Search Results

Search found 10941 results on 438 pages for 'location'.

Page 19/438 | < Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • How to get location of sprite placed on rotating circle in cocos2d android?

    - by Real_steel4819
    I am developing a game using cocos2d and i got stuck here when finding location of sprite placed on rotating circle on background, so that when i hit at certain position on circle its not getting hit at wanted position,but its going away from it and placing target there.I tried printing the position of hit on spriteMoveFinished() and ccTouchesEnded(). Its giving initial position and not rotated position. CGPoint location = CCDirector.sharedDirector().convertToGL(CGPoint.ccp(event.getX(), event.getY())); This is what i am using to get location.

    Read the article

  • How to create Large resumable download from a secured location .NET

    - by Kelvin H
    I need to preface I'm not a .NET coder at all, but to get partial functionality, I modified a technet chunkedfilefetch.aspx script that uses chunked Data Reading and writing Streamed method of doing file transfer, to get me half-way. iStream = New System.IO.FileStream(path, System.IO.FileMode.Open, _ IO.FileAccess.Read, IO.FileShare.Read) dataToRead = iStream.Length Response.ContentType = "application/octet-stream" Response.AddHeader("Content-Length", file.Length.ToString()) Response.AddHeader("Content-Disposition", "attachment; filename=" & filedownload) ' Read and send the file 16,000 bytes at a time. ' While dataToRead 0 If Response.IsClientConnected Then length = iStream.Read(buffer, 0, 16000) Response.OutputStream.Write(buffer, 0, length) Response.Flush() ReDim buffer(16000) ' Clear the buffer ' dataToRead = dataToRead - length Else ' Prevent infinite loop if user disconnects ' dataToRead = -1 End If End While This works great on files up to 2GB and is fully functioning now.. But only one problem it doesn't allow for resume. I took the original code called it fetch.aspx and pass an orderNUM through the URL. fetch.aspx&ordernum=xxxxxxx It then reads the filename/location from the database occording to the ordernumber, and chunks it out from a secured location NOT under the webroot. I need a way to make this resumable, by the nature of the internet and large files people always get disconnected and would like to resume where they left off. But any resumable articles i've read, assume the file is within the webroot.. ie. http://www.devx.com/dotnet/Article/22533/1954 Great article and works well, but I need to stream from a secured location. I'm not a .NET coder at all, at best i can do a bit of coldfusion, if anyone could help me modify a handler to do this, i would really appreciate it. Requirements: I Have a working fetch.aspx script that functions well and uses the above code snippet as a base for the streamed downloading. Download files are large 600MB and are stored in a secured location outside of the webroot. Users click on the fetch.aspx to start the download, and would therefore be clicking it again if it was to fail. If the ext is a .ASPX and the file being sent is a AVI, clicking on it would completely bypass an IHTTP handler mapped to .AVI ext, so this confuses me From what I understand the browser will read and match etag value and file modified date to determine they are talking about the same file, then a subsequent accept-range is exchanged between the browser and IIS. Since this dialog happens with IIS, we need to use a handler to intercept and respond accordingly, but clicking on the link would send it to an ASPX file which the handeler needs to be on an AVI fiel.. Also confusing me. If there is a way to request the initial HTTP request header containing etag, accept-range into the normal .ASPX file, i could read those values and if the accept-range and etag exist, start chunking at that byte value somehow? but I couldn't find a way to transfer the http request headers since they seem to get lost at the IIS level. OrderNum which is passed in the URL string is unique and could be used as the ETag Response.AddHeader("ETag", request("ordernum")) Files need to be resumable and chunked out due to size. File extensions are .AVI so a handler could be written around it. IIS 6.0 Web Server Any help would really be appreciated, i've been reading and reading and downloading code, but none of the examples given meet my situation with the original file being streamed from outside of the webroot. Please help me get a handle on these httphandlers :)

    Read the article

  • how to remove location block from $uri in nginx configuration?

    - by Jason
    I have a rewrite in my ngix conf file that works properly except it seems to include the location block as part of the $uri variable. I only want the path after the location block. My current config code is: location /cargo { try_files $uri $uri/ /cargo/index.php?_REWRITE_COMMAND=$uri&args; } Using an example url of http://localhost/cargo/testpage the redirect works, however the value of the "_REWRITE_COMMAND" parameter received by my php file is "/cargo/testpage". I need to strip off the location block and just have "testpage" as the $uri I am pretty sure there is a regex syntax to split the $uri and assign it to a new variable using $1 $2 etc, but I can't find any example to do just a variable assignment using a regex that is not part of a rewrite statement. I've been looking and trying for hours and I just can't seem to get past this last step. I also know I could just strip this out on the application code, but the reason I want to try to fix it in the nginx conf is for compatibility reasons as it also runs on Apache. I also should say that I have figured out a really hacky way to do it, but it involves an "if" statement to check for file existance and the documentation specifically says not to do it that way. -- UPDATE: ANSWERED BY theuni: The regex goes in the location block definition. one note of caution is that php handler location needs to be ABOVE this location, otherwise you will get a server error because it goes into an infinite redirect loop location ~ ^/cargo/(.*) { try_files $1 /cargo/$1/ /cargo/index.php?_REWRITE_COMMAND=$1&args; }

    Read the article

  • How mail tracking works?

    - by abc
    whoreadme is the web site that helps to track mail reader's location as well as it acknowledges when reader opens mail. What is the concept of detection behind this?

    Read the article

  • Distributing IronPython applications - how to detect the location of ipyw.exe

    - by Kragen
    I'm thinking of developing a small application using Iron python, however I want to distribute my app to non-techies and so ideally I want to be able to give them a standard shortcut to my application along with the instructions that they need to install IronPython first. If possible I even want my shortcut to detect if IronPython is not present and display a suitable warning if this is the case (which I can do using a simple VbScript) The trouble is that IronPython doesn't place itself in the %PATH% environment variable, and so if IronPython is installed to a nonstandard location my shortcut don't work. Now I could also tell my users "If you install IronPython to a different location you need to go and edit this shortcut and...", but this is all getting far too technical for my target audience. Is there any foolproof way of distributing my IronPython dependent app?

    Read the article

  • Marking Current Location on Map, Android

    - by deewangan
    Hi every one, i followed some tutorials to create an application that shows the current position of the user on the map with a marking. but for some reasons i can't get to work the marking part? the other parts works well, but whenever i add the marking code the application crashes. i hope someone could help me.here is the code: public class LocationActivity extends MapActivity { /** Called when the activity is first created. */ private MapView mapView; private LocationManager lm; private LocationListener ll; private MapController mc; GeoPoint p = null; Drawable defaultMarker = null; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mapView = (MapView)findViewById(R.id.mapView); //show zoom in/out buttons mapView.setBuiltInZoomControls(true); //Standard view of the map(map/sat) mapView.setSatellite(false); //get controller of the map for zooming in/out mc = mapView.getController(); // Zoom Level mc.setZoom(18); MyLocationOverlay myLocationOverlay = new MyLocationOverlay(); List<Overlay> list = mapView.getOverlays(); list.add(myLocationOverlay); lm = (LocationManager)getSystemService(Context.LOCATION_SERVICE); ll = new MyLocationListener(); lm.requestLocationUpdates( LocationManager.GPS_PROVIDER, 0, 0, ll); //Get the current location in start-up GeoPoint initGeoPoint = new GeoPoint( (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLatitude()*1000000), (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLongitude()*1000000)); mc.animateTo(initGeoPoint); } protected class MyLocationOverlay extends com.google.android.maps.Overlay { @Override public boolean draw(Canvas canvas, MapView mapView, boolean shadow, long when) { Paint paint = new Paint(); super.draw(canvas, mapView, shadow); // Converts lat/lng-Point to OUR coordinates on the screen. Point myScreenCoords = new Point(); mapView.getProjection().toPixels(p, myScreenCoords); paint.setStrokeWidth(1); paint.setARGB(255, 255, 255, 255); paint.setStyle(Paint.Style.STROKE); Bitmap bmp = BitmapFactory.decodeResource(getResources(), R.drawable.push); canvas.drawBitmap(bmp, myScreenCoords.x, myScreenCoords.y, paint); canvas.drawText("I am here...", myScreenCoords.x, myScreenCoords.y, paint); return true; } } private class MyLocationListener implements LocationListener{ public void onLocationChanged(Location argLocation) { // TODO Auto-generated method stub GeoPoint myGeoPoint = new GeoPoint( (int)(argLocation.getLatitude()*1000000), (int)(argLocation.getLongitude()*1000000)); /* * it will show a message on * location change Toast.makeText(getBaseContext(), "New location latitude [" +argLocation.getLatitude() + "] longitude [" + argLocation.getLongitude()+"]", Toast.LENGTH_SHORT).show(); */ mc.animateTo(myGeoPoint); } public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } protected boolean isRouteDisplayed() { return false; } } here is the logcat: 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): >>>>>>>>>>>>>> AndroidRuntime START <<<<<<<<<<<<<< 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): CheckJNI is ON 01-19 05:31:43.411: DEBUG/AndroidRuntime(759): --- registering native functions --- 01-19 05:31:43.431: INFO/jdwp(759): received file descriptor 19 from ADB 01-19 05:31:43.431: INFO/jdwp(759): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.531: INFO/ActivityManager(583): Starting activity: Intent { flg=0x10000000 cmp=pro.googlemapp/.LocationActivity } 01-19 05:31:44.641: DEBUG/AndroidRuntime(759): Shutting down VM 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM waiting for non-daemon threads to exit 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM shutting VM down 01-19 05:31:44.641: DEBUG/dalvikvm(759): HeapWorker thread shutting down 01-19 05:31:44.651: DEBUG/dalvikvm(759): HeapWorker thread has shut down 01-19 05:31:44.651: DEBUG/jdwp(759): JDWP shutting down net... 01-19 05:31:44.651: DEBUG/jdwp(759): +++ peer disconnected 01-19 05:31:44.651: INFO/dalvikvm(759): Debugger has detached; object registry had 1 entries 01-19 05:31:44.661: DEBUG/dalvikvm(759): VM cleaning up 01-19 05:31:44.681: INFO/ActivityManager(583): Start proc pro.googlemapp for activity pro.googlemapp/.LocationActivity: pid=770 uid=10025 gids={3003} 01-19 05:31:44.761: DEBUG/dalvikvm(759): LinearAlloc 0x0 used 676436 of 4194304 (16%) 01-19 05:31:44.801: INFO/jdwp(770): received file descriptor 20 from ADB 01-19 05:31:44.822: INFO/dalvikvm(770): ignoring registerObject request in thread=3 01-19 05:31:44.851: INFO/jdwp(770): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.851: ERROR/jdwp(770): Failed writing handshake bytes: Broken pipe (-1 of 14) 01-19 05:31:44.851: INFO/dalvikvm(770): Debugger has detached; object registry had 0 entries 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.340: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.781: DEBUG/LocationManager(770): Constructor: service = android.location.ILocationManager$Stub$Proxy@4379d9f0 01-19 05:31:45.791: WARN/GpsLocationProvider(583): Duplicate add listener for uid 10025 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): setMinTime 0 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): startNavigating 01-19 05:31:45.831: INFO/jdwp(770): received file descriptor 27 from ADB 01-19 05:31:46.001: INFO/MapActivity(770): Handling network change notification:CONNECTED 01-19 05:31:46.001: ERROR/MapActivity(770): Couldn't get connection factory client 01-19 05:31:46.451: DEBUG/dalvikvm(770): GC freed 4539 objects / 298952 bytes in 118ms 01-19 05:31:46.470: DEBUG/AndroidRuntime(770): Shutting down VM 01-19 05:31:46.470: WARN/dalvikvm(770): threadid=3: thread exiting with uncaught exception (group=0x4001aa28) 01-19 05:31:46.481: ERROR/AndroidRuntime(770): Uncaught handler: thread main exiting due to uncaught exception 01-19 05:31:46.541: ERROR/AndroidRuntime(770): java.lang.NullPointerException 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:58) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:48) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at pro.googlemapp.LocationActivity$MyLocationOverlay.draw(LocationActivity.java:101) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.OverlayBundle.draw(OverlayBundle.java:42) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.MapView.onDraw(MapView.java:476) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6274) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1883) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.draw(ViewRoot.java:1332) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.performTraversals(ViewRoot.java:1097) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.handleMessage(ViewRoot.java:1613) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Handler.dispatchMessage(Handler.java:99) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Looper.loop(Looper.java:123) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.app.ActivityThread.main(ActivityThread.java:4203) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invokeNative(Native Method) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invoke(Method.java:521) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:791) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:549) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at dalvik.system.NativeStart.main(Native Method) 01-19 05:31:46.551: INFO/Process(583): Sending signal. PID: 770 SIG: 3 01-19 05:31:46.581: INFO/dalvikvm(770): threadid=7: reacting to signal 3 01-19 05:31:46.661: INFO/dalvikvm(770): Wrote stack trace to '/data/anr/traces.txt' 01-19 05:31:46.871: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00000000_00000000 [ 27 ipp] (41 ins) at [0x2c69c8:0x2c6a6c] in 973448 ns 01-19 05:31:46.911: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00001001_00000000 [ 64 ipp] (84 ins) at [0x2c6a70:0x2c6bc0] in 1985378 ns 01-19 05:31:49.881: INFO/Process(770): Sending signal. PID: 770 SIG: 9 01-19 05:31:49.931: INFO/ActivityManager(583): Process pro.googlemapp (pid 770) has died. 01-19 05:31:49.941: WARN/GpsLocationProvider(583): Unneeded remove listener for uid 1000 01-19 05:31:49.941: DEBUG/GpsLocationProvider(583): stopNavigating 01-19 05:31:49.951: INFO/WindowManager(583): WIN DEATH: Window{438891c0 pro.googlemapp/pro.googlemapp.LocationActivity paused=false} 01-19 05:31:50.111: WARN/UsageStats(583): Unexpected resume of com.android.launcher while already resumed in pro.googlemapp 01-19 05:31:50.200: WARN/InputManagerService(583): Got RemoteException sending setActive(false) notification to pid 770 uid 10025

    Read the article

  • How To find the location of any treeviewitem in silverlight

    - by user312772
    Hi I am new in silverlight 3. I want to find the location of any treeview Item . Although I applied this code GeneralTransform gt = ProjectTree.TransformToVisual(Application.Current.RootVisual as UIElement); Point offset = gt.Transform(new Point(0, 0)); double controlTop = offset.Y; double controlLeft = offset.X; Here Project tree is the root element of the treeview. This code is working But when I applied this for any child TreeViewelement of Treeview then an exception occurs "Value does not fall within the expected range." How to find the location of this child treeview element object

    Read the article

  • current location from CoreLocation

    - by Christian
    I have an App which launches the google Map App. The code is: UIApplication *app = [UIApplication sharedApplication]; [app openURL:[[NSURL alloc] initWithString: @"http://maps.google.com/maps?daddr=Obere+Laube,+Konstanz,+Germany&saddr="]]; The saddr= should be the current location. I get the current location with -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"%f,%f", [newLocation coordinate]); The Log displays the correct coordinates like 2010-04-05 15:33:25.436 deBordeaux[60657:207] 37.331689,-122.030731 I didn't find the right way to transmit the coordinates to the url-string. Does someone can give me a hint how-to?

    Read the article

  • Blackberry.location API not working correctly

    - by chibineku
    I am experimenting with making Blackberry widgets but having a little trouble. My first trial involves displaying a button which, when clicked, calls a JavaScript function that should alert the phones latitude and longitude. The function looks: function whereAmI() { var latitude = blackberry.location.latitude; var longitude = blackberry.location.longitude; alert("Lat: "+latitude+", Long: "+longitude); } But it only ever alerts "Lat: 0, Long: 0". I've checked and my GPS seems to be working ok. I'm running OS 5.* on a Curve 8900. Any help would be appreciated :)

    Read the article

  • Change the Views location

    - by Vinni
    I am developing a website in MVC 2.0. I want to change the View folder location in my website. I wanted to keep the views folder inside other folders, When I try to do so i am getting following errors The view 'Index' or its master was not found. The following locations were searched: ~/Views/Search/Index.aspx ~/Views/Search/Index.ascx ~/Views/Shared/Index.aspx ~/Views/Shared/Index.ascx Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. My Views folder will be in ~/XYZ/ABC/Views instead of ~/Views. Please solve my problem. Will I get any problems If I change the default Views folder location. Do I need to change anything in HTML Helper classes because I don't know anything in MVC as this is my starting project i dont want to risk..Please help me out...

    Read the article

  • Debugging problems in Visual Studio 2005 - No source code available for the current location

    - by espais
    Hi all I've searched up and down Google for others with a similar problem, and while I can find the error I don't think that other people have the same base problem that I do. Basically, I had to create a project for a unit-testing environment in order to run this test suite. First, I add my original C file, compile, and then a test file (C++) is generated. I then exclude my original source from the project, include this test script (which includes the original source at the top), and then run. I can debug the test file fine, but when it jumps to the original C file I get the dreaded 'no source code available for the current location' error. Both files are located within the same location, and I compiled the original file without any issue. Anybody have any thoughts about this? Its driving me crazy!

    Read the article

  • location.hash in an iframe scrolls the parent window

    - by Ben Clayton
    Hi all. I have a page with an iframe. Inside the iframe is code (that I can't change) that sets location.hash to the id of an element in the iframe window. This has the unwanted effect of scrolling my outermost browser window so that the top of the window touches the top of the iframe. This is quite annoying as I have a toolbar above the iframe that is vital to my app. Is there any way of preventing the setting of location.hash affecting the scroll position of the main window? Will preventDefault help me out here? Thanks!

    Read the article

  • NSStatusItem (cocoa) location on screen

    - by Craig
    I am trying to get the on screen location of an NSStatusItem so that I can perform a click on that area via code like below. I am doing this so that my users can press a hotkey to see the menu. event = CGEventCreateMouseEvent(NULL, kCGEventLeftMouseDown, newLocation, kCGMouseButtonLeft); CGEventPost(kCGHIDEventTap, event); CFRelease(event); Does anyone know of a way to get the location?, I have been trying ideas and searching for days and have found several ideas but none of them seem to work in leopard/snow leopard The NSStatusItem is using an NSMenu not a custom view.

    Read the article

  • IIS7 and 301 permanent redirects using the location tag in web.config

    - by Mike
    I need to setup some 301 permanent redirects in the web.config of an ASP.NET MVC application running under IIS. The easiest way is to add a tag similar to the one below to the web.config file: <location path="TheMenu.aspx"> <system.webServer> <httpRedirect enabled="true" destination="menus/" httpResponseStatus="Permanent" /> </system.webServer> </location> When I go to the site at http://domain.com/TheMenu.aspx it redirects me to http://domain.com/menusxd instead of http://domain.com/menus. What would be causing this?

    Read the article

  • Why is ContextConfiguration location different in idea and eclipse

    - by jakob
    Hello experts. In my team we work both in Eclipse and Idea. That works pretty good, except for one minor issue that I can't figure out how to solve. When setting the ContextConfiguration location in our tests and running them inside Eclipse everything works like a charm: @Test(groups = { "database" }) @ContextConfiguration(locations = {" file:src/main/webapp/WEB-INF/applicationContext.xml" }) But in my Idea env I get "could not find applicationContext" error. I need to set the location like this(project name is services): @Test(groups = { "database" }) @ContextConfiguration(locations = {" file:services/src/main/webapp/WEB-INF/applicationContext.xml" }) The project structure is like this: parent.pom with two child poms: services.pom and other.pom. When running the test in the terminal from the service project like this: mvn -Dtest=com.mytest.service.somepackage.TheTest test there are no issues. I guess that since my project structure is parent-with-two-children the need of /service is necessary(The project is created by pointing out the parent pom). Is there a way to fix this? Could you please help me with a solution. thx

    Read the article

  • MKReverseGeocoder delegate location?

    - by fuzzygoat
    I have a quick question regarding memory management that I am not quite sure about. I currently have a locationManager delegate that calls locationManager:didUpdateToLocation:fromLocation when it resolves the device location. My question is I am looking at adding ReverseGeoCoding after I have obtained the [newLocation coordinate] but am unsure about doing the alloc here, as each time locationManager:didUpdateToLocation:fromLocation gets called I will be alloc-ing a new MKReverseGeoCoder? // LOCATION -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { // GeoCoding: MKReverseGeocoder *geoCoder = [[MKReverseGeocoder alloc] initWithCoordinate:[newLocation coordinate]]; [geoCoder setDelegate:self]; [geoCoder start]; [self foundLocation]; } Can anyone point me in the right direction with regards to this? I did try doing the alloc in application:didFinishLaunchingWithOptions: but then realised I did not have access to [newLocation coordinate]. many thanks gary

    Read the article

< Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >