Search Results

Search found 6298 results on 252 pages for 'veili 13'.

Page 189/252 | < Previous Page | 185 186 187 188 189 190 191 192 193 194 195 196  | Next Page >

  • How to handle custom Java exception in Flex app.

    - by mico
    Hello, we are using BlazeDS as a proxy between Flex and Java. The approach is the same as in (http://www.flexpasta.com/index.php/2008/05/16/exception-handling-with-blazeds-and-flex/) Java exception declaration: public class FlexException extends RuntimeException { private String name = 'John'; public FlexException(String message) { super(message); } public String getName() { return name; } } Then, we are throwing it: public void testMethod(String str) throws Exception { throw new FlexException("Custom exception"); } Flex part: private function faultHandler(event:FaultEvent):void { var errorMessage:ErrorMessage = event.message as ErrorMessage; trace("error++"); } and remote object is instantiated here: <mx:RemoteObject id="mySample" destination="mySample" channelSet="{cs1}" fault="faultHandler(event)" /> But in event.fault I get "Server.Processing" and event.faultString equals "There was an unhandled failure on the server. Custom exception" How can I receive the data is specified in exception props ? BlazeDS log is similar to the log that was mentioned in the comment [BlazeDS] 11:28:13.906 [DEBUG] Serializing AMF/HTTP response Version: 3 (Message #0 targetURI=/2/onStatus, responseUR|-) (Typed Object #0 ‘flex.messaging.messages.ErrorMessage’) headers = (Object #1) rootCause = null body = null correlationId = “2F1126D7-5658-BE40-E27C-7B43F3C5DCDD” faultDetail = null faultString = “Login required before authorization can proceed.” clientId = “C4F0E77C-3208-ECDD-1497-B8D070884830? timeToLive = 0.0 destination = “books” timestamp = 1.204658893906E12 extendedData = null faultCode = “Client.Authentication” messageId = “C4F0E77C-321E-6FCE-E17D-D9F1C16600A8? So the quesion is why rootClause is null? How can I get that Exception object not just a string 'Custom exception'?

    Read the article

  • FLEX: how to dynamically add LineSeries to CartesianChart

    - by Patrick
    hi, the LineSeries is not dynamically added to my CartesianChart... What's wrong in this code: ... private function chartComplete():void { var ls:LineSeries = new LineSeries(); ls.styleName = 'timeline'; ls.dataProvider = "{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}"; ls.yField = 'popularity'; //ls.s = "{new Stroke(0xCC33CC, 2)}"; AllChart.series[0] = ls; } ... <mx:CartesianChart id="AllChart" width="100%" height="100" creationComplete="chartComplete();"> <mx:horizontalAxis><mx:CategoryAxis id="horiz1" dataProvider="['1','2','3','4','5','6','7','8','9','10','11','23','13','14','15','16','17','18','19','20','21','22','23','24','25','26','27','28','29','30','31']"/></mx:horizontalAxis> <mx:horizontalAxisRenderers><mx:AxisRenderer axis="{horiz1}"/></mx:horizontalAxisRenderers> <mx:verticalAxis><mx:LinearAxis id="vert1" /></mx:verticalAxis> <mx:verticalAxisRenderers><mx:AxisRenderer axis="{vert1}"/></mx:verticalAxisRenderers> <mx:series> <mx:AreaSeries id="timeArea" styleName="timeArea" name="A" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(2).yearPopularity}" areaStroke="{new Stroke(0x0033CC, 2)}" areaFill="{new SolidColor(0x0033CC, 0.5)}" /> </mx:series> </mx:CartesianChart> I can only see the TimeLine if I added it with MXML: <mx:LineSeries styleName="timeLine" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}" yField="popularity" stroke="{new Stroke(0xCC33CC, 2)}" /> But I need to update the view, and add N lines so I cannot do it with MXML. thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • ABAddressBookGetPersonCount(ab) problem

    - by prathumca
    Why the call to ABAddressBookGetPersonCount(ab); is giving the problem? I have around 2000 contacts in my address book. When my app gets started I'm trying to read the entire address book. This works perfectly on simulator but causing crash on IPhone. The crash report is pointing to 9 AppSupport 0x31fbca1e 0x31fb6000 + 27166 // CPRecordStoreGetCountOfInstancesOfClassWhere + 0x7e 10 AddressBook 0x318df668 0x318d5000 + 42600 // ABCGetPersonCountInStore + 0x88 11 AddressBook 0x318ea450 0x318d5000 + 87120 // ABAddressBookGetPersonCount + 0x8 12 MyAddressBook 0x0000ad30 0x1000 + 40240 // -[MyAddressBookController readAB] + 0x2c0 13 MyAddressBook 0x0000a8ce 0x1000 + 39118 // -[MyAddressBookController start] + 0x4a What I'm doing in "readAB"? - (void) readAB { ABAddressBookRef ab = ABAddressBookCreate(); CFArrayRef contacts = ABAddressBookCopyArrayOfAllPeople(ab); CFIndex count = ABAddressBookGetPersonCount(ab); for(int i = 0; i < count; i++) { //doing some thing... } } If you observe the above crash report, it is clearly pointing to CFIndex count = ABAddressBookGetPersonCount(ab);. Whats wrong with this code? I'm sure that this code works perfectly on firmware 3.1.2. But now I upgraded firmware to 3.1.3. Is this upgrade is causing any trouble? Regards, prathumca.

    Read the article

  • Instruments (Leaks) and NSDateFormatter

    - by Cal
    When I run my iPhone app with Instruments Leaks and parse a bunch of NSDates using NSDateFormatter my memory goes up about 1mb and stays even though these NSDates should be dealloc'd after the parsing (I just discard them if they aren't new). I thought the malloc (in my heaviest stack trace below) could become part of the NSDate but I also thought it could be memory that only used during some intermediate step in parsing. Does anyone know which one it is or how to find out? Also, is there a way to put a breakpoint on NSDate dealloc to see if that memory is really being reclaimed? Here's what my date formatter looks like for parsing these dates: df = [[NSDateFormatter alloc] init]; [df setDateFormat:@"EEE, d MMM yyyy H:m:s z"]; Here's the Heaviest Stack trace when the memory bumps up and stays there: 0 libSystem.B.dylib 208.80 Kb malloc 1 libicucore.A.dylib 868.19 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 2 libicucore.A.dylib 868.66 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 3 libicucore.A.dylib 868.67 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 4 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::initZoneStringFormat() 5 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::getZoneStringFormat() const 6 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::subParse(icu::UnicodeString const&, int&, unsigned short, int, signed char, signed char, signed char*, icu::Calendar&) const 7 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::parse(icu::UnicodeString const&, icu::Calendar&, icu::ParsePosition&) const 8 libicucore.A.dylib 868.67 Kb icu::DateFormat::parse(icu::UnicodeString const&, icu::ParsePosition&) const 9 libicucore.A.dylib 868.67 Kb udat_parse 10 CoreFoundation 868.67 Kb CFDateFormatterGetAbsoluteTimeFromString 11 CoreFoundation 868.67 Kb CFDateFormatterCreateDateFromString 12 Foundation 868.67 Kb -[NSDateFormatter getObjectValue:forString:range:error:] 13 Foundation 868.75 Kb -[NSDateFormatter getObjectValue:forString:errorDescription:] 14 Foundation 868.75 Kb -[NSDateFormatter dateFromString:] Thanks!

    Read the article

  • GCC emits extra code for boost::shared_ptr dereference

    - by Checkers
    I have the following code: #include <boost/shared_ptr.hpp> struct Foo { int a; }; static int A; void func_shared(const boost::shared_ptr<Foo> &foo) { A = foo->a; } void func_raw(Foo * const foo) { A = foo->a; } I thought the compiler would create identical code, but for shared_ptr version an extra seemingly redundant instruction is emitted. Disassembly of section .text: 00000000 <func_raw(Foo*)>: 0: 55 push ebp 1: 89 e5 mov ebp,esp 3: 8b 45 08 mov eax,DWORD PTR [ebp+8] 6: 5d pop ebp 7: 8b 00 mov eax,DWORD PTR [eax] 9: a3 00 00 00 00 mov ds:0x0,eax e: c3 ret f: 90 nop 00000010 <func_shared(boost::shared_ptr<Foo> const&)>: 10: 55 push ebp 11: 89 e5 mov ebp,esp 13: 8b 45 08 mov eax,DWORD PTR [ebp+8] 16: 5d pop ebp 17: 8b 00 mov eax,DWORD PTR [eax] 19: 8b 00 mov eax,DWORD PTR [eax] 1b: a3 00 00 00 00 mov ds:0x0,eax 20: c3 ret I'm just curious, is this necessary, or it is just an optimizer's shortcoming? Compiling with g++ 4.1.2, -O3 -NDEBUG.

    Read the article

  • check status application pool iis7 with csharp (access-denied)

    - by jack
    I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

    Read the article

  • iPhone app crashes on start-up, in stack-trace only messages from built-in frameworks

    - by Aleksejs
    My app some times crashes at start-up. In stack-trace only messages from built-in frameworks. An excerpt from a crash log: OS Version: iPhone OS 3.1.3 (7E18) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGBUS) Exception Codes: KERN_PROTECTION_FAILURE at 0x000e6000 Crashed Thread: 0 Thread 0 Crashed: 0 CoreGraphics 0x339305d8 argb32_image_mark_RGB32 + 704 1 CoreGraphics 0x338dbcd4 argb32_image + 1640 2 libRIP.A.dylib 0x320d99f0 ripl_Mark 3 libRIP.A.dylib 0x320db3ac ripl_BltImage 4 libRIP.A.dylib 0x320cc2a0 ripc_RenderImage 5 libRIP.A.dylib 0x320d5238 ripc_DrawImage 6 CoreGraphics 0x338d7da4 CGContextDelegateDrawImage + 80 7 CoreGraphics 0x338d7d14 CGContextDrawImage + 364 8 UIKit 0x324ee68c compositeCGImageRefInRect 9 UIKit 0x324ee564 -[UIImage(UIImageDeprecated) compositeToRect:fromRect:operation:fraction:] 10 UIKit 0x32556f44 -[UINavigationBar drawBackButtonBackgroundInRect:withStyle:pressed:] 11 UIKit 0x32556b00 -[UINavigationItemButtonView drawRect:] 12 UIKit 0x324ecbc4 -[UIView(CALayerDelegate) drawLayer:inContext:] 13 QuartzCore 0x311cacfc -[CALayer drawInContext:] 14 QuartzCore 0x311cab00 backing_callback 15 QuartzCore 0x311ca388 CABackingStoreUpdate 16 QuartzCore 0x311c978c -[CALayer _display] 17 QuartzCore 0x311c941c -[CALayer display] 18 QuartzCore 0x311c9368 CALayerDisplayIfNeeded 19 QuartzCore 0x311c8848 CA::Context::commit_transaction(CA::Transaction*) 20 QuartzCore 0x311c846c CA::Transaction::commit() 21 QuartzCore 0x311c8318 +[CATransaction flush] 22 UIKit 0x324f5e94 -[UIApplication _reportAppLaunchFinished] 23 UIKit 0x324a7a80 -[UIApplication _runWithURL:sourceBundleID:] 24 UIKit 0x324f8df8 -[UIApplication handleEvent:withNewEvent:] 25 UIKit 0x324f8634 -[UIApplication sendEvent:] 26 UIKit 0x324f808c _UIApplicationHandleEvent 27 GraphicsServices 0x335067dc PurpleEventCallback 28 CoreFoundation 0x323f5524 CFRunLoopRunSpecific 29 CoreFoundation 0x323f4c18 CFRunLoopRunInMode 30 UIKit 0x324a6c00 -[UIApplication _run] 31 UIKit 0x324a5228 UIApplicationMain 32 Journaler 0x000029ac main (main.m:14) 33 Journaler 0x00002948 start + 44 File main.m is simple as possible: #import <UIKit/UIKit.h> int main(int argc, char *argv[]) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; int retVal = UIApplicationMain(argc, argv, nil, nil); // line 14 [pool release]; return retVal; } What my cause the app to crash?

    Read the article

  • SharpPcap issue

    - by Eyla
    This is my first time to use SharpPcap library. I created new project with VC# 2008 and I added SharpPcap as a reference to my project. I post a sample code to get interface of my pc but I'm getting this error: Error 1 The type or namespace name 'PcapDeviceList' could not be found (are you missing a using directive or an assembly reference?) C:\Users\Ali\Documents\Visual Studio 2008\Projects\Pcap\Pcap\Form1.cs 28 13 Pcap please advice to solve this problem. here is my code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; using SharpPcap; using SharpPcap.Packets; using SharpPcap.Protocols; using SharpPcap.Util; namespace Pcap { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { /* Retrieve the device list */ PcapDeviceList devices = SharpPcap.GetAllDevices(); /*If no device exists, print error */ if (devices.Count < 1) { Console.WriteLine("No device found on this machine"); return; } int i = 0; /* Scan the list printing every entry */ foreach (PcapDevice dev in devices) { /* Description */ label1.Text = "{0}) {1}" + i + dev.PcapDescription +"\n"+ /* Name */ "\tName:\t{0}" + dev.PcapName+"\n"+ /* IP Address */ "\tIP Address: \t\t{0}"+ dev.PcapIpAddress+"\n"+ /* Is Loopback */ "\tLoopback: \t\t{0}"+ dev.PcapLoopback; i++; } } } }

    Read the article

  • Java errors on Lotus Domino Designer Client 8.5.1

    - by ajcooper
    I have a clean install of Lotus Notes 8.5.1 (now with FP3) and I'm getting the following errors in Designer. This is with a new database with a couple of forms and views. I'm finding this is typical across all databases. Is there something I need to install/configure etc.? I'm not new to Notes, but I'm new to 8.5 Thanks Aidan Description Resource Path Location Type Cannot resolve plug-in: org.eclipse.core.runtime plugin.xml TestAgent.nsf line 9 Plug-in Problem Cannot resolve plug-in: org.eclipse.ui plugin.xml TestAgent.nsf line 8 Plug-in Problem Cannot resolve plug-in: com.ibm.commons plugin.xml TestAgent.nsf line 10 Plug-in Problem Cannot resolve plug-in: com.ibm.commons.vfs plugin.xml TestAgent.nsf line 12 Plug-in Problem Cannot resolve plug-in: com.ibm.commons.xml plugin.xml TestAgent.nsf line 11 Plug-in Problem Cannot resolve plug-in: com.ibm.designer.runtime plugin.xml TestAgent.nsf line 15 Plug-in Problem Cannot resolve plug-in: com.ibm.designer.runtime.directory plugin.xml TestAgent.nsf line 14 Plug-in Problem Cannot resolve plug-in: com.ibm.jscript plugin.xml TestAgent.nsf line 13 Plug-in Problem Cannot resolve plug-in: com.ibm.notes.java.api plugin.xml TestAgent.nsf line 20 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.core plugin.xml TestAgent.nsf line 16 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.core plugin.xml TestAgent.nsf line 21 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.designer plugin.xml TestAgent.nsf line 18 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.designer plugin.xml TestAgent.nsf line 22 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.domino plugin.xml TestAgent.nsf line 19 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.domino plugin.xml TestAgent.nsf line 23 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.extsn plugin.xml TestAgent.nsf line 17 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.extsn plugin.xml TestAgent.nsf line 24 Plug-in Problem Cannot resolve plug-in: com.ibm.xsp.rcp plugin.xml TestAgent.nsf line 25 Plug-in Problem

    Read the article

  • Jquery button.click bug?

    - by Chris
    I have the following home-grown jquery plugin: (function($) { $.fn.defaultButton = function(button) { var field = $(this); var target = $(button); if (field.attr('type').toLowerCase() != 'text') return; field.keydown(function (e) { if ((e.which || e.keyCode) == 13) { console.log('enter'); target.click(); return false; } }); } })(jQuery); I'm using it like so: $('#SignUpForm input').defaultButton('#SignUpButton'); $('#SignUpButton').click(function(e) { console.log('click'); $.ajax({ type: 'post', url: '<%=ResolveUrl("~/WebServices/ForumService.asmx/SignUp")%>', contentType: 'application/json; charset=utf-8', dataType: 'json', data: JSON.stringify({ email: $('#SignUpEmail').val(), password: $('#SignUpPassword').val() }), success: function(msg) { $.modal.close(); } }); }); The first time, it works. The second time, nothing happens. I see enter and click the first time in the firebug log, but the second time I only see the enter message. It's almost like the button's click handler is being unregistered somehow. Any thoughts?

    Read the article

  • crash when linking swc with Alchemy

    - by paleozogt
    I have a project I'm trying to compile with alchemy. It will compile .o and .a files, but when trying to create a .swc, it will fail. It appears to crash with this error: g++ -swc -o mylib.swc my-flex-interface.cpp mylib.a Cannot yet select: 0x279c810: ch,flag = AVM2ISD::CALL - A call instruction 0x279c7a0, 0x29c4350 0 llc 0x00636dfe _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 6078 1 llc 0x006373a2 _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 7522 2 libSystem.B.dylib 0x9530942b _sigtramp + 43 3 ??? 0xffffffff 0x0 + 4294967295 4 libSystem.B.dylib 0x953968e5 raise + 26 5 libSystem.B.dylib 0x953ac99c abort + 93 6 llc 0x002f4fe0 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel6Emit_7ERKN4llvm9SDOperandEj + 0 7 llc 0x002f8e1b _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectCodeEN4llvm9SDOperandE + 2219 8 llc 0x002fa193 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectRootEN4llvm9SDOperandE + 819 9 llc 0x002e6a2c _ZN4llvm19X86_64TargetMachineD0Ev + 65116 10 llc 0x003de4ca _ZN4llvm11StoreSDNodeD1Ev + 1610 11 llc 0x0040d3fe _ZN4llvm11StoreSDNodeD1Ev + 193918 12 llc 0x0040f92e _ZN4llvm11StoreSDNodeD1Ev + 203438 13 llc 0x005d1926 _ZN4llvm12FunctionPassD1Ev + 20998 14 llc 0x005d1f3a _ZN4llvm12FunctionPassD1Ev + 22554 15 llc 0x005d20c5 _ZN4llvm12FunctionPassD1Ev + 22949 16 llc 0x00002e44 0x0 + 11844 17 llc 0x00001f36 0x0 + 7990 18 ??? 0x00000006 0x0 + 6 make[2]: *** [src/app/alchemy/sonic.swc] Error 6 make[1]: *** [src/app/alchemy/CMakeFiles/alchemy.dir/all] Error 2 make: *** [all] Error 2 I'm not familiar enough with LLVM (which Alchemy uses under the hood) to figure out what this error means. Any ideas?

    Read the article

  • How can I handle these different HTML chunks in Perl?

    - by kkchaitu
    I need to write a single regular expression with the three possible cases. case1 <td width="100%" align="left" bgcolor="#001E5A"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[Punjabi Music]</font></b> <a id="listlinks" target="_scurl" href="http://www.apnaradio.com/">Apna Radio Broadcast Live 24x7: Indian - Pakistani - Punjabi - Bhangra and Hindi Music !!</a> </font></td> <td nowrap align="center" width="10" bgcolor="#001E5A">&nbsp;</td> case2 <td width="100%" align="left" bgcolor="#001E32"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[jazz]</font></b> <a id="listlinks" target="_scurl" href="http://www.dinnerjazzexcursion.com">Dinner Jazz Excursion</a> <br> <font size="1"><a id="chatstuff" href="aim:goim?screenname=NA">[ AIM ]</a>&nbsp;<font color="#FF0000">Now Playing:</font> Ken Peplowski - Indian Summer</font></font></td> <td nowrap align="center" width="10" bgcolor="#001E32">&nbsp;</td> case 3 <td width="100%" align="left" bgcolor="#001E5A"><font face="Arial" size="2" color="#FFFFFF"><font size="1"><b>[World Bollywood Hindi]</font></b> <a id="listlinks" target="_scurl" href="http://www.bollywoodmusicradio.com/">Bollywood Music Radio :: Indian Music :: Request your Hindi Songs</a> <br> <font size="1"><font color="#FF0000">Now Playing:</font> Bollywood Music Radio - Fear (2007) - Tu Hai Ishq @ 13:46</font></font></td> <td nowrap align="center" width="10" bgcolor="#001E5A">&nbsp;</td>

    Read the article

  • How to implement a web app with blazeds+java+flex+tomcat?

    - by ARYAD
    Hi, i'm doing a web app in flex blazeds and java, i installed the eclipse plugs for using WTP mixed project, i use the flex's server that uses an emulate of tomcat when i ran my flex service the web app got the datas, everythings is ok. the problem is when i copy the proyect with all files generated by flex in my tomcat or the blazeds's tomcat, it doesn't work, this is becasue i want to implement my app on a server the error is: "(mx.messaging.messages::ErrorMessage)#0 body = (Object)#1 clientId = (null) correlationId = "B425A2A7-7D12-A982-7779-8CCBF669413C" destination = "" extendedData = (null) faultCode = "Client.Error.MessageSend" faultDetail = "Channel.Connect.Failed error NetConnection.Call.Failed: HTTP: Failed: url: 'http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf'" faultString = "Send failed" headers = (Object)#2 messageId = "1CBC6020-0ED8-C4CC-3B77-8CCBF6D6621D" rootCause = (mx.messaging.events::ChannelFaultEvent)#3 bubbles = false cancelable = false channel = (mx.messaging.channels::AMFChannel)#4 authenticated = false channelSets = (Array)#5 [0] (mx.messaging::ChannelSet)#6 authenticated = false channelIds = (Array)#7 [0] "my-amf" channels = (Array)#8 [0] (mx.messaging.channels::AMFChannel)#4 clustered = false connected = false currentChannel = (mx.messaging.channels::AMFChannel)#4 initialDestinationId = (null) messageAgents = (Array)#9 [0] (mx.rpc::AsyncRequest)#10 authenticated = false autoConnect = true channelSet = (mx.messaging::ChannelSet)#6 clientId = (null) connected = false defaultHeaders = (null) destination = "ADEscenario" id = "7D92EDF2-CF62-9545-BA11-8CCBF6691E6B" reconnectAttempts = 0 reconnectInterval = 0 requestTimeout = -1 subtopic = "" connected = false connectTimeout = -1 enableSmallMessages = true endpoint = "http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf" failoverURIs = (Array)#11 id = "my-amf" mpiEnabled = false netConnection = (flash.net::NetConnection)#12 client = (mx.messaging.channels::AMFChannel)#4 connected = false objectEncoding = 3 proxyType = "none" uri = "http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf" piggybackingEnabled = false polling = false pollingEnabled = true pollingInterval = 3000 protocol = "http" reconnecting = false recordMessageSizes = false recordMessageTimes = false requestTimeout = -1 uri = "http://{server.name}:{server.port}/IEC-BLAZEDS/messagebroker/amf" url = "http://{server.name}:{server.port}/IEC-BLAZEDS/messagebroker/amf" useSmallMessages = false channelId = "my-amf" connected = false currentTarget = (mx.messaging.channels::AMFChannel)#4 eventPhase = 2 faultCode = "Channel.Connect.Failed" faultDetail = "NetConnection.Call.Failed: HTTP: Failed: url: 'http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf'" faultString = "error" reconnecting = false rejected = false rootCause = (Object)#13 code = "NetConnection.Call.Failed" description = "HTTP: Failed" details = "http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf" level = "error" target = (mx.messaging.channels::AMFChannel)#4 type = "channelFault" timestamp = 0 timeToLive = 0" i don't know why tomcat doesn't find the class of flex.messaging.endpoints.AMFEndpoint that is used for my-amf 'http://172.16.8.245:8400/IEC-BLAZEDS/messagebroker/amf'. all works well in the emulated server that flex has.

    Read the article

  • Academic question: typename

    - by Arman
    Hi, recently I accounted with a "simple problem" of porting code from VC++ to gcc/intel. The code is compiles w/o error on VC++: #include <vector> using std::vector; template <class T> void test_vec( std::vector<T> &vec) { typedef std::vector<T> M; /*==> add here typename*/ M::iterator ib=vec.begin(),ie=vec.end(); }; int main() { vector<double> x(100, 10); test_vec<double>(x); return 0; } then with g++ we have some unclear errors: g++ t.cpp t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&)': t.cpp:13: error: expected `;' before 'ie' t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&) [with T = double]': t.cpp:18: instantiated from here t.cpp:12: error: dependent-name 'std::M::iterator' is parsed as a non-type, but instantiation yields a type t.cpp:12: note: say 'typename std::M::iterator' if a type is meant If we add typename before iterator the code will compile w/o pb. If it is possible to make a compiler which can understand the code written in the more "natural way", then for me is unclear why we should add typename? Which rules of "C++ standards"(if there are some) will be broken if we allow all compilers to use without "typename"? kind regards Arman.

    Read the article

  • Bibliography behaves strange in lyx.

    - by Orjanp
    Hi! I have created a Bibliography section in my document written in lyx. It uses a book layout. For some reason it did start over again when I added some more entries. The new entries was made some time later than the first ones. I just went down to key-27 and hit enter. Then it started on key-1 again. Does anyone know why it behaves like this? The lyx code is below. \begin{thebibliography}{34} \bibitem{key-6}Lego mindstorms, http://mindstorms.lego.com/en-us/default.aspx \bibitem{key-7}C.A.R. Hoare. Communicating sequential processes. Communications of the ACM, 21(8):666-677, pages 666\textendash{}677, August 1978. \bibitem{key-8}C.A.R. Hoare. Communicating sequential processes. Prentice-Hall, 1985. \bibitem{key-9}CSPBuilder, http://code.google.com/p/cspbuilder/ \bibitem{key-10}Rune Møllegård Friborg and Brian Vinter. CSPBuilder - CSP baset Scientific Workflow Modelling, 2008. \bibitem{key-11}Labview, http://www.ni.com/labview \bibitem{key-12}Robolab, http://www.lego.com/eng/education/mindstorms/home.asp?pagename=robolab \bibitem{key-13}http://code.google.com/p/pycsp/ \bibitem{key-14}Paparazzi, http://paparazzi.enac.fr \bibitem{key-15}Debian, http://www.debian.org \bibitem{key-16}Ubuntu, http://www.ubuntu.com \bibitem{key-17}GNU, http://www.gnu.org \bibitem{key-18}IVY, http://www2.tls.cena.fr/products/ivy/ \bibitem{key-19}Tkinter, http://wiki.python.org/moin/TkInter \bibitem{key-20}pyGKT, http://www.pygtk.org/ \bibitem{key-21}pyQT4, http://wiki.python.org/moin/PyQt4 \bibitem{key-22}wxWidgets, http://www.wxwidgets.org/ \bibitem{key-23}wxPython GUI toolkit, http://www.wxPython.org \bibitem{key-24}Python programming language, http://www.python.org \bibitem{key-25}wxGlade, http://wxglade.sourceforge.net/ \bibitem{key-26}http://numpy.scipy.org/ \bibitem{key-27}http://www.w3.org/XML/ \bibitem{key-1}IVY software bus, http://www2.tls.cena.fr/products/ivy/ \bibitem{key-2}sdas \bibitem{key-3}sad \bibitem{key-4}sad \bibitem{key-5}fsa \bibitem{key-6}sad \bibitem{key-7} \end{thebibliography}

    Read the article

  • Reading HTML table data / html tag

    - by user348038
    I have some 50 pages of html which have around 100-plus rows of data in each, with all sort of CSS style, I want to read the html file and just get the data, like Name, Age, Class, Teacher. and store it in Database, but I am not able to read the html tags e.g space i kept to display it here <table class="table_100"> <tr> <td class="col_1"> <span class="txt_student">Gauri Singh</span><br> <span class="txt_bold">13</span><br> <span class="txt_bold">VIII</span><br> </td> <td class="col_2"> <span class="txt_teacher">Praveen M</span><br> <span class="txt_bold">3494</span><br> <span class="txt_bold">3Star</span><br> </td> <td class="col_3"> </td> </tr> </table>

    Read the article

  • understanding valgrind output

    - by sbsp
    Hi, i made a post earlier asking about checking for memory leaks etc, i did say i wasnt to familiar with the terminal in linux but someone said to me it was easy with valgrind i have managed to get it running etc but not to sure what the output means. Glancing over, all looks good to me but would like to run it past you experience folk for confirmation if possible. THe output is as follows ^C==2420== ==2420== HEAP SUMMARY: ==2420== in use at exit: 2,240 bytes in 81 blocks ==2420== total heap usage: 82 allocs, 1 frees, 2,592 bytes allocated ==2420== ==2420== LEAK SUMMARY: ==2420== definitely lost: 0 bytes in 0 blocks ==2420== indirectly lost: 0 bytes in 0 blocks ==2420== possibly lost: 0 bytes in 0 blocks ==2420== still reachable: 2,240 bytes in 81 blocks ==2420== suppressed: 0 bytes in 0 blocks ==2420== Reachable blocks (those to which a pointer was found) are not shown. ==2420== To see them, rerun with: --leak-check=full --show-reachable=yes ==2420== ==2420== For counts of detected and suppressed errors, rerun with: -v ==2420== ERROR SUMMARY: 0 errors from 0 contexts (suppressed: 13 from 8) Is all good here? the only thing concerning me is the still reachable part. Is that ok? Thanks everyone

    Read the article

  • Are Large iPhone Ping Times Indicative of Application Latency?

    - by yar
    I am contemplating creating a realtime app where an iPod Touch/iPhone/iPad talks to a server-side component (which produces MIDI, and sends it onward within the host). When I ping my iPod Touch on Wifi I get huge latency (and a enormous variance, too): 64 bytes from 192.168.1.3: icmp_seq=9 ttl=64 time=38.616 ms 64 bytes from 192.168.1.3: icmp_seq=10 ttl=64 time=61.795 ms 64 bytes from 192.168.1.3: icmp_seq=11 ttl=64 time=85.162 ms 64 bytes from 192.168.1.3: icmp_seq=12 ttl=64 time=109.956 ms 64 bytes from 192.168.1.3: icmp_seq=13 ttl=64 time=31.452 ms 64 bytes from 192.168.1.3: icmp_seq=14 ttl=64 time=55.187 ms 64 bytes from 192.168.1.3: icmp_seq=15 ttl=64 time=78.531 ms 64 bytes from 192.168.1.3: icmp_seq=16 ttl=64 time=102.342 ms 64 bytes from 192.168.1.3: icmp_seq=17 ttl=64 time=25.249 ms Even if this is double what the iPhone-Host or Host-iPhone time would be, 15ms+ is too long for the app I'm considering. Is there any faster way around this (e.g., USB cable)? If not, would building the app on Android offer any other options? Traceroute reports more workable times: traceroute to 192.168.1.3 (192.168.1.3), 64 hops max, 52 byte packets 1 192.168.1.3 (192.168.1.3) 4.662 ms 3.182 ms 3.034 ms can anyone decipher this difference between ping and traceroute for me, and what they might mean for an application that needs to talk to (and from) a host?

    Read the article

  • How to migrate project from RCS to git? (SOLVED)

    - by Norman Ramsey
    I have a 20-year-old project that I would like to migrate from RCS to git, without losing the history. All web pages suggest that the One True Path is through CVS. But after an hour of Googling and trying different scripts, I have yet to find anything that successfully converts my RCS project tree to CVS. I'm hoping the good people at Stackoverflow will know what actually works, as opposed to what is claimed to work and doesn't. (I searched Stackoverflow using both the native SO search and a Google search, but if there's a helpful answer in the database, I missed it.) UPDATE: The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export was repaired on 14 April 2009, and this version seems to work for me. This tool converts straight to git with no intermediate CVS. Thanks Giuseppe and Jakub!!! Things that did not work that I still remember: The rcs-to-cvs script that ships in the contrib directory of the CVS sources The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export in versions before 13 April 2010 The rcs2cvs script found in a document called "CVS-RCS- HOW-TO Document for Linux"

    Read the article

  • Compute the Length of Largest substring that starts and ends with the same substring

    - by Deepak
    Hi People, Below is the Problem Statement: PS: Given a string and a non-empty substring sub, compute recursively the largest substring which starts and ends with sub and return its length. Examples: strDist("catcowcat", "cat") ? 9 strDist("catcowcat", "cow") ? 3 strDist("cccatcowcatxx", "cat") ? 9 Below is my Code: (Without recursion)//since i found it hard to implement with recursion. public int strDist(String str, String sub){ int idx = 0; int max; if (str.isEmpty()) max = 0; else max=1; while ((idx = str.indexOf(sub, idx)) != -1){ int previous=str.indexOf(sub, idx); max = Math.max(max,previous); idx++; } return max; } Its working for few as shown below but returns FAIL for others. Expected This Run strDist("catcowcat", "cat") ? 9 6 FAIL strDist("catcowcat", "cow") ? 3 3 OK strDist("cccatcowcatxx", "cat") ? 9 8 FAIL strDist("abccatcowcatcatxyz", "cat") ? 12 12 OK strDist("xyx", "x") ? 3 2 FAIL strDist("xyx", "y") ? 1 1 OK strDist("xyx", "z") ? 0 1 FAIL strDist("z", "z") ? 1 1 OK strDist("x", "z") ? 0 1 FAIL strDist("", "z") ? 0 0 OK strDist("hiHellohihihi", "hi") ? 13 11 FAIL strDist("hiHellohihihi", "hih") ? 5 9 FAIL strDist("hiHellohihihi", "o") ? 1 6 FAIL strDist("hiHellohihihi", "ll") ? 2 4 FAIL Could you let me whats wrong with the code and how to return the largest substring that begins and ends with sub with its respective length.

    Read the article

  • Project Euler 7 Scala Problem

    - by Nishu
    I was trying to solve Project Euler problem number 7 using scala 2.8 First solution implemented by me takes ~8 seconds def problem_7:Int = { var num = 17; var primes = new ArrayBuffer[Int](); primes += 2 primes += 3 primes += 5 primes += 7 primes += 11 primes += 13 while (primes.size < 10001){ if (isPrime(num, primes)) primes += num if (isPrime(num+2, primes)) primes += num+2 num += 6 } return primes.last; } def isPrime(num:Int, primes:ArrayBuffer[Int]):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(num) for (i <- primes){ if(i <= r ){ if (num % i == 0) return false; } } return true; } Later I tried the same problem without storing prime numbers in array buffer. This take .118 seconds. def problem_7_alt:Int = { var limit = 10001; var count = 6; var num:Int = 17; while(count < limit){ if (isPrime2(num)) count += 1; if (isPrime2(num+2)) count += 1; num += 6; } return num; } def isPrime2(n:Int):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(n) var f = 5; while (f <= r){ if (n % f == 0) { return false; } else if (n % (f+2) == 0) { return false; } f += 6; } return true; } I tried using various mutable array/list implementations in Scala but was not able to make solution one faster. I do not think that storing Int in a array of size 10001 can make program slow. Is there some better way to use lists/arrays in scala?

    Read the article

  • Add fields to Django ModelForm that aren't in the model

    - by Cyclic
    I have a model that looks like: class MySchedule(models.Model): start_datetime=models.DateTimeField() name=models.CharField('Name',max_length=75) With it comes its ModelForm: class MyScheduleForm(forms.ModelForm): startdate=forms.DateField() starthour=forms.ChoiceField(choices=((6,"6am"),(7,"7am"),(8,"8am"),(9,"9am"),(10,"10am"),(11,"11am"), (12,"noon"),(13,"1pm"),(14,"2pm"),(15,"3pm"),(16,"4pm"),(17,"5pm"), (18,"6pm" startminute=forms.ChoiceField(choices=((0,":00"),(15,":15"),(30,":30"),(45,":45")))),(19,"7pm"),(20,"8pm"),(21,"9pm"),(22,"10pm"),(23,"11pm"))) class Meta: model=MySchedule def clean(self): starttime=time(int(self.cleaned_data.get('starthour')),int(self.cleaned_data.get('startminute'))) return self.cleaned_data try: self.instance.start_datetime=datetime.combine(self.cleaned_data.get("startdate"),starttime) except TypeError: raise forms.ValidationError("There's a problem with your start or end date") Basically, I'm trying to break the DateTime field in the model into 3 more easily usable form fields -- a date picker, an hour dropdown, and a minute dropdown. Then, once I've gotten the three inputs, I reassemble them into a DateTime and save it to the model. A few questions: 1) Is this totally the wrong way to go about doing it? I don't want to create fields in the model for hours, minutes, etc, since that's all basically just intermediary data, so I'd like a way to break the DateTime field into sub-fields. 2) The difficulty I'm running into is when the startdate field is blank -- it seems like it never gets checked for non-blankness, and just ends up throwing up a TypeError later when the program expects a date and gets None. Where does Django check for blank inputs, and raise the error that eventually goes back to the form? Is this my responsibility? If so, how do I do it, since it doesn't evaluate clean_startdate() since startdate isn't in the model. 3) Is there some better way to do this with inheritance? Perhaps inherit the MyScheduleForm in BetterScheduleForm and add the fields there? How would I do this? (I've been playing around with it for over an hours and can't seem to get it) Thanks! [Edit:] Left off the return self.cleaned_data -- lost it in the copy/paste originally

    Read the article

  • #indent "off" in F#

    - by anta40
    I just started learning F#, and tried a code from the wiki: I prefer tabs to spaces, so I change the code a bit into this: #indent "off" open System open System.Windows.Forms let form = new Form(Visible=true, TopMost=true, Text="Welcome to F#") let label = let temp = new Label() let x = 3 + (4 * 5) temp.Text <- sprintf "x = %d" x temp form.Controls.Add(label) [<STAThread>] Application.Run(form) The output is: Microsoft (R) F# 2.0 Compiler build 4.0.30319.1 Copyright (c) Microsoft Corporation. All Rights Reserved. fstest2.fs(1,1): warning FS0062: This construct is for ML compatibility. Conside r using a file with extension '.ml' or '.mli' instead. You can disable this warn ing by using '--mlcompatibility' or '--nowarn:62'. fstest2.fs(9,2): error FS0010: Unexpected keyword 'let' or 'use' in expression. Expected 'in' or other token. fstest2.fs(13,1): error FS0597: Successive arguments should be separated by spac es or tupled, and arguments involving function or method applications should be parenthesized fstest2.fs(9,14): error FS0374: Invalid expression on left of assignment fstest2.fs(16,1): error FS0010: Unexpected identifier in definition Guess the error is somewhere in the let label block, but couldn't figure it out.

    Read the article

  • Getting percentage of "Count(*)" to the number of all items in "GROUP BY"

    - by celalo
    Let's say I need to have the ratio of "number of items available from certain category" to "the the number of all items". Please consider a MySQL table like this: /* mysql> select * from Item; +----+------------+----------+ | ID | Department | Category | +----+------------+----------+ | 1 | Popular | Rock | | 2 | Classical | Opera | | 3 | Popular | Jazz | | 4 | Classical | Dance | | 5 | Classical | General | | 6 | Classical | Vocal | | 7 | Popular | Blues | | 8 | Popular | Jazz | | 9 | Popular | Country | | 10 | Popular | New Age | | 11 | Popular | New Age | | 12 | Classical | General | | 13 | Classical | Dance | | 14 | Classical | Opera | | 15 | Popular | Blues | | 16 | Popular | Blues | +----+------------+----------+ 16 rows in set (0.03 sec) mysql> SELECT Category, COUNT(*) AS Total -> FROM Item -> WHERE Department='Popular' -> GROUP BY Category; +----------+-------+ | Category | Total | +----------+-------+ | Blues | 3 | | Country | 1 | | Jazz | 2 | | New Age | 2 | | Rock | 1 | +----------+-------+ 5 rows in set (0.02 sec) */ What I need is basically a result set resembles this one: /* +----------+-------+-----------------------------+ | Category | Total | percentage to the all items | (Note that number of all available items is "9") +----------+-------+-----------------------------+ | Blues | 3 | 33 | (3/9)*100 | Country | 1 | 11 | (1/9)*100 | Jazz | 2 | 22 | (2/9)*100 | New Age | 2 | 22 | (2/9)*100 | Rock | 1 | 11 | (1/9)*100 +----------+-------+-----------------------------+ 5 rows in set (0.02 sec) */ How can I achieve such a result set in a single query? Thanks in advance.

    Read the article

< Previous Page | 185 186 187 188 189 190 191 192 193 194 195 196  | Next Page >