Search Results

Search found 5279 results on 212 pages for 'execution counter'.

Page 195/212 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • Need Help with Consolidating RoR Google Map Results

    - by Kevin
    I have a project that returns geocoded results within 20 miles of the user. I want these results grouped on the map by zip code, then within the info window show the individual results. The code posted below works, but for some reason it only displays the 1.png rather than looking at the results and using the correct .png icon associated with the number. When I look at the infowindows, it displays the correct png like "/images/2.png" or "/images/5.png" but the actual image is always 1. @ziptickets = Ticket.find(:all, :origin => coords, :select => 'DISTINCT zip, lat, lng', :within => @user.distance_to_travel, :conditions => "status_id = 1") for t in @ziptickets zips = Ticket.find(:all, :conditions => ["zip = ?", t.zip]) currentzip = t.zip.to_s tixinzip = zips.size.to_s imagelocation = "/images/" + tixinzip + ".png" shadowlocation = "/images/" + tixinzip + "s.png" @map.icon_global_init(GIcon.new(:image => imagelocation, :shadow => shadowlocation, :shadow_size => GSize.new(60,40), :icon_anchor => GPoint.new(20,20), :info_window_anchor => GPoint.new(9,2)), "test") newicon = Variable.new("test") new_marker = GMarker.new([t.lat, t.lng], :icon => newicon, :title => imagelocation, :info_window => currentzip) @map.overlay_init(new_marker) end I tried changing the last part of the mapicon from: :info_window_anchor => GPoint.new(9,2)), "test") newicon = Variable.new("test") to: :info_window_anchor => GPoint.new(9,2)), currentzip) newicon = Variable.new(currentzip) but the strangest thing is that any string that has numbers in it causes the map to fail to render in the view and just show a blank screen... same if I replace it with :info_window_anchor => GPoint.new(9,2)), "123") newicon = Variable.new("123") Any advice would be helpful... also it runs a bit slower than my previous code which just set up 4 standard icons and used them outside of the loop so any hints as to speed up execution would be appreciated greatly. Thanks!

    Read the article

  • Python: Script works, but seems to deadlock after some time

    - by sberry2A
    I have the following script, which is working for the most part Link to PasteBin The script's job is to start a number of threads which in turn each start a subprocess with Popen. The output from each subprocess is as follows: 1 2 3 . . . n Done Bascially the subprocess is transferring 10M records from tables in one database to different tables in another db with a lot of data massaging/manipulation in between because of the different schemas. If the subprocess fails at any time in it's execution (bad records, duplicate primary keys, etc), or it completes successfully, it will output "Done\n". If there are no more records to select against for transfer then it will output "NO DATA\n" My intent was to create my script "tableTransfer.py" which would spawn a number of these processes, read their output, and in turn output information such as number of updates completed, time remaining, time elapsed, and number of transfers per second. I started running the process last night and checked in this morning to see it had deadlocked. There were not subprocceses running, there are still records to be updated, and the script had not exited. It was simply sitting there, no longer outputting the current information because no subprocces were running to update the total number complete which is what controls updates to the output. This is running on OS X. I am looking for three things: I would like to get rid of the possibility of this deadlock occurring so I don't need to check in on it as frequently. Is there some issue with locking? Am I doing this in a bad way (gThreading variable to control looping of spawning additional thread... etc.) I would appreciate some suggestions for improving my overall methodology. How should I handle ctrl-c exit? Right now I need to kill the process, but assume I should be able to use the signal module or other to catch the signal and kill the threads, is that right? I am not sure whether I should be pasting my entire script here, since I usually just paste snippets. Let me know if I should paste it here as well.

    Read the article

  • Reliable session faulting for unknown reason

    - by Scarfman007
    I am trying to achieve the following - one client-side proxy instance (kept open) accessed by multiple threads using a reliable session. What I have managed so far is to have either A) a reliable session with a client-side proxy which is created and disposed per call or B) what I aim for, but without a reliable session. When I enable reliable sessions on my binding however, the following behaviour is exhibited: Client-side Upon application startup everything appears to work fine until roughly 18 messages in to the WCF session. I firstly get the proxy.InnerChannel.Faulted event raised, then an exception is caught at the point where I am calling the method on the proxy. The exception is a System.TimeoutException, with message: "The request channel timed out while waiting for a reply after 00:00:59.9062512. Increase the timeout value passed to the call to Request or increase the SendTimeout value on the Binding. The time allotted to this operation may have been a portion of a longer timeout." The inner exception has a similar message: "The request operation did not complete within the allotted timeout of 00:01:00. The time allotted to this operation may have been a portion of a longer timeout." With the method at the top of the inner stack trace being: System.ServiceModel.Channels.ReliableRequestSessionChannel.SyncRequest.WaitForReply(TimeSpan timeout) I then call proxy.Close followed by proxy.Abort (catching and ignoring exceptions). If I utilize the default settings (i.e. have simply <reliableSession/>), then calling proxy. Close results in another System.Timeout exception (although this time the allotted timeout is 00:00:00), however if I override the defaults as specified above no exception is thrown. Service-side Utilizing WCF tracing I get a System.ServiceModel.CommunicationException, with message: "The sequence has been terminated by the remote endpoint. The session has stopped waiting for a particular reply. Because of this the reliable session cannot continue. The reliable session was faulted." And a stack trace ending at: System.ServiceModel.AsyncResult.End[TAsyncResult](IAsyncResult result) When remotely attaching to the server I get the same message, which occurs when code execution steps over the return statement of my service in the service call which causes the error. The puzzling thing to me is that the service is stable and runs with options A) or B) as decribed at the beginning of my post, and occurs after a varying number of messages (around 18). The former fact points to there being nothing wrong with the code (indeed I have checked that no exceptions are thrown), and the latter just serves to confuse me and is why I modified the settings on the reliable session binding. I am quite stuck on this. Can anyone suggest why the reliable session would fault in such a way?

    Read the article

  • sharepoint custom aspx page with database connection

    - by Megini
    hi there i have created a custom aspx page whithin my sharepoint site with a sql server connection to a database on that server to select data when i view the page it works but when another user tries to view it it gives the following error : Server Error in '/' Application. Login failed for user 'GRINCOR\GuguK'. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.SqlClient.SqlException: Login failed for user 'GRINCOR\GuguK'. Source Error: The source code that generated this unhandled exception can only be shown when compiled in debug mode. To enable this, please follow one of the below steps, then request the URL: Add a "Debug=true" directive at the top of the file that generated the error. Example: <%@ Page Language="C#" Debug="true" % or: 2) Add the following section to the configuration file of your application: Note that this second technique will cause all files within a given application to be compiled in debug mode. The first technique will cause only that particular file to be compiled in debug mode. Important: Running applications in debug mode does incur a memory/performance overhead. You should make sure that an application has debugging disabled before deploying into production scenario. Stack Trace: [SqlException (0x80131904): Login failed for user 'GRINCOR\GuguK'.] System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) +248 System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) +245 System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) +2811 System.Data.SqlClient.SqlInternalConnectionTds.CompleteLogin(Boolean enlistOK) +53 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +327 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +2445370 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +2445224 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +354 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +703 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +54 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +2414776 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +92 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +1657 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +84 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +1645767 System.Data.SqlClient.SqlConnection.Open() +258 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa__233736835.DisplayData() in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:151 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa_233736835._RenderMain(HtmlTextWriter __w, Control parameterContainer) in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:346 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +115 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +253 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +87 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +53 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Page.Render(HtmlTextWriter writer) +38 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +4240 Version Information: Microsoft .NET Framework Version:2.0.50727.3603; ASP.NET Version:2.0.50727.3601 can someone give me a solution to this problem ? i am using sharepoint services 3.0

    Read the article

  • Why is my producer-consumer blocking?

    - by User007
    My code is here: http://pastebin.com/Fi3h0E0P Here is the output 0 Should we take order today (y or n): y Enter order number: 100 More customers (y or n): n Stop serving customers right now. Passing orders to cooker: There are total of 1 order(s) 1 Roger, waiter. I am processing order #100 The goal is waiter must take orders and then give them to the cook. The waiter has to wait cook finishes all pizza, deliver the pizza, and then take new orders. I asked how P-V work in my previous post here. I don't think it has anything to do with \n consuming? I tried all kinds of combination of wait(), but none work. Where did I make a mistake? The main part is here: //Producer process if(pid > 0) { while(1) { printf("0"); P(emptyShelf); // waiter as P finds no items on shelf; P(mutex); // has permission to use the shelf waiter_as_producer(); V(mutex); // cooker now can use the shelf V(orderOnShelf); // cooker now can pickup orders wait(); printf("2"); P(pizzaOnShelf); P(mutex); waiter_as_consumer(); V(mutex); V(emptyShelf); printf("3 "); } } if(pid == 0) { while(1) { printf("1"); P(orderOnShelf); // make sure there is an order on shelf P(mutex); //permission to work cooker_as_consumer(); // take order and put pizza on shelf printf("return from cooker"); V(mutex); //release permission printf("just released perm"); V(pizzaOnShelf); // pizza is now on shelf printf("after"); wait(); printf("4"); } } So I imagine this is the execution path: enter waiter_as_producer, then go to child process (cooker), then transfer the control back to parent, finish waiter_as_consumer, switch back to child. The two waits switch back to parent (like I said I tried all possible wait() combination...).

    Read the article

  • Neo4j 1.9.4 (REST Server,CYPHER) performance issue

    - by user2968943
    I have Neo4j 1.9.4 installed on 24 core 24Gb ram (centos) machine and for most queries CPU usage spikes goes to 200% with only few concurrent requests. Domain: some sort of social application where few types of nodes(profiles) with 3-30 text/array properties and 36 relationship types with at least 3 properties. Most of nodes currently has ~300-500 relationships. Current data set footprint(from console): LogicalLogSize=4294907 (32MB) ArrayStoreSize=1675520 (12MB) NodeStoreSize=1342170 (10MB) PropertyStoreSize=1739548 (13MB) RelationshipStoreSize=6395202 (48MB) StringStoreSize=1478400 (11MB) which is IMHO really small. most queries looks like this one(with more or less WITH .. MATCH .. statements and few queries with variable length relations but the often fast): START targetUser=node({id}), currentUser=node({current}) MATCH targetUser-[contact:InContactsRelation]->n, n-[:InLocationRelation]->l, n-[:InCategoryRelation]->c WITH currentUser, targetUser,n, l,c, contact.fav is not null as inFavorites MATCH n<-[followers?:InContactsRelation]-() WITH currentUser, targetUser,n, l,c,inFavorites, COUNT(followers) as numFollowers RETURN id(n) as id, n.name? as name, n.title? as title, n._class as _class, n.avatar? as avatar, n.avatar_type? as avatar_type, l.name as location__name, c.name as category__name, true as isInContacts, inFavorites as isInFavorites, numFollowers it runs in ~1s-3s(for first run) and ~1s-70ms (for consecutive and it depends on query) and there is about 5-10 queries runs for each impression. Another interesting behavior is when i try run query from console(neo4j) on my local machine many consecutive times(just press ctrl+enter for few seconds) it has almost constant execution time but when i do it on server it goes slower exponentially and i guess it somehow related with my problem. Problem: So my problem is that neo4j is very CPU greedy(for 24 core machine its may be not an issue but its obviously overkill for small project). First time i used AWS EC2 m1.large instance but over all performance was bad, during testing, CPU always was over 100%. Some relevant parts of configuration: neostore.nodestore.db.mapped_memory=1280M wrapper.java.maxmemory=8192 note: I already tried configuration where all memory related parameters where HIGH and it didn't worked(no change at all). Question: Where to digg? configuration? scheme? queries? what i'm doing wrong? if need more info(logs, configs) just ask ;)

    Read the article

  • Elapsed time of running a C program

    - by yCalleecharan
    Hi, I would like to know what lines of C code to add to a program so that it tells me the total time that the program takes to run. I guess there should be counter initialization near the beginning of main and one after the main function ends. Is the right header clock.h? Thanks a lot... Update I have a Win Xp machine. Is it just adding clock() at the beginning and another clock() at the end of the program? Then I can estimate the time difference. Yes, you're right it's time.h. Here's my code: #include <stdio.h> #include <stdlib.h> #include <math.h> #include <share.h> #include <time.h> void f(long double fb[], long double fA, long double fB); int main() { clock_t start, end; start = clock(); const int ARRAY_SIZE = 11; long double* z = (long double*) malloc(sizeof (long double) * ARRAY_SIZE); int i; long double A, B; if (z == NULL) { printf("Out of memory\n"); exit(-1); } A = 0.5; B = 2; for (i = 0; i < ARRAY_SIZE; i++) { z[i] = 0; } z[1] = 5; f(z, A, B); for (i = 0; i < ARRAY_SIZE; i++) printf("z is %.16Le\n", z[i]); free(z); z = NULL; end = clock(); printf("Took %ld ticks\n", end-start); printf("Took %f seconds\n", (double)(end-start)/CLOCKS_PER_SEC); return 0; } void f(long double fb[], long double fA, long double fB) { fb[0] = fb[1]* fA; fb[1] = fb[1] - 1; return; } Some errors with MVS2008: testim.c(16) : error C2143: syntax error : missing ';' before 'const' testim.c(18) :error C2143: syntax error : missing ';' before 'type' testim.c(20) :error C2143: syntax error : missing ';' before 'type' testim.c(21) :error C2143: syntax error : missing ';' before 'type' testim.c(23) :error C2065: 'z' : undeclared identifier testim.c(23) :warning C4047: '==' : 'int' differs in levels of indirection from 'void *' testim.c(28) : error C2065: 'A' : undeclared identifier testim.c(28) : warning C4244: '=' : conversion from 'double' to 'int', possible loss of data and it goes to 28 errors. Note that I don't have any errors/warnings without your clock codes. LATEST NEWS: I unfortunately didn't get a good reply here. But after a search on Google, the code is working. Here it is: #include <stdio.h> #include <stdlib.h> #include <math.h> #include <share.h> #include <time.h> void f(long double fb[], long double fA, long double fB); int main() { clock_t start = clock(); const int ARRAY_SIZE = 11; long double* z = (long double*) malloc(sizeof (long double) * ARRAY_SIZE); int i; long double A, B; if (z == NULL) { printf("Out of memory\n"); exit(-1); } A = 0.5; B = 2; for (i = 0; i < ARRAY_SIZE; i++) { z[i] = 0; } z[1] = 5; f(z, A, B); for (i = 0; i < ARRAY_SIZE; i++) printf("z is %.16Le\n", z[i]); free(z); z = NULL; printf("Took %f seconds\n", ((double)clock()-start)/CLOCKS_PER_SEC); return 0; } void f(long double fb[], long double fA, long double fB) { fb[0] = fb[1]* fA; fb[1] = fb[1] - 1; return; } Cheers

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • I asked this yesterday, after the input given I'm still having trouble implementing..

    - by Josh
    I'm not sure how to fix this or what I did wrong, but whenever I enter in a value it just closes out the run prompt. So, seems I do have a problem somewhere in my coding. Whenever I run the program and input a variable, it always returns the same answer.."The content at location 76 is 0." On that note, someone told me that "I don't know, but I suspect that Program A incorrectly has a fixed address being branched to on instructions 10 and 11." - mctylr but I'm not sure how to fix that.. I'm trying to figure out how to incorporate this idea from R Samuel Klatchko.. I'm still not sure what I'm missing but I can't get it to work.. const int OP_LOAD = 3; const int OP_STORE = 4; const int OP_ADD = 5; ... const int OP_LOCATION_MULTIPLIER = 100; mem[0] = OP_LOAD * OP_LOCATION_MULTIPLIER + ...; mem[1] = OP_ADD * OP_LOCATION_MULTIPLIER + ...; operand = memory[ j ] % OP_LOCATION_MULTIPLIER; operation = memory[ j ] / OP_LOCATION_MULTIPLIER; I'm new to programming, I'm not the best, so I'm going for simplicity. Also this is an SML program. Anyway, this IS a homework assignment and I'm wanting a good grade on this. So I was looking for input and making sure this program will do what I'm hoping they are looking for. Anyway, here are the instructions: Write SML (Simpletron Machine language) programs to accomplish each of the following task: A) Use a sentinel-controlled loop to read positive number s and compute and print their sum. Terminate input when a neg number is entered. B) Use a counter-controlled loop to read seven numbers, some positive and some negative, and compute + print the avg. C) Read a series of numbers, and determine and print the largest number. The first number read indicates how many numbers should be processed. Without further a due, here is my program. All together. int main() { const int READ = 10; const int WRITE = 11; const int LOAD = 20; const int STORE = 21; const int ADD = 30; const int SUBTRACT = 31; const int DIVIDE = 32; const int MULTIPLY = 33; const int BRANCH = 40; const int BRANCHNEG = 41; const int BRANCHZERO = 41; const int HALT = 43; int mem[100] = {0}; //Making it 100, since simpletron contains a 100 word mem. int operation; //taking the rest of these variables straight out of the book seeing as how they were italisized. int operand; int accum = 0; // the special register is starting at 0 int j; // This is for part a, it will take in positive variables in a sent-controlled loop and compute + print their sum. Variables from example in text. memory [0] = 1010; memory [01] = 2009; memory [02] = 3008; memory [03] = 2109; memory [04] = 1109; memory [05] = 4300; memory [06] = 1009; j = 0; //Makes the variable j start at 0. while ( true ) { operand = memory[ j ]%100; // Finds the op codes from the limit on the memory (100) operation = memory[ j ]/100; //using a switch loop to set up the loops for the cases switch ( operation ){ case 10: //reads a variable into a word from loc. Enter in -1 to exit cout <<"\n Input a positive variable: "; cin >> memory[ operand ]; break; case 11: // takes a word from location cout << "\n\nThe content at location " << operand << "is " << memory[operand]; break; case 20:// loads accum = memory[ operand ]; break; case 21: //stores memory[ operand ] = accum; break; case 30: //adds accum += mem[operand]; break; case 31: // subtracts accum-= memory[ operand ]; break; case 32: //divides accum /=(memory[ operand ]); break; case 33: // multiplies accum*= memory [ operand ]; break; case 40: // Branches to location j = -1; break; case 41: //branches if acc. is < 0 if (accum < 0) j = 5; break; case 42: //branches if acc = 0 if (accum == 0) j = 5; break; case 43: // Program ends exit(0); break; } j++; } return 0; }

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • Having trouble wrapping functions in the linux kernel

    - by Corey Henderson
    I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • How would you implement this "WorkerChain" functionality in .NET?

    - by Dan Tao
    Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

    Read the article

  • How would you go about tackling this problem? [SOLVED in C++]

    - by incrediman
    Intro: EDIT: See solution at the bottom of this question (c++) I have a programming contest coming up in about half a week, and I've been prepping :) I found a bunch of questions from this canadian competition, they're great practice: http://cemc.math.uwaterloo.ca/contests/computing/2009/stage2/day1.pdf I'm looking at problem B ("Dinner"). Any idea where to start? I can't really think of anything besides the naive approach (ie. trying all permutations) which would take too long to be a valid answer. Btw, the language there says c++ and pascal I think, but i don't care what language you use - I mean really all I want is a hint as to the direction I should proceed in, and perhpas a short explanation to go along with it. It feels like I'm missing something obvious... Of course extended speculation is more than welcome, but I just wanted to clarify that I'm not looking for a full solution here :) Short version of the question: You have a binary string N of length 1-100 (in the question they use H's and G's instead of one's and 0's). You must remove all of the digits from it, in the least number of steps possible. In each step you may remove any number of adjacent digits so long as they are the same. That is, in each step you can remove any number of adjacent G's, or any number of adjacent H's, but you can't remove H's and G's in one step. Example: HHHGHHGHH Solution to the example: 1. HHGGHH (remove middle Hs) 2. HHHH (remove middle Gs) 3. Done (remove Hs) -->Would return '3' as the answer. Note that there can also be a limit placed on how large adjacent groups have to be when you remove them. For example it might say '2', and then you can't remove single digits (you'd have to remove pairs or larger groups at a time). Solution I took Mark Harrison's main algorithm, and Paradigm's grouping idea and used them to create the solution below. You can try it out on the official test cases if you want. //B.cpp //include debug messages? #define DEBUG false #include <iostream> #include <stdio.h> #include <vector> using namespace std; #define FOR(i,n) for (int i=0;i<n;i++) #define FROM(i,s,n) for (int i=s;i<n;i++) #define H 'H' #define G 'G' class String{ public: int num; char type; String(){ type=H; num=0; } String(char type){ this->type=type; num=1; } }; //n is the number of bits originally in the line //k is the minimum number of people you can remove at a time //moves is the counter used to determine how many moves we've made so far int n, k, moves; int main(){ /*Input from File*/ scanf("%d %d",&n,&k); char * buffer = new char[200]; scanf("%s",buffer); /*Process input into a vector*/ //the 'line' is a vector of 'String's (essentially contigious groups of identical 'bits') vector<String> line; line.push_back(String()); FOR(i,n){ //if the last String is of the correct type, simply increment its count if (line.back().type==buffer[i]) line.back().num++; //if the last String is of the wrong type but has a 0 count, correct its type and set its count to 1 else if (line.back().num==0){ line.back().type=buffer[i]; line.back().num=1; } //otherwise this is the beginning of a new group, so create the new group at the back with the correct type, and a count of 1 else{ line.push_back(String(buffer[i])); } } /*Geedily remove groups until there are at most two groups left*/ moves=0; int I;//the position of the best group to remove int bestNum;//the size of the newly connected group the removal of group I will create while (line.size()>2){ /*START DEBUG*/ if (DEBUG){ cout<<"\n"<<moves<<"\n----\n"; FOR(i,line.size()) printf("%d %c \n",line[i].num,line[i].type); cout<<"----\n"; } /*END DEBUG*/ I=1; bestNum=-1; FROM(i,1,line.size()-1){ if (line[i-1].num+line[i+1].num>bestNum && line[i].num>=k){ bestNum=line[i-1].num+line[i+1].num; I=i; } } //remove the chosen group, thus merging the two adjacent groups line[I-1].num+=line[I+1].num; line.erase(line.begin()+I);line.erase(line.begin()+I); moves++; } /*START DEBUG*/ if (DEBUG){ cout<<"\n"<<moves<<"\n----\n"; FOR(i,line.size()) printf("%d %c \n",line[i].num,line[i].type); cout<<"----\n"; cout<<"\n\nFinal Answer: "; } /*END DEBUG*/ /*Attempt the removal of the last two groups, and output the final result*/ if (line.size()==2 && line[0].num>=k && line[1].num>=k) cout<<moves+2;//success else if (line.size()==1 && line[0].num>=k) cout<<moves+1;//success else cout<<-1;//not everyone could dine. /*START DEBUG*/ if (DEBUG){ cout<<" moves."; } /*END DEBUG*/ }

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

  • StaX: Content not allowed in prolog

    - by RalfB
    I have the following (test) XML file below and Java code that uses StaX. I want to apply this code to a file that is about 30 GB large but with fairly small elements, so I thought StaX is a good choice. I am getting the following error: Exception in thread "main" javax.xml.stream.XMLStreamException: ParseError at [row,col]:[1,1] Message: Content is not allowed in prolog at com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next(XMLStreamReaderImpl.java:598) at at.tuwien.mucke.util.xml.staxtest.StaXTest.main(StaXTest.java:18) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at com.intellij.rt.execution.application.AppMain.main(AppMain.java:120) <?xml version='1.0' encoding='utf-8'?> <catalog> <book id="bk101"> <author>Gambardella, Matthew</author> <title>XML Developer's Guide</title> <price>44.95</price> <description>An in-depth look at creating applications with XML.</description> </book> <book id="bk102"> <author>Ralls, Kim</author> <title>Midnight Rain</title> <price>5.95</price> <description>A former architect battles corporate zombies, an evil sorceress, and her own childhood to become queen of the world.</description> </book> </catalog> Here the code: package xml.staxtest; import java.io.*; import javax.xml.stream.*; public class StaXTest { public static void main(String[] args) throws Exception { XMLInputFactory xif = XMLInputFactory.newInstance(); XMLStreamReader streamReader = xif.createXMLStreamReader(new FileReader("D:/Data/testFile.xml")); while(streamReader.hasNext()){ int eventType = streamReader.next(); if(eventType == XMLStreamReader.START_ELEMENT){ System.out.println(streamReader.getLocalName()); } //... more to come here later ... } } }

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • Android browser touch events stop display being updated inc. canvas/elements - How to work around?

    - by Ed Kirk
    On some android's native browser touching the page seems to stop the display from being updated until the finger is released. This occurs for both html element based animation (switching classes) and for canvas based animation. It does not however stop normal js execution and other events are fired as normal. On devices with this problem the dolphin browser also seems effected (not firefox though). Touchstart/move both have preventDefault() fired as well as stopPropergation(), cancelBubble = true; and e.returnValue = false;. In the CSS webkit selection has also been disabled. The page will not scroll. A similar question has been asked here: Does Android browser lock DOM on touchStart? but I'd like to find out if this behaviour can be overcome, or at least to discover what devices will be effected by the problem, is it a device or version android issue? If you cannot answer the question running the demo and reporting your experience along with your device model and useragent (displayed at bottom of demo page) as a comment might help others or myself answer the question. Here is a demo and steps to reproduce the behaviour. A QR code for the link can be found here https://s3-eu-west-1.amazonaws.com/canvas-test-pd/tmp.png. https://s3-eu-west-1.amazonaws.com/canvas-test-pd/index.html The web page has a canvas at the top and a div with a background image at the bottom. Every second the canvas is cleared and a different image displayed and the div has it's class switched (both toggle between 0 and 1 pngs). Once this has toggled a few times place your finger on the canvas (the top grey box) and hold it there. Wait to see if the animation continues (sometimes it will once or twice then stops) and if there are any visual distortions. Update It seems that the Galaxy Tab running 3.2 requires handlers for touchstart/end of document, not just required divs for the screen to continue updating the display. Thanks jimpic. I'm starting to believe it's an issue caused by manufacturers skins, although this is difficult to prove.

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >