Search Results

Search found 44502 results on 1781 pages for 'run as administrator'.

Page 191/1781 | < Previous Page | 187 188 189 190 191 192 193 194 195 196 197 198  | Next Page >

  • How to schedule multiple jobs in quartz scheduler using same trigger?

    - by aquero
    Hi, I am using quartz scheduler in my spring project. I have to run a job after another job which is scheduled to run in every 15 mins? I cant run this job concurrently as both of this jobs have to access same mail account using different protocols(one to send:smtp and other to receive: imap) and it may cause problems. Please reply quickly, as its an urgent requirement.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Rails - rake:gems:install - not installing gems

    - by Hamish
    If i define a few gems in my config/environments/test.rb file like this: config.gem "rspec" config.gem "rspec-rails" config.gem "mocha" and then run 'rake gems:install RAILS_ENV=test' I get the following error: Missing these required gems: mocha Run rake gems:install to install the missing gems. however if I run rake gems:install like it says it will continue to recurse like this forever. How do I actually get the gems to install using rake (not gem install)? thanks!

    Read the article

  • How to make a general profile for PHPUnit testing in WebIDE?

    - by Ondrej Slinták
    I'm playing a bit with beta version of PHP Storm (PHP version of WebIDE) and its integration of PHPUnit. I know how to set a profile to run tests in particular file, directory or class. Problem is, I'd like to create some profile where Run button would run tests in currently opened file. Any idea if there's a way to do it? Or perhaps it isn't implemented in beta version yet?

    Read the article

  • JMS ConnectionFactory creation error WSVR0073W

    - by scottyab
    I must confess I’m not a JMS aficionado, one of our guys has written a Java webservice client [postcode lookup web service] and from a Remote Java client are calling a Message Driven Bean running in Websphere 6.1, using JMS. Getting the following error when attempted to create the Connection Factory. To which configured within Websphere jms/WSProxyQueueConnectionFactory. WARNING: WSVR0073W. Googling WSVR0073W yields little, the error code is an unknown error. Can anyone shed any light on potential issues creating the connection factory. Code Hashtable env = new Hashtable(); env.put(Context.INITIAL_CONTEXT_FACTORY, contextFactoryName); env.put(Context.PROVIDER_URL, providerURL); env.put("com.ibm.CORBA.ORBInit","com.ibm.ws.sib.client.ORB"); namingContext = new InitialContext(env); System.out.println("callRemoteService: get connectionFactoriy, request/response queues, session. Naming contex env =" + env); // Find everything we need to communicate... connectionFactory = (QueueConnectionFactory) namingContext.lookup(getQueueConnectionFactoryName()); requestQueue = (Queue) namingContext.lookup(getRequestQueueName()); Console output: calling RemoteService with hostname[MyServer:2813] and postcode[M4E 3W1]callRemoteService hostname[MyServer:2813] messess text[M4E 3W1] callRemoteService: get connectionFactoriy, request/response queues, session. Naming contex env ={com.ibm.CORBA.ORBInit=com.ibm.ws.sib.client.ORB, java.naming.provider.url=iiop:// MyServer:2813/, java.naming.factory.initial=com.ibm.websphere.naming.WsnInitialContextFactory} 05-Jan-2011 13:51:04 null null WARNING: WSVR0073W 05-Jan-2011 13:51:05 null null WARNING: jndiGetObjInstErr 05-Jan-2011 13:51:05 null null WARNING: jndiNamingException callRemoteService: closing connections and resources com.ibm.websphere.naming.CannotInstantiateObjectException: Exception occurred while the JNDI NamingManager was processing a javax.naming.Reference object. [Root exception is java.lang.NoClassDefFoundError: Invalid Implementation Key, com.ibm.ws.transaction.NonRecovWSTxManager] at com.ibm.ws.naming.util.Helpers.processSerializedObjectForLookupExt(Helpers.java:1000) at com.ibm.ws.naming.util.Helpers.processSerializedObjectForLookup(Helpers.java:705) at com.ibm.ws.naming.jndicos.CNContextImpl.processResolveResults(CNContextImpl.java:2097) at com.ibm.ws.naming.jndicos.CNContextImpl.doLookup(CNContextImpl.java:1951) at com.ibm.ws.naming.jndicos.CNContextImpl.doLookup(CNContextImpl.java:1866) at com.ibm.ws.naming.jndicos.CNContextImpl.lookupExt(CNContextImpl.java:1556) at com.ibm.ws.naming.jndicos.CNContextImpl.lookup(CNContextImpl.java:1358) at com.ibm.ws.naming.util.WsnInitCtx.lookup(WsnInitCtx.java:172) at javax.naming.InitialContext.lookup(InitialContext.java:450) at com.das.jms.clients.BaseWSProxyClient.callRemoteService(BaseWSProxyClient.java:180) at com.das.jms.clients.RemotePostCodeLookup.findAddress(RemotePostCodeLookup.java:38) at com.das.jms.RemoteServiceAccess.findAddress(RemoteServiceAccess.java:80) at com.das.jms.TestRemoteAccess.testSuccessLookup(TestRemoteAccess.java:20) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:37) at java.lang.reflect.Method.invoke(Method.java:599) at junit.framework.TestCase.runTest(TestCase.java:168) at junit.framework.TestCase.runBare(TestCase.java:134) at junit.framework.TestResult$1.protect(TestResult.java:110) at junit.framework.TestResult.runProtected(TestResult.java:128) at junit.framework.TestResult.run(TestResult.java:113) at junit.framework.TestCase.run(TestCase.java:124) at junit.framework.TestSuite.runTest(TestSuite.java:232) at junit.framework.TestSuite.run(TestSuite.java:227) at org.junit.internal.runners.OldTestClassRunner.run(OldTestClassRunner.java:76) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:45) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:460)com.ibm.websphere.naming.CannotInstantiateObjectException: Exception occurred while the JNDI NamingManager was processing a javax.naming.Reference object. [Root exception is java.lang.NoClassDefFoundError: Invalid Implementation Key, com.ibm.ws.transaction.NonRecovWSTxManager] [[B@4d794d79 at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:673) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:386) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:196) Caused by: java.lang.NoClassDefFoundError: Invalid Implementation Key, com.ibm.ws.transaction.NonRecovWSTxManager at com.ibm.ws.Transaction.TransactionManagerFactory.getUOWCurrent(TransactionManagerFactory.java:125) at com.ibm.ws.rsadapter.AdapterUtil.<clinit>(AdapterUtil.java:271) at java.lang.J9VMInternals.initializeImpl(Native Method) at java.lang.J9VMInternals.initialize(J9VMInternals.java:200) at com.ibm.ejs.j2c.ConnectionFactoryBuilderImpl.getObjectInstance(ConnectionFactoryBuilderImpl.java:281) at javax.naming.spi.NamingManager.getObjectInstanceByFactoryInReference(NamingManager.java:480) at javax.naming.spi.NamingManager.getObjectInstance(NamingManager.java:345) at com.ibm.ws.naming.util.Helpers.processSerializedObjectForLookupExt(Helpers.java:896) ... 31 more

    Read the article

  • Voice transmission over LAN using java?

    - by Ala ABUDEEB
    Hello I'm building a java application which works in a LAN environment, every computer on that LAN have this application installed on it, at some point i need this application to transfer voice simultaneously to all computer over the LAN (voice broadcasting) according to the following mechanism: Only one computer of the LAN can send voice using a microphone(the administrator) All computers receive that voice simultaneously (of course using my application) The voice should be recorded on the administrator computer after finishing the session. Could anyone give me an idea of how to use java in working with voice transmission? What java library can help me do that? Please help, thank you

    Read the article

  • Command-Line Parsing API from TestAPI library - Type-Safe Commands how to

    - by MicMit
    Library at http://testapi.codeplex.com/ Excerpt of usage from http://blogs.msdn.com/ivo_manolov/archive/2008/12/17/9230331.aspx A third common approach is forming strongly-typed commands from the command-line parameters. This is common for cases when the command-line looks as follows: some-exe COMMAND parameters-to-the-command The parsing in this case is a little bit more involved: Create one class for every supported command, which derives from the Command abstract base class and implements an expected Execute method. Pass an expected command along with the command-line arguments to CommandLineParser.ParseCommand – the method will return a strongly-typed Command instance that can be Execute()-d. // EXAMPLE #3: // Sample for parsing the following command-line: // Test.exe run /runId=10 /verbose // In this particular case we have an actual command on the command-line (“run”), which we want to effectively de-serialize and execute. public class RunCommand : Command { bool? Verbose { get; set; } int? RunId { get; set; } public override void Execute() { // Implement your "run" execution logic here. } } Command c = new RunCommand(); CommandLineParser.ParseArguments(c, args); c.Execute(); ============================ I don't get if we instantiate specific class before parsing arguments , what's the point of command line argument "run" which is very first one. I thought the idea was to instantiate and execute command/class based on a command line parameter ( "run" parameter becomes instance RunCommand class, "walk" becomes WalkCommand class and so on ). Can it be done with the latest version ?

    Read the article

  • dynamically create class in scala, should I use interpreter?

    - by Phil
    Hi, I want to create a class at run-time in Scala. For now, just consider a simple case where I want to make the equivalent of a java bean with some attributes, I only know these attributes at run time. How can I create the scala class? I am willing to create from scala source file if there is a way to compile it and load it at run time, I may want to as I sometimes have some complex function I want to add to the class. How can I do it? I worry that the scala interpreter which I read about is sandboxing the interpreted code that it loads so that it won't be available to the general application hosting the interpreter? If this is the case, then I wouldn't be able to use the dynamically loaded scala class. Anyway, the question is, how can I dynamically create a scala class at run time and use it in my application, best case is to load it from a scala source file at run time, something like interpreterSource("file.scala") and its loaded into my current runtime, second best case is some creation by calling methods ie. createClass(...) to create it at runtime. Thanks, Phil

    Read the article

  • .NET 4 SpinLock

    - by Jon Harrop
    The following test code (F#) is not returning the result I'd expect: let safeCount() = let n = 1000000 let counter = ref 0 let spinlock = ref <| SpinLock(false) let run i0 i1 () = for i=i0 to i1-1 do let locked = ref false try (!spinlock).Enter locked if !locked then counter := !counter + 1 finally if !locked then (!spinlock).Exit() let thread = System.Threading.Thread(run 0 (n/2)) thread.Start() run (n/2) n () thread.Join() !counter I'd expect the SpinLock to mutually exclude the counter and, therefore, for it to return counts of 1,000,000 but, instead, it returns smaller values as if no mutual exclusion is occurring. Any ideas what's wrong?

    Read the article

  • Facebook Source path issue in iPhone

    - by Arun Thakkar
    Hello everyone!! Hope You all are fie and also in one of your best of moods!! I need your help to solve an issue with Facebook. I have integrate Facebook Connect with my iPhone app. So as per step i have to write path of src folder into 'Header path info' Field in Project Build. I have given the absolute path to 'Header path info' Field. and its run fine without any Error.. But, Now When i Move the project folder to another destination, its but obvious, that path of src folder will change… So Now after moving file, when i run an application, It gives path error. So is there any way to solve this path issue? this comes when i run an app in simulator, and i guess It also won't run in iPhone because of problem of path of src folder. Kindly accept my Apologize if i have written anything wrong.. Looking Forwards, Thanks, Arun Thakkar

    Read the article

  • Netbeans Profile JUnit 4 problem

    - by Krishna K
    I have a unit test that takes 200 sec to run. I am trying to use NetBeans profiler to speed it up. But the profiler doesn't run the unit test. It just creates an object of the test and exits. Doesn't run the actual test methods or @Before / @After methods. This is a maven project with surefire and junit 4. And partial output is below. Profiler Agent: Waiting for connection on port 5140, timeout 10 seconds (Protocol version: 9) Profiler Agent: Established local connection with the tool ------------------------------------------------------- T E S T S ------------------------------------------------------- Running com.cris.puzzle.solvers.SudokuSolverTest Tests run: 0, Failures: 0, Errors: 0, Skipped: 0, Time elapsed: 0.031 sec Results : Tests run: 0, Failures: 0, Errors: 0, Skipped: 0 Profiler Agent: Connection with agent closed Profiler Agent: Connection with agent closed Profiler Agent: Initializing... Profiler Agent: Options: >C:/Program Files/NetBeans 6.8/profiler3/lib,5140,10< Profiler Agent: Initialized succesfully ------------------------------------------------------------------------ BUILD SUCCESSFUL ------------------------------------------------------------------------ Total time: 14 seconds Does anyone know how to make it work? Thank you.

    Read the article

  • Maven: compile aspectj project containing Java 1.6 source

    - by gmale
    What I want to do is fairly easy. Or so you would think. However, nothing is working properly. Requirement: Using maven, compile Java 1.6 project using AspectJ compiler. Note: Our code cannot compile with javac. That is, it fails compilation if aspects are not woven in (because we have aspects that soften exceptions). Questions (based on failed attempts below): Either 1) How do you get maven to run the aspectj:compile goal directly, without ever running compile:compile? 2) How do you specify a custom compilerId that points to your own ajc compiler? Thanks for any and all suggestions. These are the things I've tried that have let to my problem/questions: Attempt 1 (fail): Specify aspectJ as the compiler for the maven-compiler-plugin: org.apache.maven.plugins maven-compiler-plugin 2.2 1.6 1.6 aspectj org.codehaus.plexus plexus-compiler-aspectj 1.8 This fails with the error: org.codehaus.plexus.compiler.CompilerException: The source version was not recognized: 1.6 No matter what version of the plexus compiler I use (1.8, 1.6, 1.3, etc), this doesn't work. I actually read through the source code and found that this compiler does not like source code above Java 1.5. Attempt 2 (fail): Use the aspectJ-maven-plugin attached to the compile and test-compile goals: org.codehaus.mojo aspectj-maven-plugin 1.3 1.6 1.6 compile test-compile This fails when running either: mvn clean test-compile mvn clean compile because it attempts to execute compile:compile before running aspectj:compile. As noted above, our code doesn't compile with javac--the aspects are required. So mvn would need to skip the compile:compile goal altogether and run only aspectj:compile. Attempt 3 (works but unnacceptable): Use the same configuration above but instead run: mvn clean aspectj:compile This works, in that it builds successfully but it's unacceptable in that we need to be able to run the compile goal and the test-compile goal directly (m2eclipse auto-build depends on those goals). Moreover, running it this way would require that we spell out every goal we want along the way (for instance, we need resources distributed and tests to be run and test resources deployed, etc)

    Read the article

  • Make Python Socket Server More Efficient

    - by BenMills
    I have very little experience working with sockets and multithreaded programming so to learn more I decided to see if I could hack together a little python socket server to power a chat room. I ended up getting it working pretty well but then I noticed my server's CPU usage spiked up over 100% when I had it running in the background. Here is my code in full: http://gist.github.com/332132 I know this is a pretty open ended question so besides just helping with my code are there any good articles I could read that could help me learn more about this? My full code: import select import socket import sys import threading from daemon import Daemon class Server: def __init__(self): self.host = '' self.port = 9998 self.backlog = 5 self.size = 1024 self.server = None self.threads = [] self.send_count = 0 def open_socket(self): try: self.server = socket.socket(socket.AF_INET6, socket.SOCK_STREAM) self.server.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) self.server.bind((self.host,self.port)) self.server.listen(5) print "Server Started..." except socket.error, (value,message): if self.server: self.server.close() print "Could not open socket: " + message sys.exit(1) def remove_thread(self, t): t.join() def send_to_children(self, msg): self.send_count = 0 for t in self.threads: t.send_msg(msg) print 'Sent to '+str(self.send_count)+" of "+str(len(self.threads)) def run(self): self.open_socket() input = [self.server,sys.stdin] running = 1 while running: inputready,outputready,exceptready = select.select(input,[],[]) for s in inputready: if s == self.server: # handle the server socket c = Client(self.server.accept(), self) c.start() self.threads.append(c) print "Num of clients: "+str(len(self.threads)) self.server.close() for c in self.threads: c.join() class Client(threading.Thread): def __init__(self,(client,address), server): threading.Thread.__init__(self) self.client = client self.address = address self.size = 1024 self.server = server self.running = True def send_msg(self, msg): if self.running: self.client.send(msg) self.server.send_count += 1 def run(self): while self.running: data = self.client.recv(self.size) if data: print data self.server.send_to_children(data) else: self.running = False self.server.threads.remove(self) self.client.close() """ Run Server """ class DaemonServer(Daemon): def run(self): s = Server() s.run() if __name__ == "__main__": d = DaemonServer('/var/servers/fserver.pid') if len(sys.argv) == 2: if 'start' == sys.argv[1]: d.start() elif 'stop' == sys.argv[1]: d.stop() elif 'restart' == sys.argv[1]: d.restart() else: print "Unknown command" sys.exit(2) sys.exit(0) else: print "usage: %s start|stop|restart" % sys.argv[0] sys.exit(2)

    Read the article

  • WPF: Changing config file user settings at runtime?

    - by Poku
    Hey I'm trying to change some config file user settings values in my WPF application, but its only working partly. The value is changed correctly and the program runs fine with the value. I can even restart the program and the value is still the one i changed it to. The problem is that when i open the .exe.config file the value is still the old value. Im using this code to change the value: Properties.Settings.Default.ProjectNumber = varTestExample; Properties.Settings.Default.Save(); Where does this save code save the changes and how/where does the program read the value after i have run this code? If i run a clean version of the program the ProjectNumber value is correctly taken from the .exe.config file and if i change the value in the config file it is also change when i run the program. But as soon as i run the above code the program is not reading the value from the config file. Why?

    Read the article

  • Can't start gdb.exe in Qt Creator

    - by Ben
    I have a project in Qt Creator that builds fine, but when I try to debug it I get this message: Adapter start failed Unable to start gdb 'C:\Qt\2010.02.1\mingw\bin\gdb.exe': Process failed to start: The directory name is invalid If I navigate to the debug build folder and directly run my compiled application, it will run fine, but obviously there's no debugging support. Additionally, gdb.exe is present at C:\Qt\2010.02.1\mingw\bin\gdb.exe, but Qt Creator can't seem to run it. How can I fix this problem?

    Read the article

  • a scala remote actor exception

    - by kula
    hi all i with a scala code like this for echo service. import scala.actors.Actor import scala.actors.Actor._ import scala.actors.remote.RemoteActor._ class Echo extends Actor { def act() { alive(9010) register('myName, self) loop { react { case msg = println(msg) } } } } object EchoServer { def main(args: Array[String]): unit = { val echo = new Echo echo.start println("Echo server started") } } EchoServer.main(null) but there has some exception. java.lang.NoClassDefFoundError: Main$$anon$1$Echo$$anonfun$act$1 at Main$$anon$1$Echo.act((virtual file):16) at scala.actors.Reaction.run(Reaction.scala:76) at scala.actors.Actor$$anonfun$start$1.apply(Actor.scala:785) at scala.actors.Actor$$anonfun$start$1.apply(Actor.scala:783) at scala.actors.FJTaskScheduler2$$anon$1.run(FJTaskScheduler2.scala:160) at scala.actors.FJTask$Wrap.run(Unknown Source) at scala.actors.FJTaskRunner.scanWhileIdling(Unknown Source) at scala.actors.FJTaskRunner.run(Unknown Source) Caused by: java.lang.ClassNotFoundException: Main$$anon$1$Echo$$anonfun$act$1 at java.net.URLClassLoader$1.run(URLClassLoader.java:200) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:188) at java.lang.ClassLoader.loadClass(ClassLoader.java:307) at java.lang.ClassLoader.loadClass(ClassLoader.java:252) at java.lang.ClassLoader.loadClassInternal(ClassLoader.java:320) ... 8 more i don't konw how can cause it. by the way .my scala version is 2.7.5

    Read the article

  • NoSuchMethod exception when using scala Regex class... confused...

    - by hbatista
    Hi there, I have a simple Scala project that runs without any problems inside Eclipse, however, when packaged into a .jar I receive this exception when running it: Exception in thread "AWT-EventQueue-0" java.lang.NoSuchMethodError: scala.util.matching.Regex.replaceAllIn(Ljava/lang/CharSequence;Lscala/Function1;)Ljava/lang/String; What is going on here?... The code line in question, and the full stack are below. This is the offending line: "alt=\"[^>]+\">".r.replaceAllIn(inputStr, {_.replace(">", "/>")}) Full stack: Exception in thread "AWT-EventQueue-0" java.lang.NoSuchMethodError: scala.util.matching.Regex.replaceAllIn(Ljava/lang/CharSequence;Lscala/Function1;)Ljava/lang/String; at com.inosat.fuel.FuelStationDgge.fixhtml(FuelStationDgge.scala:40) at com.inosat.fuel.FuelStationDgge.setDetails(FuelStationDgge.scala:82) at com.inosat.fuel.DggeParser$$anon$1.propertyChange(DggeParser.scala:49) at java.beans.PropertyChangeSupport.firePropertyChange(Unknown Source) at java.beans.PropertyChangeSupport.firePropertyChange(Unknown Source) at java.beans.PropertyChangeSupport.firePropertyChange(Unknown Source) at org.jdesktop.beans.AbstractBean.firePropertyChange(AbstractBean.java:302) at org.jdesktop.http.async.AsyncHttpRequest.setReadyState(AsyncHttpRequest.java:705) at org.jdesktop.http.async.AsyncHttpRequest.access$600(AsyncHttpRequest.java:79) at org.jdesktop.http.async.AsyncHttpRequest$AsyncWorker.done(AsyncHttpRequest.java:831) at javax.swing.SwingWorker$5.run(Unknown Source) at javax.swing.SwingWorker$DoSubmitAccumulativeRunnable.run(Unknown Source) at sun.swing.AccumulativeRunnable.run(Unknown Source) at javax.swing.SwingWorker$DoSubmitAccumulativeRunnable.actionPerformed(Unknown Source) at javax.swing.Timer.fireActionPerformed(Unknown Source) at javax.swing.Timer$DoPostEvent.run(Unknown Source) at java.awt.event.InvocationEvent.dispatch(Unknown Source) at java.awt.EventQueue.dispatchEvent(Unknown Source) at java.awt.EventDispatchThread.pumpOneEventForFilters(Unknown Source) at java.awt.EventDispatchThread.pumpEventsForFilter(Unknown Source) at java.awt.EventDispatchThread.pumpEventsForHierarchy(Unknown Source) at java.awt.EventDispatchThread.pumpEvents(Unknown Source) at java.awt.EventDispatchThread.pumpEvents(Unknown Source) at java.awt.EventDispatchThread.run(Unknown Source)

    Read the article

  • spoj: runlength

    - by user285825
    For RLM problem of SPOJ: This is the problem: "Run-length encoding of a number replaces a run of digits (that is, a sequence of consecutive equivalent digits) with the number of digits followed by the digit itself. For example, 44455 would become 3425 (three fours, two fives). Note that run-length encoding does not necessarily shorten the length of the data: 11 becomes 21, and 42 becomes 1412. If a number has more than nine consecutive digits of the same type, the encoding is done greedily: each run grabs as many digits as it can, so 111111111111111 is encoded as 9161. Implement an integer arithmetic calculator that takes operands and gives results in run-length format. You should support addition, subtraction, multiplication, and division. You won't have to divide by zero or deal with negative numbers. Input/Output The input will consist of several test cases, one per line. For each test case, compute the run-length mathematics expression and output the original expression and the result, as shown in the examples. The (decimal) representation of all operands and results will fit in signed 64-bit integers." These are my testcases: input: 11 + 11 988726 - 978625 12 * 41 1124 / 1112 13 * 33 15 / 16 19222317121013161815142715181017 + 10 10 + 19222317121013161815142715181017 19222317121013161815142715181017 / 19222317121013161815142715181017 19222317121013161815142715181017 / 11 11 / 19222317121013161815142715181017 19222317121013161815142715181017 / 12 12 / 19222317121013161815142715181017 19222317121013161815142715181017 / 141621161816101118141217131817191014 141621161816101118141217131817191014 / 19222317121013161815142715181017 19222317121013161815142715181017 / 141621161816101118141217131817191013 141621161816101118141217131817191013 / 19222317121013161815142715181017 19222317121013161815142715181017 * 11 11 * 19222317121013161815142715181017 19222317121013161815142715181017 * 10 10 * 19222317121013161815142715181017 19222317121013161815142715181017 - 10 19222317121013161815142715181017 - 19222317121013161815142715181017 19222317121013161815142715181017 - 141621161816101118141217131817191014 19222317121013161815142715181017 - 141621161816101118141217131817191013 141621161816101118141217131817191013 + 141621161816101118141217131817191013 141621161816101118141217131817191013 + 141621161816101118141217131817191014 141621161816101118141217131817191014 + 141621161816101118141217131817191013 141621161816101118141217131817191014 + 10 10 + 141621161816101118141217131817191013 141621161816101118141217131817191013 + 11 11 + 141621161816101118141217131817191013 141621161816101118141217131817191013 * 12 12 * 141621161816101118141217131817191013 141621161816101118141217131817191014 - 141621161816101118141217131817191014 141621161816101118141217131817191013 - 141621161816101118141217131817191013 141621161816101118141217131817191013 - 10 141621161816101118141217131817191014 - 11 141621161816101118141217131817191014 - 141621161816101118141217131817191013 141621161816101118141217131817191014 / 141621161816101118141217131817191014 141621161816101118141217131817191014 / 141621161816101118141217131817191013 141621161816101118141217131817191013 / 141621161816101118141217131817191014 141621161816101118141217131817191013 / 141621161816101118141217131817191013 141621161816101118141217131817191014 * 11 11 * 141621161816101118141217131817191014 141621161816101118141217131817191014 / 11 11 / 141621161816101118141217131817191014 10 + 10 10 + 11 10 + 15 15 + 10 11 + 10 11 + 10 10 - 10 15 - 10 10 * 10 10 * 15 15 * 10 10 / 111213 output: 11 + 11 = 12 988726 - 978625 = 919111 12 * 41 = 42 1124 / 1112 = 1112 13 * 33 = 39 15 / 16 = 10 19222317121013161815142715181017 + 10 = 19222317121013161815142715181017 10 + 19222317121013161815142715181017 = 19222317121013161815142715181017 19222317121013161815142715181017 / 19222317121013161815142715181017 = 11 19222317121013161815142715181017 / 11 = 19222317121013161815142715181017 11 / 19222317121013161815142715181017 = 10 19222317121013161815142715181017 / 12 = 141621161816101118141217131817191013 12 / 19222317121013161815142715181017 = 10 19222317121013161815142715181017 / 141621161816101118141217131817191014 = 11 141621161816101118141217131817191014 / 19222317121013161815142715181017 = 10 19222317121013161815142715181017 / 141621161816101118141217131817191013 = 12 141621161816101118141217131817191013 / 19222317121013161815142715181017 = 10 19222317121013161815142715181017 * 11 = 19222317121013161815142715181017 11 * 19222317121013161815142715181017 = 19222317121013161815142715181017 19222317121013161815142715181017 * 10 = 10 10 * 19222317121013161815142715181017 = 10 19222317121013161815142715181017 - 10 = 19222317121013161815142715181017 19222317121013161815142715181017 - 19222317121013161815142715181017 = 10 19222317121013161815142715181017 - 141621161816101118141217131817191014 = 141621161816101118141217131817191013 19222317121013161815142715181017 - 141621161816101118141217131817191013 = 141621161816101118141217131817191014 141621161816101118141217131817191013 + 141621161816101118141217131817191013 = 19222317121013161815142715181016 141621161816101118141217131817191013 + 141621161816101118141217131817191014 = 19222317121013161815142715181017 141621161816101118141217131817191014 + 141621161816101118141217131817191013 = 19222317121013161815142715181017 141621161816101118141217131817191014 + 10 = 141621161816101118141217131817191014 10 + 141621161816101118141217131817191013 = 141621161816101118141217131817191013 141621161816101118141217131817191013 + 11 = 141621161816101118141217131817191014 11 + 141621161816101118141217131817191013 = 141621161816101118141217131817191014 141621161816101118141217131817191013 * 12 = 19222317121013161815142715181016 12 * 141621161816101118141217131817191013 = 19222317121013161815142715181016 141621161816101118141217131817191014 - 141621161816101118141217131817191014 = 10 141621161816101118141217131817191013 - 141621161816101118141217131817191013 = 10 141621161816101118141217131817191013 - 10 = 141621161816101118141217131817191013 141621161816101118141217131817191014 - 11 = 141621161816101118141217131817191013 141621161816101118141217131817191014 - 141621161816101118141217131817191013 = 11 141621161816101118141217131817191014 / 141621161816101118141217131817191014 = 11 141621161816101118141217131817191014 / 141621161816101118141217131817191013 = 11 141621161816101118141217131817191013 / 141621161816101118141217131817191014 = 10 141621161816101118141217131817191013 / 141621161816101118141217131817191013 = 11 141621161816101118141217131817191014 * 11 = 141621161816101118141217131817191014 11 * 141621161816101118141217131817191014 = 141621161816101118141217131817191014 141621161816101118141217131817191014 / 11 = 141621161816101118141217131817191014 11 / 141621161816101118141217131817191014 = 10 10 + 10 = 10 10 + 11 = 11 10 + 15 = 15 15 + 10 = 15 11 + 10 = 11 11 + 10 = 11 10 - 10 = 10 15 - 10 = 15 10 * 10 = 10 10 * 15 = 10 15 * 10 = 10 10 / 111213 = 10 I am getting consistently wrong answer. I generated the above testcases trying to make them as representative as possible (boundary conditions, etc). I am not sure how to test it further. Some guidline would be really appreciated.

    Read the article

  • Bacula windows client could not connect to Bacula director

    - by pr0f-r00t
    I have a Bacula server on my Linux Debian squeeze host (Bacula version 5.0.2) and a Bacula client on Windows XP SP3. On my network each client can see each other, can share files and can ping. On my local server I could run bconsole and the server responds but when I run bconsole or bat on my windows client the server does not respond. Here are my configuration files: bacula-dir.conf: # # Default Bacula Director Configuration file # # The only thing that MUST be changed is to add one or more # file or directory names in the Include directive of the # FileSet resource. # # For Bacula release 5.0.2 (28 April 2010) -- debian squeeze/sid # # You might also want to change the default email address # from root to your address. See the "mail" and "operator" # directives in the Messages resource. # Director { # define myself Name = nima-desktop-dir DIRport = 9101 # where we listen for UA connections QueryFile = "/etc/bacula/scripts/query.sql" WorkingDirectory = "/var/lib/bacula" PidDirectory = "/var/run/bacula" Maximum Concurrent Jobs = 1 Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" # Console password Messages = Daemon DirAddress = 127.0.0.1 # DirAddress = 72.16.208.1 } JobDefs { Name = "DefaultJob" Type = Backup Level = Incremental Client = nima-desktop-fd FileSet = "Full Set" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = File Priority = 10 Write Bootstrap = "/var/lib/bacula/%c.bsr" } # # Define the main nightly save backup job # By default, this job will back up to disk in /nonexistant/path/to/file/archive/dir Job { Name = "BackupClient1" JobDefs = "DefaultJob" } #Job { # Name = "BackupClient2" # Client = nima-desktop2-fd # JobDefs = "DefaultJob" #} # Backup the catalog database (after the nightly save) Job { Name = "BackupCatalog" JobDefs = "DefaultJob" Level = Full FileSet="Catalog" Schedule = "WeeklyCycleAfterBackup" # This creates an ASCII copy of the catalog # Arguments to make_catalog_backup.pl are: # make_catalog_backup.pl <catalog-name> RunBeforeJob = "/etc/bacula/scripts/make_catalog_backup.pl MyCatalog" # This deletes the copy of the catalog RunAfterJob = "/etc/bacula/scripts/delete_catalog_backup" Write Bootstrap = "/var/lib/bacula/%n.bsr" Priority = 11 # run after main backup } # # Standard Restore template, to be changed by Console program # Only one such job is needed for all Jobs/Clients/Storage ... # Job { Name = "RestoreFiles" Type = Restore Client=nima-desktop-fd FileSet="Full Set" Storage = File Pool = Default Messages = Standard Where = /nonexistant/path/to/file/archive/dir/bacula-restores } # job for vmware windows host Job { Name = "nimaxp-fd" Type = Backup Client = nimaxp-fd FileSet = "nimaxp-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # job for vmware windows host Job { Name = "arg-michael-fd" Type = Backup Client = nimaxp-fd FileSet = "arg-michael-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # List of files to be backed up FileSet { Name = "Full Set" Include { Options { signature = MD5 } # # Put your list of files here, preceded by 'File =', one per line # or include an external list with: # # File = <file-name # # Note: / backs up everything on the root partition. # if you have other partitions such as /usr or /home # you will probably want to add them too. # # By default this is defined to point to the Bacula binary # directory to give a reasonable FileSet to backup to # disk storage during initial testing. # File = /usr/sbin } # # If you backup the root directory, the following two excluded # files can be useful # Exclude { File = /var/lib/bacula File = /nonexistant/path/to/file/archive/dir File = /proc File = /tmp File = /.journal File = /.fsck } } # List of files to be backed up FileSet { Name = "nimaxp-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # List of files to be backed up FileSet { Name = "arg-michael-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # # When to do the backups, full backup on first sunday of the month, # differential (i.e. incremental since full) every other sunday, # and incremental backups other days Schedule { Name = "WeeklyCycle" Run = Full 1st sun at 23:05 Run = Differential 2nd-5th sun at 23:05 Run = Incremental mon-sat at 23:05 } # This schedule does the catalog. It starts after the WeeklyCycle Schedule { Name = "WeeklyCycleAfterBackup" Run = Full sun-sat at 23:10 } # This is the backup of the catalog FileSet { Name = "Catalog" Include { Options { signature = MD5 } File = "/var/lib/bacula/bacula.sql" } } # Client (File Services) to backup Client { Name = nima-desktop-fd Address = localhost FDPort = 9102 Catalog = MyCatalog Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V6" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = nimaxp-fd Address = nimaxp FDPort = 9102 Catalog = MyCatalog Password = "Ku8F1YAhDz5EMUQjiC9CcSw95Aho9XbXailUmjOaAXJP" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = arg-michael-fd Address = 192.168.0.61 FDPort = 9102 Catalog = MyCatalog Password = "b4E9FU6s/9Zm4BVFFnbXVKhlyd/zWxj0oWITKK6CALR/" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # # Second Client (File Services) to backup # You should change Name, Address, and Password before using # #Client { # Name = nima-desktop2-fd # Address = localhost2 # FDPort = 9102 # Catalog = MyCatalog # Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V62" # password for FileDaemon 2 # File Retention = 30 days # 30 days # Job Retention = 6 months # six months # AutoPrune = yes # Prune expired Jobs/Files #} # Definition of file storage device Storage { Name = File # Do not use "localhost" here Address = localhost # N.B. Use a fully qualified name here SDPort = 9103 Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" Device = FileStorage Media Type = File } # Definition of DDS tape storage device #Storage { # Name = DDS-4 # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # password for Storage daemon # Device = DDS-4 # must be same as Device in Storage daemon # Media Type = DDS-4 # must be same as MediaType in Storage daemon # Autochanger = yes # enable for autochanger device #} # Definition of 8mm tape storage device #Storage { # Name = "8mmDrive" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "Exabyte 8mm" # MediaType = "8mm" #} # Definition of DVD storage device #Storage { # Name = "DVD" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "DVD Writer" # MediaType = "DVD" #} # Generic catalog service Catalog { Name = MyCatalog # Uncomment the following line if you want the dbi driver # dbdriver = "dbi:sqlite3"; dbaddress = 127.0.0.1; dbport = dbname = "bacula"; dbuser = ""; dbpassword = "" } # Reasonable message delivery -- send most everything to email address # and to the console Messages { Name = Standard # # NOTE! If you send to two email or more email addresses, you will need # to replace the %r in the from field (-f part) with a single valid # email address in both the mailcommand and the operatorcommand. # What this does is, it sets the email address that emails would display # in the FROM field, which is by default the same email as they're being # sent to. However, if you send email to more than one address, then # you'll have to set the FROM address manually, to a single address. # for example, a '[email protected]', is better since that tends to # tell (most) people that its coming from an automated source. # mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: %t %e of %c %l\" %r" operatorcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: Intervention needed for %j\" %r" mail = root@localhost = all, !skipped operator = root@localhost = mount console = all, !skipped, !saved # # WARNING! the following will create a file that you must cycle from # time to time as it will grow indefinitely. However, it will # also keep all your messages if they scroll off the console. # append = "/var/lib/bacula/log" = all, !skipped catalog = all } # # Message delivery for daemon messages (no job). Messages { Name = Daemon mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula daemon message\" %r" mail = root@localhost = all, !skipped console = all, !skipped, !saved append = "/var/lib/bacula/log" = all, !skipped } # Default pool definition Pool { Name = Default Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year } # File Pool definition Pool { Name = File Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year Maximum Volume Bytes = 50G # Limit Volume size to something reasonable Maximum Volumes = 100 # Limit number of Volumes in Pool } # Scratch pool definition Pool { Name = Scratch Pool Type = Backup } # # Restricted console used by tray-monitor to get the status of the director # Console { Name = nima-desktop-mon Password = "-T0h6HCXWYNy0wWqOomysMvRGflQ_TA6c" CommandACL = status, .status } bacula-fd.conf on client: # # Default Bacula File Daemon Configuration file # # For Bacula release 5.0.3 (08/05/10) -- Windows MinGW32 # # There is not much to change here except perhaps the # File daemon Name # # # "Global" File daemon configuration specifications # FileDaemon { # this is me Name = nimaxp-fd FDport = 9102 # where we listen for the director WorkingDirectory = "C:\\Program Files\\Bacula\\working" Pid Directory = "C:\\Program Files\\Bacula\\working" # Plugin Directory = "C:\\Program Files\\Bacula\\plugins" Maximum Concurrent Jobs = 10 } # # List Directors who are permitted to contact this File daemon # Director { Name = Nima-desktop-dir Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" } # # Restricted Director, used by tray-monitor to get the # status of the file daemon # Director { Name = nimaxp-mon Password = "q5b5g+LkzDXorMViFwOn1/TUnjUyDlg+gRTBp236GrU3" Monitor = yes } # Send all messages except skipped files back to Director Messages { Name = Standard director = Nima-desktop = all, !skipped, !restored } I have checked my firewall and disabled the firewall but it doesn't work.

    Read the article

  • Overwrite archetypes in Maven

    - by Random
    Hello again! I'm having some trouble using Maven for my archetypes and I will need to overwrite some. I launch an instruction that does an archetype:generate in an archetype already existing directory. Is there a parameter that let's me overwrite existing archetypes? I have search the maven definitve guide but it states that the only parameters accepted are: -DgroupId -DartifactId -Dversion -DpackageName -DarchetypeGroupId -DarchetypeArtifactId -DarchetypeVersion -DinteractiveMode I could just search the directory and delete the files, but this proccess is going to be done automatically (so no human involved, no brains involved) and I wouldn't like he machine deleting things around. Thanks for all! Edit: I almost forgot, here is some maven trace: [INFO] Scanning for projects... [INFO] Searching repository for plugin with prefix: 'archetype'. [INFO] ------------------------------------------------------------------------ [INFO] Building Maven Default Project [INFO] task-segment: [archetype:generate] (aggregator-style) [INFO] ------------------------------------------------------------------------ [INFO] Preparing archetype:generate [INFO] No goals needed for project - skipping [INFO] Setting property: classpath.resource.loader.class => 'org.codehaus.plexus.velocity.ContextClassLoaderResourceLoader'. [INFO] Setting property: velocimacro.messages.on => 'false'. [INFO] Setting property: resource.loader => 'classpath'. [INFO] Setting property: resource.manager.logwhenfound => 'false'. [INFO] [archetype:generate {execution: default-cli}] [INFO] Generating project in Batch mode [INFO] Archetype defined by properties [INFO] ---------------------------------------------------------------------------- [INFO] Using following parameters for creating OldArchetype: archetype-foo-lib:1.0 [INFO] ---------------------------------------------------------------------------- [INFO] Parameter: groupId, Value: foo.tecnologia [INFO] Parameter: packageName, Value: foo.tecnologia [INFO] Parameter: basedir, Value: C:\temp\Desarrollo [INFO] Parameter: package, Value: foo.tecnologia [INFO] Parameter: version, Value: 1.0 [INFO] Parameter: artifactId, Value: Foo-Lib-Test [ERROR] Directory Foo-Lib-Test already exists - please run from a clean directory org.apache.maven.archetype.old.ArchetypeTemplateProcessingException: Directory Foo-Lib-Test already exists - please run from a clean directory at org.apache.maven.archetype.old.DefaultOldArchetype.createArchetype(DefaultOldArchetype.java:242) at org.apache.maven.archetype.generator.DefaultArchetypeGenerator.processOldArchetype(DefaultArchetypeGenerator.java:253) at org.apache.maven.archetype.generator.DefaultArchetypeGenerator.generateArchetype(DefaultArchetypeGenerator.java:143) at org.apache.maven.archetype.generator.DefaultArchetypeGenerator.generateArchetype(DefaultArchetypeGenerator.java:286) at org.apache.maven.archetype.DefaultArchetype.generateProjectFromArchetype(DefaultArchetype.java:69) at org.apache.maven.archetype.mojos.CreateProjectFromArchetypeMojo.execute(CreateProjectFromArchetypeMojo.java:184) at org.apache.maven.plugin.DefaultPluginManager.executeMojo(DefaultPluginManager.java:490) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:694) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeStandaloneGoal(DefaultLifecycleExecutor.java:569) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoal(DefaultLifecycleExecutor.java:539) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalAndHandleFailures(DefaultLifecycleExecutor.java:387) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeTaskSegments(DefaultLifecycleExecutor.java:284) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.execute(DefaultLifecycleExecutor.java:180) at org.apache.maven.DefaultMaven.doExecute(DefaultMaven.java:328) at org.apache.maven.DefaultMaven.execute(DefaultMaven.java:138) at com.foo.model.CSMavenCli.main(CSMavenCli.java:391) at com.foo.model.MavenAdmin.generateArchetype(MavenAdmin.java:399) at com.foo.model.ValidarPom.validarPom(ValidarPom.java:167) at com.foo.prueba.GenerarPOM.execute(GenerarPOM.java:93) at org.apache.struts.chain.commands.servlet.ExecuteAction.execute(ExecuteAction.java:58) at org.apache.struts.chain.commands.AbstractExecuteAction.execute(AbstractExecuteAction.java:67) at org.apache.struts.chain.commands.ActionCommandBase.execute(ActionCommandBase.java:51) at org.apache.commons.chain.impl.ChainBase.execute(ChainBase.java:191) at org.apache.commons.chain.generic.LookupCommand.execute(LookupCommand.java:305) at org.apache.commons.chain.impl.ChainBase.execute(ChainBase.java:191) at org.apache.struts.chain.ComposableRequestProcessor.process(ComposableRequestProcessor.java:283) at org.apache.struts.action.ActionServlet.process(ActionServlet.java:1913) at org.apache.struts.action.ActionServlet.doPost(ActionServlet.java:462) at javax.servlet.http.HttpServlet.service(HttpServlet.java:647) at javax.servlet.http.HttpServlet.service(HttpServlet.java:729) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:269) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:188) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:172) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:127) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:117) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:108) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:174) at org.apache.coyote.http11.Http11Processor.process(Http11Processor.java:873) at org.apache.coyote.http11.Http11BaseProtocol$Http11ConnectionHandler.processConnection(Http11BaseProtocol.java:665) at org.apache.tomcat.util.net.PoolTcpEndpoint.processSocket(PoolTcpEndpoint.java:528) at org.apache.tomcat.util.net.LeaderFollowerWorkerThread.runIt(LeaderFollowerWorkerThread.java:81) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:689) at java.lang.Thread.run(Unknown Source) [INFO] ------------------------------------------------------------------------ [ERROR] BUILD FAILURE [INFO] ------------------------------------------------------------------------ [INFO] : org.apache.maven.archetype.old.ArchetypeTemplateProcessingException: Directory Foo-Lib-Test already exists - please run from a clean directory Directory Foo-Lib-Test already exists - please run from a clean directory [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: 1 second [INFO] Finished at: Fri Apr 09 10:01:33 CEST 2010 [INFO] Final Memory: 15M/28M [INFO] ------------------------------------------------------------------------

    Read the article

  • Wicket testing - AnnotApplicationContextMock - There is no application attached to current thread ma

    - by John
    I've written a couple of tests for a small web app, but I get an error when I try to run the page specific tests that makes use of WicketTester. Google sends me to a mailing list for Apache Wicket, where a user experienced the same exception. He/she said the problem was that AnnotApplicationContextMock was initialized before the Wicket Application. I've pasted my WicketApplication class as well. Has any of you dealt with this error before? I've pasted the exception and the class below. Exception: ------------------------------------------------------------------------------- Test set: com.upbeat.shoutbox.web.TestViewShoutsPage ------------------------------------------------------------------------------- Tests run: 1, Failures: 0, Errors: 1, Skipped: 0, Time elapsed: 1.545 sec (AnnotApplicationContextMock.java:61) at com.upbeat.shoutbox.web.TestViewShoutsPage.setUp(TestViewShoutsPage.java:30) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.junit.internal.runners.MethodRoadie.runBefores(MethodRoadie.java:129) at org.junit.internal.runners.MethodRoadie.runBeforesThenTestThenAfters(MethodRoadie.java:93) at org.unitils.UnitilsJUnit4TestClassRunner$CustomMethodRoadie.runBeforesThenTestThenAfters(UnitilsJUnit4TestClassRunner.java:168) at org.junit.internal.runners.MethodRoadie.runTest(MethodRoadie.java:84) at org.junit.internal.runners.MethodRoadie.run(MethodRoadie.java:49) at org.unitils.UnitilsJUnit4TestClassRunner.invokeTestMethod(UnitilsJUnit4TestClassRunner.java:127) at org.junit.internal.runners.JUnit4ClassRunner.runMethods(JUnit4ClassRunner.java:59) at org.unitils.UnitilsJUnit4TestClassRunner.access$000(UnitilsJUnit4TestClassRunner.java:42) at org.unitils.UnitilsJUnit4TestClassRunner$1.run(UnitilsJUnit4TestClassRunner.java:87) at org.junit.internal.runners.ClassRoadie.runUnprotected(ClassRoadie.java:34) at org.junit.internal.runners.ClassRoadie.runProtected(ClassRoadie.java:44) at org.unitils.UnitilsJUnit4TestClassRunner.run(UnitilsJUnit4TestClassRunner.java:94) at org.apache.maven.surefire.junit4.JUnit4TestSet.execute(JUnit4TestSet.java:62) at org.apache.maven.surefire.suite.AbstractDirectoryTestSuite.executeTestSet(AbstractDirectoryTestSuite.java:140) at org.apache.maven.surefire.suite.AbstractDirectoryTestSuite.execute(AbstractDirectoryTestSuite.java:127) at org.apache.maven.surefire.Surefire.run(Surefire.java:177) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.maven.surefire.booter.SurefireBooter.runSuitesInProcess(SurefireBooter.java:345) at org.apache.maven.surefire.booter.SurefireBooter.main(SurefireBooter.java:1009) My page specific test class: package com.upbeat.shoutbox.web; import org.apache.wicket.application.IComponentInstantiationListener; import org.apache.wicket.protocol.http.WebApplication; import org.apache.wicket.spring.injection.annot.SpringComponentInjector; import org.apache.wicket.spring.injection.annot.test.AnnotApplicationContextMock; import org.apache.wicket.util.tester.FormTester; import org.apache.wicket.util.tester.WicketTester; import org.junit.Before; import org.junit.Test; import org.unitils.spring.annotation.SpringBeanByType; import com.upbeat.shoutbox.WicketApplication; import com.upbeat.shoutbox.integrations.AbstractIntegrationTest; import com.upbeat.shoutbox.persistence.ShoutItemDao; import com.upbeat.shoutbox.services.ShoutService; import com.upbeat.shoutbox.web.pages.ViewShoutsPage; public class TestViewShoutsPage extends AbstractIntegrationTest { @SpringBeanByType private ShoutService svc; @SpringBeanByType private ShoutItemDao dao; protected WicketTester tester; @Before public void setUp() { final AnnotApplicationContextMock appctx = new AnnotApplicationContextMock(); appctx.putBean("ShoutItemDao", dao); appctx.putBean("ShoutService", svc); tester = new WicketTester(new WicketApplication() { @Override protected IComponentInstantiationListener getSpringComponentInjector(WebApplication app) { return new SpringComponentInjector(app, appctx, false); } }); } @Test public void testRenderPage() { tester.startPage(ViewShoutsPage.class); tester.assertRenderedPage(ViewShoutsPage.class); FormTester ft = tester.newFormTester("addShoutForm"); ft.setValue("nickname", "test-nickname"); ft.setValue("content", "a whole lot of content"); ft.submit(); tester.assertRenderedPage(ViewShoutsPage.class); tester.assertContains("test-nickname"); tester.assertContains("a whole lot of content"); } } AbstractIntegrationTest: package com.upbeat.shoutbox.integrations; import org.springframework.context.ApplicationContext; import org.unitils.UnitilsJUnit4; import org.unitils.spring.annotation.SpringApplicationContext; @SpringApplicationContext({"/com/upbeat/shoutbox/spring/applicationContext.xml", "applicationContext-test.xml"}) public abstract class AbstractIntegrationTest extends UnitilsJUnit4 { private ApplicationContext applicationContext; } WicketApplication: package com.upbeat.shoutbox; import org.apache.wicket.application.IComponentInstantiationListener; import org.apache.wicket.protocol.http.WebApplication; import org.apache.wicket.request.target.coding.IndexedParamUrlCodingStrategy; import org.apache.wicket.spring.injection.annot.SpringComponentInjector; import com.upbeat.shoutbox.web.pages.ParamPage; import com.upbeat.shoutbox.web.pages.VeryNiceExceptionPage; /** * Application object for your web application. If you want to run this application without deploying, run the Start class. * * @see com.upbeat.shoutbox.Start#main(String[]) */ public class WicketApplication extends WebApplication { /** * Constructor */ public WicketApplication() { } /** * @see org.apache.wicket.Application#getHomePage() */ public Class getHomePage() { return HomePage.class; } @Override protected void init() { super.init(); // Enable wicket ajax debug getDebugSettings().setAjaxDebugModeEnabled(true); addComponentInstantiationListener(getSpringComponentInjector(this)); // Mount pages mountBookmarkablePage("/home", HomePage.class); mountBookmarkablePage("/exceptionPage", VeryNiceExceptionPage.class); mount(new IndexedParamUrlCodingStrategy("/view_params", ParamPage.class)); } protected IComponentInstantiationListener getSpringComponentInjector(WebApplication app) { return new SpringComponentInjector(app); } }

    Read the article

  • Neon toolkit and Gate Web Service

    - by blueomega
    I am trying to run any of the services from gate web service, in neon 2.3. Even Annie that runs so well in gate doesn't run, or better, it stay for indefinite time processing, a thing that should take no more than a couple of seconds. I run wizard, set input directory, leave file pattern as default and set a folder and name for the output ontology, shouldn't it be enough? Shouldn't i get something, even an error? I think its the location who's giving me problems. http://safekeeper1.dcs.shef.ac.uk/neon/services/sardine http://safekeeper1.dcs.shef.ac.uk/neon/services/sprat http://safekeeper1.dcs.shef.ac.uk/neon/services/annie http://safekeeper1.dcs.shef.ac.uk/neon/services/termraider How can i confirm it? Can i run it offline? Can anyone give me a hand? Also, i've seen sprat running on gate, on "SPRAT: a tool for automatic semantic pattern-based ontology population" Can anyone teach me how, and with what versions? Thx, Celso Costa

    Read the article

  • Call private methods and private properties from outside a class in PHP

    - by Pablo López Torres
    I want to access private methods and variables from outside the classes in very rare specific cases. I've seen that this is not be possible although introspection is used. The specific case is the next one: I would like to have something like this: class Console { final public static function run() { while (TRUE != FALSE) { echo "\n> "; $command = trim(fgets(STDIN)); switch ($command) { case 'exit': case 'q': case 'quit': echo "OK+\n"; return; default: ob_start(); eval($command); $out = ob_get_contents(); ob_end_clean(); print("Command: $command"); print("Output:\n$out"); break; } } } } This method should be able to be injected in the code like this: Class Demo { private $a; final public function myMethod() { // some code Console::run(); // some other code } final public function myPublicMethod() { return "I can run through eval()"; } private function myPrivateMethod() { return "I cannot run through eval()"; } } (this is just one simplification. the real one goes through a socket, and implement a bunch of more things...) So... If you instantiate the class Demo and you call $demo-myMethod(), you'll get a console: that console can access the first method writing a command like: > $this->myPublicMethod(); But you cannot run successfully the second one: > $this->myPrivateMethod(); Do any of you have any idea, or if there is any library for PHP that allows you to do this? Thanks a lot!

    Read the article

  • Select and Insert across dblink

    - by Domtar
    I am having a bit of trouble with a select into insert across a dblink in oracle 10. I am using the following statement: INSERT INTO LOCAL.TABLE_1 ( COL1, COL2) SELECT COL1, COL2 FROM REMOTE.TABLE1@dblink s WHERE COL1 IN ( SELECT COL1 FROM WORKING_TABLE) When I run the statement the following is what gets run against the remote server on the DB Link: SELECT /*+ OPAQUE_TRANSFORM */ "COL1", "COL2" FROM "REMOTE"."TABLE1" "S" If I run the select only and do not do the insert into the following is run: SELECT /*+ */ "A1"."COL1" , "A1"."COL2" FROM "REMOTE"."TABLE1" "A1" WHERE "A1"."COL1" = ANY ( SELECT "A2"."COL1" FROM "LOCAL"."TABLE1"@! "A2") The issue is in the insert case the enitre table is being pulled across the dblink and then limited localy which takes a fair bit of time given the table size. Is there any reason adding the insert would change the behavior in this manner?

    Read the article

  • Hudson + Jboss AS 7.1 + Maven 3 Project Build Error

    - by Zehra Gül Çabuk
    I've wanted to prepare an environment that I'm able to build my project and run my tests on a integration server. So I've installed an Jboss application server 7.1 and deployed hudson.war to it. Then I've created a project to trigger "mvn clean install" and when I built it I've got following exception. [INFO] Using bundled Maven 3 installation [INFO] Checking Maven 3 installation environment [workspace] $ /disk7/hudson_home/maven/slavebundle/bundled-maven/bin/mvn --help [INFO] Checking Maven 3 installation version [INFO] Detected Maven 3 installation version: 3.0.3 [workspace] $ /disk7/hudson_home/maven/slavebundle/bundled-maven/bin/mvn clean install -V -B -Dmaven.ext.class.path=/disk7/hudson_home/maven/slavebundle/resources:/disk7/hudson_home/maven/slavebundle/lib/maven3-eventspy-3.0.jar:/disk7/jboss-as-7.1.0.Final/standalone/tmp/vfs/deploymentdf2a6dfa59ee3407/hudson-remoting-2.2.0.jar-407215e5de02980f/contents -Dhudson.eventspy.port=37183 -f pom.xml [DEBUG] Waiting for connection on port: 37183 Apache Maven 3.0.3 (r1075438; 2011-02-28 19:31:09+0200) Maven home: /disk7/hudson_home/maven/slavebundle/bundled-maven Java version: 1.7.0_04, vendor: Oracle Corporation Java home: /usr/lib/jvm/jdk1.7.0_04/jre Default locale: en_US, platform encoding: UTF-8 OS name: "linux", version: "3.2.0-24-generic", arch: "amd64", family: "unix" [ERROR] o.h.m.e.DelegatingEventSpy - Init failed java.lang.NoClassDefFoundError: hudson/remoting/Channel at org.hudsonci.maven.eventspy.common.RemotingClient.open(RemotingClient.java:103) ~[maven3-eventspy-runtime.jar:na] at org.hudsonci.maven.eventspy_30.RemotingEventSpy.openChannel(RemotingEventSpy.java:86) ~[maven3-eventspy-3.0.jar:na] at org.hudsonci.maven.eventspy_30.RemotingEventSpy.init(RemotingEventSpy.java:114) ~[maven3-eventspy-3.0.jar:na] at org.hudsonci.maven.eventspy_30.DelegatingEventSpy.init(DelegatingEventSpy.java:128) ~[maven3-eventspy-3.0.jar:na] at org.apache.maven.eventspy.internal.EventSpyDispatcher.init(EventSpyDispatcher.java:84) [maven-core-3.0.3.jar:3.0.3] at org.apache.maven.cli.MavenCli.container(MavenCli.java:403) [maven-embedder-3.0.3.jar:3.0.3] at org.apache.maven.cli.MavenCli.doMain(MavenCli.java:191) [maven-embedder-3.0.3.jar:3.0.3] at org.apache.maven.cli.MavenCli.main(MavenCli.java:141) [maven-embedder-3.0.3.jar:3.0.3] at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) ~[na:1.7.0_04] at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) ~[na:1.7.0_04] at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) ~[na:1.7.0_04] at java.lang.reflect.Method.invoke(Method.java:601) ~[na:1.7.0_04] at org.codehaus.plexus.classworlds.launcher.Launcher.launchEnhanced(Launcher.java:290) [plexus-classworlds-2.4.jar:na] at org.codehaus.plexus.classworlds.launcher.Launcher.launch(Launcher.java:230) [plexus-classworlds-2.4.jar:na] at org.codehaus.plexus.classworlds.launcher.Launcher.mainWithExitCode(Launcher.java:409) [plexus-classworlds-2.4.jar:na] at org.codehaus.plexus.classworlds.launcher.Launcher.main(Launcher.java:352) [plexus-classworlds-2.4.jar:na] Caused by: java.lang.ClassNotFoundException: hudson.remoting.Channel at org.codehaus.plexus.classworlds.strategy.SelfFirstStrategy.loadClass(SelfFirstStrategy.java:50) ~[plexus-classworlds-2.4.jar:na] at org.codehaus.plexus.classworlds.realm.ClassRealm.loadClass(ClassRealm.java:244) ~[plexus-classworlds-2.4.jar:na] at org.codehaus.plexus.classworlds.realm.ClassRealm.loadClass(ClassRealm.java:230) ~[plexus-classworlds-2.4.jar:na] ... 16 common frames omitted [ERROR] ABORTED [ERROR] Failed to initialize [ERROR] Caused by: hudson/remoting/Channel [ERROR] Caused by: hudson.remoting.Channel [ERROR] Failure: java.net.SocketException: Connection reset FATAL: Connection reset java.net.SocketException: Connection reset at java.net.SocketInputStream.read(SocketInputStream.java:189) at java.net.SocketInputStream.read(SocketInputStream.java:121) at java.io.FilterInputStream.read(FilterInputStream.java:133) at java.io.BufferedInputStream.fill(BufferedInputStream.java:235) at java.io.BufferedInputStream.read(BufferedInputStream.java:254) at hudson.remoting.Channel.<init>(Channel.java:385) at hudson.remoting.Channel.<init>(Channel.java:347) at hudson.remoting.Channel.<init>(Channel.java:320) at hudson.remoting.Channel.<init>(Channel.java:315) at hudson.slaves.Channels$1.<init>(Channels.java:71) at hudson.slaves.Channels.forProcess(Channels.java:71) at org.hudsonci.maven.plugin.builder.internal.PerformBuild.doExecute(PerformBuild.java:174) at org.hudsonci.utils.tasks.PerformOperation.execute(PerformOperation.java:58) at org.hudsonci.maven.plugin.builder.MavenBuilder.perform(MavenBuilder.java:169) at hudson.tasks.BuildStepMonitor$1.perform(BuildStepMonitor.java:19) at hudson.model.AbstractBuild$AbstractRunner.perform(AbstractBuild.java:630) at hudson.model.Build$RunnerImpl.build(Build.java:175) at hudson.model.Build$RunnerImpl.doRun(Build.java:137) at hudson.model.AbstractBuild$AbstractRunner.run(AbstractBuild.java:429) at hudson.model.Run.run(Run.java:1366) at hudson.model.FreeStyleBuild.run(FreeStyleBuild.java:46) at hudson.model.ResourceController.execute(ResourceController.java:88) at hudson.model.Executor.run(Executor.java:145) I want to point out the command which is tried to execute by hudson : /disk7/hudson_home/maven/slavebundle/bundled-maven/bin/mvn clean install -V -B -Dmaven.ext.class.path=/disk7/hudson_home/maven/slavebundle/resources:/disk7/hudson_home/maven/slavebundle/lib/maven3-eventspy-3.0.jar:/disk7/jboss-as-7.1.0.Final/standalone/tmp/vfs/deploymentdf2a6dfa59ee3407/hudson-remoting-2.2.0.jar-407215e5de02980f/contents -Dhudson.eventspy.port=37183 -f pom.xml It tries to find "hudson-remoting-2.2.0.jar" to put it to build path but it searches it at the wrong place because when I look where the hudson-remoting jar I found it at /disk7/jboss-as-7.1.0.Final/standalone/tmp/vfs/deploymentdf2a6dfa59ee3407/hudson-remoting-2.2.0.jar-407215e5de02980f/hudson-remoting-2.2.0.jar for this build(not in contents). So how can I configure the hudson to force it looking at the right place for jars? Is there anyone has an idea? Thanks in advance.

    Read the article

< Previous Page | 187 188 189 190 191 192 193 194 195 196 197 198  | Next Page >