I'm trying to decrypt the file now, and it just dies with the message "Failed to complete decryption" (which is coded in there...) There's nothing in the php error logs, so I'm not sure why it's failing, but as mcrypt is entirely new to me, I'm more than inclined to believe I'm doing something wrong here... Here are the functions: //ENCRYPT FILE function encryptFile() { global $cryptastic; $pass = PGPPASS; $salt = PGPSALT; $key = $cryptastic->pbkdf2($pass, $salt, 1000, 32) or die("Failed to generate secret key."); if ($handle = opendir(PATH.'/ftpd')) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != "..") { $newfile = PATH.'/encrypted/'.$file.'.txt'; $msg = file_get_contents(PATH.'/ftpd/'.$file); $encrypted = $cryptastic->encrypt($msg, $key) or die("Failed to complete encryption."); $nfile = fopen($newfile, 'w'); fwrite($nfile, $encrypted); fclose($nfile); unlink(PATH.'/ftpd/'.$file); } } closedir($handle); } //DECRYPT FILE function inFTP() { global $cryptastic; $pass = PGPPASS; $salt = PGPSALT; $key = $cryptastic->pbkdf2($pass, $salt, 1000, 32) or die("Failed to generate secret key."); if ($handle = opendir(PATH.'/encrypted')) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != "..") { $newfile = PATH.'/decrypted/'.$file; $msg = PATH.'/encrypted/'.$file; $decrypted = $cryptastic->decrypt($msg, $key) or die("Failed to complete decryption."); $nfile = fopen($newfile, 'w'); fwrite($nfile, $decrypted); fclose($nfile); //unlink(PATH.'/encrypted/'.$file); } } closedir($handle); } //$crypt->decrypt($file); }

    Read the article

  • HttpURLConnection does not read the whole respnse

    - by Peter Szanto
    I use HttpURLConnection to do HTTP POST but I dont always get back the full response. I wanted to debug the problem, but when I step through each line it worked. I thought it must be a timing issue so I added Thread.sleep and it really made my code work, but this is only a temporary workaround. I wonder why is this happening and how to solve. Here is my code: URL u = new URL(url); URLConnection c = u.openConnection(); InputStream in = null; String mediaType = null; if (c instanceof HttpURLConnection) { //c.setConnectTimeout(1000000); //c.setReadTimeout(1000000); HttpURLConnection h = (HttpURLConnection)c; h.setRequestMethod("POST"); //h.setChunkedStreamingMode(-1); setAccept(h, expectedMimeType); h.setRequestProperty("Content-Type", inputMimeType); for(String key: httpHeaders.keySet()) { h.setRequestProperty(key, httpHeaders.get(key)); if (logger.isDebugEnabled()) { logger.debug("Request property key : " + key + " / value : " + httpHeaders.get(key)); } } h.setDoOutput(true); h.connect(); OutputStream out = h.getOutputStream(); out.write(input.getBytes()); out.close(); mediaType = h.getContentType(); logger.debug(" ------------------ sleep ------------------ START"); try { Thread.sleep(2000); } catch (InterruptedException e) { e.printStackTrace(); } logger.debug(" ------------------ sleep ------------------ END"); if (h.getResponseCode() < 400) { in = h.getInputStream(); } else { in = h.getErrorStream(); } It genearates the following HTTP headers POST /emailauthentication/ HTTP/1.1 Accept: application/xml Content-Type: application/xml Authorization: OAuth oauth_consumer_key="b465472b-d872-42b9-030e-4e74b9b60e39",oauth_nonce="YnDb5eepuLm%2Fbs",oauth_signature="dbN%2FWeWs2G00mk%2BX6uIi3thJxlM%3D", oauth_signature_method="HMAC-SHA1", oauth_timestamp="1276524919", oauth_token="", oauth_version="1.0" User-Agent: Java/1.6.0_20 Host: test:6580 Connection: keep-alive Content-Length: 1107 In other posts it was suggested to turn off keep-alive by using the http.keepAlive=false system property, I tried that and the headers changed to POST /emailauthentication/ HTTP/1.1 Accept: application/xml Content-Type: application/xml Authorization: OAuth oauth_consumer_key="b465472b-d872-42b9-030e-4e74b9b60e39", oauth_nonce="Eaiezrj6X4Ttt0", oauth_signature="ND9fAdZMqbYPR2j%2FXUCZmI90rSI%3D", oauth_signature_method="HMAC-SHA1", oauth_timestamp="1276526608", oauth_token="", oauth_version="1.0" User-Agent: Java/1.6.0_20 Host: test:6580 Connection: close Content-Length: 1107 the Connection header is "close" but I still cannot read the whole response. Any idea what do I do wrong?

    Read the article

  • Entity Framework doesn't like 0..1 to * relationships.

    - by Orion Adrian
    I have a database framework where I have two tables. The first table has a single column that is an identity and primary key. The second table contains two columns. One is a nvarchar primary key and the other is a nullable foreign key to the first table. On the default import of the database I get the following error: Condition cannot be specified for Column member 'ForeignKeyId' because it is marked with a 'Computed' or 'Identity' StoreGeneratedPattern. where ForeignKeyId is the second foreign key reference in the second table. Is this just something the entity model doesn't do? Or am I missing something?

    Read the article

  • mysql composite unique on FK's

    - by m2o
    I want to implement the following constraints in mysql: create table TypeMapping( ... constraint unique(server_id,type_id), constraint foreign key(server_id) references Server(id), constraint foreign key(type_id) references Type(id) ); This throws a 'ERROR 1062 (23000): Duplicate entry '3-4' for key 'server_id'' when I issue an insert/update that would break the constraint. Is this type of constraint even possible? If so how? Thank you.

    Read the article

  • Is there a way to move two squares in OpenGL simultaneously?

    - by thyrgle
    Hi, so I have a function that handles key presses in a game I'm working on in OpenGL. But, the thing is that even though I have made two squares and they both move when the correct key is pressed only one square is moved. Is there a way I can make the two squares move. This is the glutKeyboardFunc function I implimented: void handleKeypress(unsigned char key, int x, int y) { switch (key) { case 27: exit(0); break; case 'w': glutTimerFunc(0.001, moveSquareUp, 0); break; case 'd': glutTimerFunc(0.001, moveSquareRight, 0); break; case 's': glutTimerFunc(0.001, moveSquareDown, 0); break; case 'a': glutTimerFunc(0.001, moveSquareLeft, 0); break; } } If you need any more code just ask.

    Read the article

  • dual map structure implementation?

    - by Danra
    Hey, I'm looking for a standard dual-map structure - is there one implemented in std/boost/another standard C++ library? When I say "dual-map" I mean a map which can be indexed efficiently both by the key and the "value" (it actually has two key types instead of one key type and one value type). for example: dualmap<int,string> m; m[1] = "foo"; m["bar"] = 2 int a = m["bar"]; // a = 2 Thanks, Dan

    Read the article

  • Mysql 100% CPU + Slow query

    - by felipeclopes
    I'm using the RDS database from amazon with a some very big tables, and yesterday I started to face 100% CPU utilisation on the server and a bunch of slow query logs that were not happening before. I tried to check the queries that were running and faced this result from the explain command +----+-------------+-------------------------------+--------+----------------------------------------------------------------------------------------------+---------------------------------------+---------+-----------------------------------------------------------------+------+----------------------------------------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+-------------------------------+--------+----------------------------------------------------------------------------------------------+---------------------------------------+---------+-----------------------------------------------------------------+------+----------------------------------------------+ | 1 | SIMPLE | businesses | const | PRIMARY | PRIMARY | 4 | const | 1 | Using index; Using temporary; Using filesort | | 1 | SIMPLE | activities_businesses | ref | PRIMARY,index_activities_users_on_business_id,index_tweets_users_on_tweet_id_and_business_id | index_activities_users_on_business_id | 9 | const | 2252 | Using index condition; Using where | | 1 | SIMPLE | activities_b_taggings_975e9c4 | ref | taggings_idx | taggings_idx | 782 | const,myapp_production.activities_businesses.id,const | 1 | Using index condition; Using where | | 1 | SIMPLE | activities | eq_ref | PRIMARY,index_activities_on_created_at | PRIMARY | 8 | myapp_production.activities_businesses.activity_id | 1 | Using where | +----+-------------+-------------------------------+--------+----------------------------------------------------------------------------------------------+---------------------------------------+---------+-----------------------------------------------------------------+------+----------------------------------------------+ Also checkin in the process list, I got something like this: +----+-----------------+-------------------------------------+----------------------------+---------+------+--------------+------------------------------------------------------------------------------------------------------+ | Id | User | Host | db | Command | Time | State | Info | +----+-----------------+-------------------------------------+----------------------------+---------+------+--------------+------------------------------------------------------------------------------------------------------+ | 1 | my_app | my_ip:57152 | my_app_production | Sleep | 0 | | NULL | | 2 | my_app | my_ip:57153 | my_app_production | Sleep | 2 | | NULL | | 3 | rdsadmin | localhost:49441 | NULL | Sleep | 9 | | NULL | | 6 | my_app | my_other_ip:47802 | my_app_production | Sleep | 242 | | NULL | | 7 | my_app | my_other_ip:47807 | my_app_production | Query | 231 | Sending data | SELECT my_fields... | | 8 | my_app | my_other_ip:47809 | my_app_production | Query | 231 | Sending data | SELECT my_fields... | | 9 | my_app | my_other_ip:47810 | my_app_production | Query | 231 | Sending data | SELECT my_fields... | | 10 | my_app | my_other_ip:47811 | my_app_production | Query | 231 | Sending data | SELECT my_fields... | | 11 | my_app | my_other_ip:47813 | my_app_production | Query | 231 | Sending data | SELECT my_fields... | ... So based on the numbers, it looks like there is no reason to have a slow query, since the worst execution plan is the one that goes through 2k rows which is not much. Edit 1 Another information that might be useful is the slow query_log SET timestamp=1401457485; SELECT my_query... # User@Host: myapp[myapp] @ ip-10-195-55-233.ec2.internal [IP] Id: 435 # Query_time: 95.830497 Lock_time: 0.000178 Rows_sent: 0 Rows_examined: 1129387 Edit 2 After profiling, I got this result. The result have approximately 250 rows with two columns each. +----------------------+----------+ | state | duration | +----------------------+----------+ | Sending data | 272 | | removing tmp table | 0 | | optimizing | 0 | | Creating sort index | 0 | | init | 0 | | cleaning up | 0 | | executing | 0 | | checking permissions | 0 | | freeing items | 0 | | Creating tmp table | 0 | | query end | 0 | | statistics | 0 | | end | 0 | | System lock | 0 | | Opening tables | 0 | | logging slow query | 0 | | Sorting result | 0 | | starting | 0 | | closing tables | 0 | | preparing | 0 | +----------------------+----------+ Edit 3 Adding query as requested SELECT activities.share_count, activities.created_at FROM `activities_businesses` INNER JOIN `businesses` ON `businesses`.`id` = `activities_businesses`.`business_id` INNER JOIN `activities` ON `activities`.`id` = `activities_businesses`.`activity_id` JOIN taggings activities_b_taggings_975e9c4 ON activities_b_taggings_975e9c4.taggable_id = activities_businesses.id AND activities_b_taggings_975e9c4.taggable_type = 'ActivitiesBusiness' AND activities_b_taggings_975e9c4.tag_id = 104 AND activities_b_taggings_975e9c4.created_at >= '2014-04-30 13:36:44' WHERE ( businesses.id = 1 ) AND ( activities.created_at > '2014-04-30 13:36:44' ) AND ( activities.created_at < '2014-05-30 12:27:03' ) ORDER BY activities.created_at; Edit 4 There may be a chance that the indexes are not being applied due to difference in column type between the taggings and the activities_businesses, on the taggable_id column. mysql> SHOW COLUMNS FROM activities_businesses; +-------------+------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-------------+------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | activity_id | bigint(20) | YES | MUL | NULL | | | business_id | bigint(20) | YES | MUL | NULL | | +-------------+------------+------+-----+---------+----------------+ 3 rows in set (0.01 sec) mysql> SHOW COLUMNS FROM taggings; +---------------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | tag_id | int(11) | YES | MUL | NULL | | | taggable_id | bigint(20) | YES | | NULL | | | taggable_type | varchar(255) | YES | | NULL | | | tagger_id | int(11) | YES | | NULL | | | tagger_type | varchar(255) | YES | | NULL | | | context | varchar(128) | YES | | NULL | | | created_at | datetime | YES | | NULL | | +---------------+--------------+------+-----+---------+----------------+ So it is examining way more rows than it shows in the explain query, probably because some indexes are not being applied. Do you guys can help m with that?

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in SQL Server 2008

    - by bodziec
    I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • Magic Methods in Python

    - by dArignac
    Howdy, I'm kind of new to Python and I wonder if there is a way to create something like the magic methods in PHP (http://www.php.net/manual/en/language.oop5.overloading.php#language.oop5.overloading.methods) My aim is to ease the access of child classes in my model. I basically have a parent class that has n child classes. These classes have three values, a language key, a translation key and a translation value. The are describing a kind of generic translation handling. The parent class can have translations for different translation key each in different languages. E.g. the key "title" can be translated into german and english and the key "description" too (and so far and so on) I don't want to get the child classes and filter by the set values (at least I want but not explicitly, the concrete implementation behind the magic method would do this). I want to call parent_class.title['de'] # or also possible maybe parent_class.title('de') for getting the translation of title in german (de). So there has to be a magic method that takes the name of the called method and their params (as in PHP). As far as I dug into Python this is only possible with simple attributes (_getattr_, _setattr_) or with setting/getting directly within the class (_getitem_, _setitem_) which both do not fit my needs. Maybe there is a solution for this? Please help! Thanks in advance!

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • What's wrong with my code? (pdcurses/getmaxyx)

    - by flarn2006
    It gives me an access violation on the getmaxyx line (second line in the main function) and also gives me these two warnings: LINK : warning LNK4049: locally defined symbol "_stdscr" imported LINK : warning LNK4049: locally defined symbol "_SP" imported Yes, it's the same code as in another question I asked, it's just that I'm making it more clear. And yes, I have written programs with pdcurses before with no problems. #include <time.h> #include <curses.h> #include "Ball.h" #include "Paddle.h" #include "config.h" int main(int argc, char *argv[]) { int maxY, maxX; getmaxyx(stdscr, maxY, maxX); Paddle *paddleLeft = new Paddle(0, KEY_L_UP, KEY_L_DOWN); Paddle *paddleRight = new Paddle(maxX, KEY_R_UP, KEY_R_DOWN); Ball *ball = new Ball(paddleLeft, paddleRight); int key = 0; initscr(); cbreak(); noecho(); curs_set(0); while (key != KEY_QUIT) { key = getch(); paddleLeft->OnKeyPress(key); paddleRight->OnKeyPress(key); } endwin(); return 0; }

    Read the article

  • Tri-Boot Win 7 64+Ubuntu 12.04+BackTrack 5

    - by Volchonoc
    I'd like to know what is the best procedure for doing a Tri-boot? I don't want to re-size windows partition I want to re-install it from scratch. I heard that it's better to install windows first, but will windows allow me to create the right partition structure? And what i the best structure? should I create a primary for windows and extended for everything else? If so what should my logicals be: 1)Ubuntu+2)SWAP(shared)+3)BackTrack root+4)BackTrack home, or should I just make 4 primary 1)win+2)Ubuntu+3)BackTrack+4)SWAP. And what are the formats I should choose for Linux partitions? I would appreciate any info on this topic Thank You

    Read the article

  • What is the difference between development and R&D?

    - by MainMa
    I was asked by a colleague to explain clearly the difference between ordinary development and research and development (R&D) and was unable to do it. After reading Wikipedia, I still don't have the precise answer. According to Wikipedia (slightly modified): There are two primary models: In one model, the primary function is to develop new products; in the other model, the primary function is to discover and create new knowledge about scientific and technological topics for the purpose of uncovering and enabling development of valuable new products, processes, and services. The first model is confusing. Does it mean that development (not R&D) consists exclusively in adding new features to a product, solving bugs and doing maintenance? What if something which was previously developed as a new feature becomes a separate product? The second model is less confusing, but still, how to qualify whether something is new knowledge or existent knowledge which is just rediscovered? Later, Wikipedia adds that ordinary development is different from R&D because of its: nearly immediate profit or immediate improvement. It's still not clear enough. How to qualify "nearly immediate profit"? What if a task has an immediate profit but requires heavy research? Or if it is basic but has uncertain profit, like the enforcement of a common style over the codebase? For example, does it belong to development or R&D to: Develop an engine which abstracts the access to the database, simplifying and shortening enormously the code of other applications (existent or ones which will be written in future) which should access to the database? Establish a new service-oriented architecture for the entire organization of company resources, in order to move from a bunch of separate and autonomous applications to a set of well-organized, interconnected web services, like what is used by Amazon? Design a new communication protocol to allow faster replication of data between two data centers of the company? Conceive a new type of software testing while working on a specific product, knowing that this type of testing will improve/simplify the testing process? Prove that Functional programming is more appropriate than OOP for a specific application, based on evidence, logic and previous experience? Enhance the existent application by adding gestures on tactile screens, after doing studies and testing that shows that those gestures improve the productivity of the users by a ratio of at least 1.4 for a precise set of tasks? Find a way to strongly enhance the Power usage effectiveness (PUE) of a data center? Create a Domain-Specific Language (DSL)? In short, how could I determine whether I'm doing R&D while working on something?

    Read the article

  • Clean way to perform commands in the Emacs minibuffer

    - by Christopher Monsanto
    Consider the following example: I want to read a file using ido from the minibuffer, but merge in all of the directories I use often. I can't just execute (ido-find-file) (ido-merge-work-directories) Because the second sexp will only execute after the user is finished selecting the file. The question then is: what is the best/cleanest way to execute commands in the minibuffer's command loop? The only way I know to do this is to bind my desired command to a key sequence, and add that sequence to unread-command-events so the key runs once we enter the minibuffer command loop: (setq unread-command-events (append (listify-key-sequence (kbd "M-s")) unread-command-events)) ; std key-binding for ido-merge-work-directories (ido-find-file) But that is very hacky, and I would like to know if there is a better solution. Thanks!

    Read the article

  • Generating short license keys with OpenSSL

    - by Marc Charbonneau
    I'm working on a new licensing scheme for my software, based on OpenSSL public / private key encryption. My past approach, based on this article, was to use a large private key size and encrypt an SHA1 hashed string, which I sent to the customer as a license file (the base64 encoded hash is about a paragraph in length). I know someone could still easily crack my application, but it prevented someone from making a key generator, which I think would hurt more in the long run. For various reasons I want to move away from license files and simply email a 16 character base32 string the customer can type into the application. Even using small private keys (which I understand are trivial to crack), it's hard to get the encrypted hash this small. Would there be any benefit to using the same strategy to generated an encrypted hash, but simply using the first 16 characters as a license key? If not, is there a better alternative that will create keys in the format I want?

    Read the article

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • Design for tagging system in GAE-J

    - by tempy
    I need a simple tagging system in GAE-J. As I see it, the entity that is being tagged should have a collection of keys referring to the tags with which it's associated. A tag entity should simply contain the tag string itself, and a collection of keys pointing to the entities associated with the tag. When an entity's list of tags is altered, the system will create a new tag if the tag is unknown, and then append the entity's key to that tag's key collection. If the tag already exists, then the entity's key is simply appended to the tag's key collection. This seems relatively straight-forward and uncontroversial to me, but I would like some feedback on this design, just to be sure.

    Read the article

  • MSI Installer start auto-repair when service starts

    - by Josh Clark
    I have a WiX based MSI that installs a service and some shortcuts (and lots of other files that don't). The shortcut is created as described in the WiX docs with a registry key under HKCU as the key file. This is an all users install, but to get past ICE38, this registry key has to be under the current user. When the service starts (it runs under the SYSTEM account) it notices that that registry key isn't valid (at least of that user) and runs the install again to "repair". In the Event Log I get MsiInstaller Events 1001 and 1004 showing that "The resource 'HKEY_CURRENT_USER\SOFTWARE\MyInstaller\Foo' does not exist." This isn't surprising since the SYSTEM user wouldn't have this key. I turned on system wide MSI logging and the auto-repair created its log file in the C:\Windows\Temp folder rather than a specific user's TEMP folder which seems to imply the current user was SYSTEM (plus the log file shows the "Calling process" to be my service). Is there something I can do to disable the auto-repair functionality? Am I doing something wrong or breaking some MSI rule? Any hints on where to look next?

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • A scheme for expiring downloaded content?

    - by Chad Johnson
    I am going to offer a web API service that allows users to download and "rent" content for a monthly subscription fee. The API will either be open to everyone or possibly just select parties (not sure yet). Each developer must agree to a license, and they receive a developer key for their person. Each software application will have its own key as well. So then end-users will download the software which will interact with my service's API. Each user will have a key for each application as well (probably using OAuth). Content will be cached on first download and accessible offline via just the third-party application that cached the content. If a user cancels their subscription, I plan on doing the following: Deactivate the user's OAuth key for all applications. Do not allow the user's account to download new content via the API (and subsequently any software that uses the API). Now, the big question is: how do I make content expire if they cancel their subscription? If they cancel, they should not have access to content anymore. Here are ideas I've thought of (some of these are half-solutions, not yet fully fleshed out): Require that applications encrypt downloaded content using the user's OAuth key, making it available to only the application. This will prevent most users from going to the cache directory and just copying and keeping files. Update the user's key once a month, forcing content to re-cache on a monthly basic. Users could then access content for a month after they cancel their subscription. Require applications to "phone home" [to the service] periodically and check whether the user's subscription has terminated. If so, require in the API developer license that applications expire cache. If it is found that applications do not comply, their keys (and possibly keys for all developers) are permanently deactivated as a consequence. One major worry is that some applications may blatantly ignore constraints of the license. Is it generally acceptable to rely on applications abiding by the licensing constraints? Bad idea? Any other ideas? Maybe a way to make content auto-expire after x days? Something else? I'm open to out-of-the-box ideas.

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in MSSQL2008

    - by bodziec
    Hi, I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

< Previous Page | 181 182 183 184 185 186 187 188 189 190 191 192  | Next Page >