Search Results

Search found 5756 results on 231 pages for 'illegal characters'.

Page 197/231 | < Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >

• JSF ISO-8859-2 charset

  - by Vladimir

  Hi! I have problem with setting proper charset on my jsf pages. I use MySql db with latin2 (ISO-8859-2 charset) and latin2_croatian_ci collation. But, I have problems with setting values on backing managed bean properties. Page directive on top of my page is: <%@ page language="java" pageEncoding="ISO-8859-2" contentType="text/html; charset=ISO-8859-2" %> In head I included: <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-2"> And my form tag is: <h:form id="entityDetails" acceptcharset="ISO-8859-2"> I've created and registered Filter in web.xml with following doFilter method implementation: public void doFilter(ServletRequest request, ServletResponse response, FilterChain chain) throws IOException, ServletException { request.setCharacterEncoding("ISO-8859-2"); response.setCharacterEncoding("ISO-8859-2"); chain.doFilter(request, response); } But, i.e. when I set managed bean property through inputText, all special (unicode) characters are replaced with '?' character. I really don't have any other ideas how to set charset to pages to perform well. Any suggestions? Thanks in advance.

  Read the article

• Keyword to SQL search

  - by jdelator

  Use Case When a user goes to my website, they will be confronted with a search box much like SO. They can search for results using plan text. ".net questions", "closed questions", ".net and java", etc.. The search will function a bit different that SO, in that it will try to as much as possible of the schema of the database rather than a straight fulltext search. So ".net questions" will only search for .net questions as opposed to .net answers (probably not applicable to SO case, just an example here), "closed questions" will return questions that are closed, ".net and java" questions will return questions that relate to .net and java and nothing else. Problem I'm not too familiar with the words but I basically want to do a keyword to SQL driven search. I know the schema of the database and I also can datamine the database. I want to know any current approaches there that existing out already before I try to implement this. I guess this question is for what is a good design for the stated problem. Proposed My proposed solution so far looks something like this Clean the input. Just remove any special characters Parse the input into chunks of data. Break an input of "c# java" into c# and java Also handle the special cases like "'c# java' questions" into 'c# java' and "questions". Build a tree out of the input Bind the data into metadata. So convert stuff like closed questions and relate it to the isclosed column of a table. Convert the tree into a sql query. Thoughts/suggestions/links?

  Read the article

• iPhone contacts app styled indexed table view implementation

  - by KSH

  My Requirement: I have this straight forward requirement of listing names of people in alphabetical order in a Indexed table view with index titles being the starting letter of alphabets (additionally a search icon at the top and # to display misc values which start with a number and other special characters). What I have done so far: 1. I am using core data for storage and "last_name" is modelled as a String property in the Contacts entity 2.I am using a NSFetchedResultsController to display the sorted indexed table view. Issues accomplishing my requirement: 1. First up, I couldn't get the section index titles to be the first letter of alphabets. Dave's suggestion in the following post, helped me achieve the same: http://stackoverflow.com/questions/1112521/nsfetchedresultscontroller-with-sections-created-by-first-letter-of-a-string The only issue I encountered with Dave' suggestion is that I couldn't get the misc named grouped under "#" index. What I have tried: 1. I tried adding a custom compare method to NSString (category) to check how the comparison and section is made but that custom method doesn't get called when specified in the NSSortDescriptor selector. Here is some code: `@interface NSString (SortString) -(NSComparisonResult) customCompare: (NSString*) aStirng; @end @implementation NSString (SortString) -(NSComparisonResult) customCompare:(NSString *)aString { NSLog(@"Custom compare called to compare : %@ and %@",self,aString); return [self caseInsensitiveCompare:aString]; } @end` Code to fetch data: `NSArray *sortDescriptors = [NSArray arrayWithObject:[[[NSSortDescriptor alloc] initWithKey:@"last_name" ascending:YES selector:@selector(customCompare:)] autorelease]]; [fetchRequest setSortDescriptors:sortDescriptors]; fetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:fetchRequest managedObjectContext:managedObjectContext sectionNameKeyPath:@"lastNameInitial" cacheName:@"MyCache"];` Can you let me know what I am missing and how the requirement can be accomplished ?

  Read the article

• ASP.NET required field validator firing on focus in Firefox

  - by ren33

  I have 2 asp.net textboxes in an update panel. Both textbox controls have some javascript attached to autotab to the next field and to allow only numeric input. When I enter some data into the first field and press enter, focus shifts to the next field and the requiredfieldvalidator of the second field displays its "* required" error message, even though I've just entered the field. This is only happening in Firefox. How can I prevent the validator from firing when I first enter the textbox? edit Here's the code: <asp:TextBox ID="add_ISBN" runat="server" Columns="14" MaxLength="17" CssClass="focus" /> <asp:TextBox ID="add_Qty" runat="server" Columns="4" MaxLength="4" /> <asp:RequiredFieldValidator ID="rfvQty" ControlToValidate="add_Qty" ErrorMessage="* required" ForeColor="Red" Display="Dynamic" EnableClientScript="true" ValidationGroup="Add" runat="server" /> In the codebehind: add_ISBN.Attributes.Add("onkeydown", "return isbnCheck(event, '" & add_Qty.ClientID & "')") And the javascript: function isbnCheck(e, id) { e = e || window.event; var key = e.which || e.keyCode if (validIsbnChars.indexOf(parseInt(key, 10)) >= 0) { return true; } else { if (key == 13) { var nextfield = document.getElementById(id); if (nextfield) nextfield.focus(); return false; } if (e.preventDefault) e.preventDefault(); e.returnValue = false; return false; } } The javascript allows only a valid subset of characters, and if the user presses enter, sets focus to the next field.

  Read the article

• Multi-base conversion - using all combinations for URL shortener

  - by Guffa

  I am making an URL shortener, and I am struggling with the optimal way of encoding a number (id) into a character string. I am using the characters 0-9,A-Z,a-z so it will basically be a base-62 encoding. That is pretty basic, but it doesn't make use of all possible codes. The codes that it would produce would be: 0, 1, ... y, z, 10, 11, ... zy, zz, 100, 101, ... Notice that the codes 00 to 0z is not used, the same for 000 to 0zz, and so on. I would like to use all the codes, like this: 0, 1, ... y, z, 00, 01, ... zy, zz, 000, 001, ... It would be some combination of base-62 and base-63, with different bases depending on the position... Using base-62 is easy, for example: create procedure tiny_GetCode @UrlId int as set nocount on declare @Code varchar(10) set @Code = '' while (@UrlId > 0 or len(@Code) = 0) begin set @Code = substring('0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz', @UrlId % 62 + 1, 1) + @Code set @UrlId = @UrlId / 62 end select @Code But I haven't yet managed to make a multi-base conversion out of it, to make use of all the codes.

  Read the article

• How does MatchEvaluator works? ( C# regex replace)

  - by Marin Doric

  This is the input string 23x * y34x2. I want to insert " * " (star surrounded by whitespaces) after every number followed by letter, and after every letter followed by number. So my input string would look like this: 23 * x * y * 34 * x * 2. This is the regex that does the job: @"\d(?=[a-z])|a-z". This is the function that I wrote that inserts the " * ". Regex reg = new Regex(@"\d(?=[a-z])|[a-z](?=\d)"); MatchCollection matchC; matchC = reg.Matches(input); int ii = 1; foreach (Match element in matchC)//foreach match I will find the index of that match { input = input.Insert(element.Index + ii, " * ");//since I' am inserting " * " ( 3 characters ) ii += 3; //I must increment index by 3 } return input; //return modified input My question how to do same job using .net MatchEvaluator? I'am new to regex and don't understand good replacing with MatchEvaluator. This is the code that I tried to wrote: Regex reg = new Regex(@"\d(?=[a-z])|[a-z](?=\d)"); MatchEvaluator matchEval = new MatchEvaluator(ReplaceStar); input = reg.Replace(input, matchEval); return input; } public string ReplaceStar( Match match ) { //return What?? }

  Read the article

• Extract wrong data from a frame in C?

  - by ipkiss

  I am writing a program that reads the data from the serial port on Linux. The data are sent by another device with the following frame format: |start | Command | Data | CRC | End | |0x02 | 0x41 | (0-127 octets) | | 0x03| ---------------------------------------------------- The Data field contains 127 octets as shown and octet 1,2 contains one type of data; octet 3,4 contains another data. I need to get these data. Because in C, one byte can only holds one character and in the start field of the frame, it is 0x02 which means STX which is 3 characters. So, in order to test my program, On the sender side, I construct an array as the frame formatted above like: char frame[254]; frame[0] = 0x02; // starting field frame[1] = 0x41; // command field which is character 'A' ..so on.. And, then On the receiver side, I take out the fields like: char result[254]; // read data read(result); printf("command = %c", result[1]); // get the command field of the frame // get other field's values the command field value (result[1]) is not character 'A'. I think, this because the first field value of the frame is 0x02 (STX) occupying 3 first places in the array frame and leading to the wrong results on the receiver side. How can I correct the issue or am I doing something wrong at the sender side? Thanks all. related questions: http://stackoverflow.com/questions/2500567/parse-and-read-data-frame-in-c http://stackoverflow.com/questions/2531779/clear-data-at-serial-port-in-linux-in-c

  Read the article

• looking for a license key algorithm.

  - by giulio

  There are a lot of questions relating to license keys asked on stackoverflow. But they don't answer this question. Can anyone provide a simple license key algorithm that is technology independent and doesn't required a diploma in mathematics to understand ? The license key algorithm is similar to public key encryption. I just need something simple that can be implemented in any platform .Net/Java and uses simple data like characters. Preferably no byte translations required. So if a person presents a string, a complementary string can be generated that is the authorisation code. Below is a common scenario that it would be used for. Customer downloads s/w which generates a unique key upon initial startup/installation. S/w runs during trial period. At end of trial period an authorisation key is required. Customer goes to designated web-site, enters their code and get authorisation code to enable s/w, after paying :) Don't be afraid to describe your answer as though you're talking to a 5 yr old as I am not a mathemtician. Just need a decent basic algorithm, we're not launching nukes... NB: Please no philosophy on encryption nor who is Diffie-Hellman. I just need a basic solution.

  Read the article

• php mailer char-coding problem

  - by Holian

  Hello! I try to use Phpmailer to send registration, activation..etc mail to users... require("class.phpmailer.php"); $mail -> charSet = "UTF-8"; $mail = new PHPMailer(); $mail->IsSMTP(); $mail->Host = "smtp.mydomain.org"; $mail->From = "[email protected]"; $mail->SMTPAuth = true; $mail->Username ="username"; $mail->Password="passw"; //$mail->FromName = $header; $mail->FromName = mb_convert_encoding($header, "UTF-8", "auto"); $mail->AddAddress($emladd); $mail->AddAddress("[email protected]"); $mail->AddBCC('[email protected]', 'firstadd'); $mail->Subject = $sub; $mail->Body = $message; $mail->WordWrap = 50; if(!$mail->Send()) { echo 'Message was not sent.'; echo 'Mailer error: ' . $mail->ErrorInfo; } The $message is contain latin characters. Unfortunatelly all webmail (gmail, webmail.mydomain.org, emailaddress.domain.xx) use different coding. How can i force to use UTF-8 coding to show my mail exactly same on all mailbox? I try to convert the mail header width mb_convert_encoding(), but with no luck. Thank you.

  Read the article

• Python win32com - Automating Word - How to replace text in a text box?

  - by Greg

  I'm trying to automate word to replace text in a word document using Python. (I'm on word 2003 if that matters and Python 2.4) The first part of my replace method below works on everything except text in text boxes. The text just doesn't get selected. I notice when I go into Word manually and hit ctrl-A all of the text gets selected except for the text box. Here's my code so far: class Word: def __init__(self,visible=0,screenupdating=0): pythoncom.CoInitialize() self.app=gencache.EnsureDispatch(WORD) self.app.Visible = visible self.app.DisplayAlerts = 0 self.app.ScreenUpdating = screenupdating print 'Starting word' def open(self,doc): self.opendoc=os.path.basename(doc) self.app.Documents.Open(FileName=doc) def replace(self,source,target): if target=='':target=' ' alltext=self.app.Documents(self.opendoc).Range(Start=0,End=self.app.Documents(self.opendoc).Characters.Count) #select all alltext.Find.Text = source alltext.Find.Replacement.Text = target alltext.Find.Execute(Replace=1,Forward=True) #Special handling to do replace in text boxes #http://word.tips.net/Pages/T003879_Updating_a_Field_in_a_Text_Box.html for shp in self.app.Documents(self.opendoc).Shapes: if shp.TextFrame.HasText: shp.TextFrame.TextRange.Find.Text = source shp.TextFrame.TextRange.Find.Replacement.Text = target shp.TextFrame.TextRange.Find.Execute(Replace=1,Forward=True) #My Usage word=Word(visible=1,screenupdating=1) word.open(r'C:\Invoice Automation\testTB.doc') word.replace('[PGN]','1') The for shp in self.app .. section is my attempt to hit the text boxes. It seems to find the text box, but it doesn't replace anything.

  Read the article

• How to delete a large cookie that causes Apache to 400

  - by jakemcgraw

  I've come across an issue where a web application has managed to create a cookie on the client, which, when submitted by the client to Apache, causes Apache to return the following: HTTP/1.1 400 Bad Request Date: Mon, 08 Mar 2010 21:21:21 GMT Server: Apache/2.2.3 (Red Hat) Content-Length: 7274 Connection: close Content-Type: text/html; charset=iso-8859-1 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML 2.0//EN"> <html><head> <title>400 Bad Request</title> </head><body> <h1>Bad Request</h1> <p>Your browser sent a request that this server could not understand.<br /> Size of a request header field exceeds server limit.<br /> <pre> Cookie: ::: A REALLY LONG COOKIE ::: </pre> </p> <hr> <address>Apache/2.2.3 (Red Hat) Server at www.foobar.com Port 80</address> </body></html> After looking into the issue, it would appear that the web application has managed to create a really long cookie, over 7000 characters. Now, don't ask me how the web application was able to do this, I was under the impression browsers were supposed to prevent this from happening. I've managed to come up with a solution to prevent the cookies from growing out of control again. The issue I'm trying to tackle is how do I reset the large cookie on the client if every time the client tries to submit a request to Apache, Apache returns a 400 client error? I've tried using the ErrorDocument directive, but it appears that Apache bails on the request before reaching any custom error handling.

  Read the article

• Sanitize a string with non-alphanum repetition

  - by Toto

  I need to sanitize article titles when (creative) users try to "attract attention" with some non-alphanum repetition. Exemples: Buy my product !!!!!!!!!!!!!!!!!!!!!!!! Buy my product !? !? !? !? !? !? Buy my product !!!!!!!!!.......!!!!!!!! Buy my product <----------- Some acceptable solution would be to reduce the repetition of non-alphanum to 2. So I would get: Buy my product !! Buy my product !? !? Buy my product !!..!! Buy my product <-- This solution did not work that well: preg_replace('/(\W{2,})(?=\1+)/', '', $title) Any idea how to do it in PHP with regex? Other better solution is also welcomed (I cannot strip all the non-alphanum characters as they can make sense). Edit: the objective is only to avoid most common issues. The other creative cases will be sanitized manually or sanitized with an other regex.

  Read the article

• How can I make this Matlab program possible?

  - by lebland-matlab

  I do not know how to combine the indices with the characters, Could you help me to make this program possible: clc; clear all; set1={F,G,FF,GG,X,Y,XX,L,BH,JK}; %set of name vectors set2={J,K,HG,UY,TR,BC,XW,IOP,ES,QA}; %set of name vectors set3={AJ,RK,DS,TU,WS,ZZE,ZXW,TYP,ZAA,QWW}; %set of name vectors for i=1:1:9 load('C:\Users\Documents\MATLAB\myFile\matrice_'set1(i)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set1(i+1)'.mat'); 'set1(i)' = m_'set1(i)'; 'set1(i+1)' = m_'set1(i+1)'; for j=1:1:9 load('C:\Users\Documents\MATLAB\myFile\matrice_'set2(j)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set2(j+1)'.mat'); 'set2(j)' = m_'set2(j)'; 'set2(j+1)' = m_'set2(j+1)'; for k=1:1:8 load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k+1)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k+2)'.mat'); 'set3(k)' = m_'set3(k)' ; 'set3(k+1)' = m_'set3(k+1)'; 'set3(k+2)' = m_'set3(k+2)'; [Result1'index',Result2'index',Result3'index',Result4'index',Result5'index'] = myFun('set1(i)','set1(i+1)','set2(j)','set2(j+1)','set3(k)','set3(k+1)','set3(k+2)'); %% 9x9x8=648 index=1,2,...,648 file_name = 'matrice_final'index'.mat'; save(file_name,'Result1'index'','Result2'index'','Result3'index'','Result4'index'','Result5'index''); clear 'set3(k)' 'set3(k+1)' 'set3(k+2)' end clear 'set2(j)' 'set2(j+1)' end clear 'set1(i)' 'set1(i+1)' end

  Read the article

• Infinite loop in regex in java

  - by carpediem

  Hello, My purpose is to match this kind of different urls: url.com my.url.com my.extended.url.com a.super.extended.url.com and so on... So, I decided to build the regex to have a letter or a number at start and end of the url, and to have a infinite number of "subdomains" with alphanumeric characters and a dot. For example, in "my.extended.url.com", "m" from "my" is the first class of the regex, "m" from "com" is the last class of the regex, and "y.", "extended." and "url." are the second class of the regex. Using the pattern and subject in the code below, I want the find method to return me a false because this url must not match, but it uses 100% of CPU and seems to stay in an infinite loop. String subject = "www.association-belgo-palestinienne-be"; Pattern pattern = Pattern.compile("^[A-Za-z0-9]\\.?([A-Za-z0-9_-]+\\.?)*[A-Za-z0-9]\\.[A-Za-z]{2,6}"); Matcher m = pattern.matcher(subject); System.out.println(" Start"); boolean hasFind = m.find(); System.out.println(" Finish : " + hasFind); Which only prints: Start I can't reproduce the problem using regex testers. Is it normal ? Is the problem coming from my regex ? Could it be due to my Java version (1.6.0_22-b04 / JVM 64 bit 17.1-b03) ? Thanks in advance for helping.

  Read the article

• How to change identifier quote character in SSIS for connection to ODBC DSN

  - by William Rose

  I'm trying to create an SSIS 2008 Data Source View that reads from an Ingres database via the ODBC driver for Ingres. I've downloaded the Ingres 10 Community Edition to get the ODBC driver, installed it, set up the data access server and a DSN on the server running SSIS. If I connect to the SQL Server 2008 Database Engine on the server running SSIS, I can retrieve data from Ingres over the ODBC DSN by running the following command: SELECT * FROM OPENROWSET( 'MSDASQL' , 'DSN=IngresODBC;UID=testuser;PWD=testpass' , 'SELECT * FROM iitables') So I am quite sure that the ODBC setup is correct. If I try the same query with SQL Server style bracketed identifier quotes, I get an error, as Ingres doesn't support this syntax. SELECT * FROM OPENROWSET( 'MSDASQL' , 'DSN=IngresODBC;UID=testuser;PWD=testpass' , 'SELECT * FROM [iitables]') The error is "[Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 1, Unexpected character '['.". What I am finding is that I get the same error when I try to add tables from Ingres to an SSIS Data Source View. The initial step of selecting the ODBC Provider works fine, and I am shown a list of tables / views to add. I then select any table, and try to add it to the view, and get "ERROR [5000A] [Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 3, Unexpected character '['.". Following Ed Harper's suggestion of creating a named query also seems to be stymied. If I put into my named query the following text: SELECT * FROM "iitables" I still get an error: "ERROR [5000A] [Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 2, Unexpected character '['". According to the error, the query text passed by SSIS to ODBC was: SELECT [iitables].* FROM ( SELECT * FROM "iitables" ) AS [iitables] It seems that SSIS assumes that bracket quote characters are acceptable, when they aren't. How can I persuade it not to use them? Double quotes are acceptable.

  Read the article

• Asymptotic complexity of a compiler

  - by Meinersbur

  What is the maximal acceptable asymptotic runtime of a general-purpose compiler? For clarification: The complexity of compilation process itself, not of the compiled program. Depending on the program size, for instance, the number of source code characters, statements, variables, procedures, basic blocks, intermediate language instructions, assembler instructions, or whatever. This is highly depending on your point of view, so this is a community wiki. See this from the view of someone who writes a compiler. Will the optimisation level -O4 ever be used for larger programs when one of its optimisations takes O(n^6)? Related questions: When is superoptimisation (exponential complexity or even incomputable) acceptable? What is acceptable for JITs? Does it have to be linear? What is the complexity of established compilers? GCC? VC? Intel? Java? C#? Turbo Pascal? LCC? LLVM? (Reference?) If you do not know what asymptotic complexity is: How long are you willing to wait until the compiler compiled your project? (scripting languages excluded)

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Lotus Notes - Export emails to plain text file

  - by mbeckish

  I am setting up a Lotus Notes account to accept emails from a client, and automatically save each email as a plain text file to be processed by another application. So, I'm trying to create my very first Agent in Lotus to automatically export the emails to text. Is there a standard, best practices way to do this? I've created a LotusScript Agent that pretty much works. However, there is a bug - once the Body of the memo exceeds 32K characters, it starts inserting extra CR/LF pairs. I am using Lotus Notes 7.0.3. Here is my script: Sub Initialize On Error Goto ErrorCleanup Dim session As New NotesSession Dim db As NotesDatabase Dim doc As NotesDocument Dim uniqueID As Variant Dim curView As NotesView Dim docCount As Integer Dim notesInputFolder As String Dim notesValidOutputFolder As String Dim notesErrorOutputFolder As String Dim outputFolder As String Dim fileNum As Integer Dim bodyRichText As NotesRichTextItem Dim bodyUnformattedText As String Dim subjectText As NotesItem ''''''''''''''''''''''''''''''''''''''''''''''''''''''' 'INPUT OUTPUT LOCATIONS outputFolder = "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\" notesInputFolder = "IBEmails" notesValidOutputFolder = "IBEmailsDone" notesErrorOutputFolder="IBEmailsError" ''''''''''''''''''''''''''''''''''''''''''''''''''''''' Set db = session.CurrentDatabase Set curview = db.GetView(notesInputFolder ) docCount = curview.EntryCount Print "NUMBER OF DOCS " & docCount fileNum = 1 While (docCount > 0) 'set current doc to Set doc = curview.GetNthDocument(docCount) Set bodyRichText = doc.GetFirstItem( "Body" ) bodyUnformattedText = bodyRichText.GetUnformattedText() Set subjectText = doc.GetFirstItem("Subject") If subjectText.Text = "LotusAgentTest" Then uniqueID = Evaluate("@Unique") Open "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\email_" & uniqueID(0) & ".txt" For Output As fileNum Print #fileNum, "Subject:" & subjectText.Text Print #fileNum, "Date:" & Now Print #fileNum, bodyUnformattedText Close fileNum fileNum = fileNum + 1 Call doc.PutInFolder(notesValidOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End If doccount = doccount-1 Wend Exit Sub ErrorCleanup: Call sendErrorEmail(db,doc.GetItemValue("From")(0)) Call doc.PutInFolder(notesErrorOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End Sub Update Apparently the 32KB issue isn't consistent - so far, it's just one document that starts getting extra carriage returns after 32K.

  Read the article

• What are the limitations of the .NET Assembly format?

  - by McKAMEY

  We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

  Read the article

• How to preprocess text to do OCR error correction

  - by eaglefarm

  Here is what I'm trying to accomplish: I need to get a several large text files from a computer that is not networked and has no other output except a printer. I tried printing the text, then scanning the printout with OCR to recover the text on another computer but the OCR gets lots of errors (1 vs l, o vs 0, O vs D, etc). To solve this I am thinking of writing a program to process (annotate?) the text file, before printing it, so that the errors can be corrected from the text output of the OCR program. For example, for 1 (number one) vs l (letter L), I could change the text like this: sample inserting \nnn after characters that are frequently wrong in the OCR results: sampl\108e Then I can write another program to examine the file, looking for \nnn and check the character before the \nnn (where nnn is the ascii code in decimal) and fix it if necessary. Of course the program will have to recognize that the \nnn may have errors too but at least it knows that the nnn are digits and can easily correct them. I think I would add a CRC on each line so that any line that isn't corrected perfectly can be flagged as having a problem. Has anyone done anything like this? If there is an existing way of doing this I'd rather not reinvent the wheel. Or any suggestions for annotation format that would help solve this problem would be helpful too.

  Read the article

• Adding custom valiadtion to ASP.NET controls

  - by Brian

  We're trying to build a simple asp control for some clients where they can just drop in a single block - i.e. <captcha:CaptchaControl ID="CaptchaControl1" runat="server" Server="http://localhost:51947/" /> and have it render the control. The catch is that I can't get this to include custom validation. Right now I'm using the RenderContents function to display the layout of the control itself as well as hook it up the to Javascript. The problem is that I don't know how to get custom validation to fire when used as part of a control. protected override void RenderContents(HtmlTextWriter output) { output.Write(@" <script type=""text/javascript"" src=""http://ajax.googleapis.com/ajax/libs/jquery/1.3/jquery.min.js""></script> <link rel=""stylesheet"" type=""text/css"" href=""/Layout/CaptchaLayout.css"" /> //etc <asp:Textbox id=""text1"" runat=""server"" text=""""></asp:Textbox> <asp:CustomValidator id=""CustomValidator2"" runat=""server"" ControlToValidate = ""text1"" ErrorMessage = ""You must enter at least 8 characters!"" ClientValidationFunction=""validateLength"" > </asp:CustomValidator>" ); } Any suggestions for a better way to do this?

  Read the article

• What is happening in this T-SQL code?

  - by Ben McCormack

  I'm just starting to learn T-SQL and could use some help in understanding what's going on in a particular block of code. I modified some code in an answer I received in a previous question, and here is the code in question: DECLARE @column_list AS varchar(max) SELECT @column_list = COALESCE(@column_list, ',') + 'SUM(Case When Sku2=' + CONVERT(varchar, Sku2) + ' Then Quantity Else 0 End) As [' + CONVERT(varchar, Sku2) + ' - ' + Convert(varchar,Description) +'],' FROM OrderDetailDeliveryReview Inner Join InvMast on SKU2 = SKU and LocationTypeID=4 GROUP BY Sku2 , Description ORDER BY Sku2 Set @column_list = Left(@column_list,Len(@column_list)-1) Select @column_list ---------------------------------------- 1 row is returned: ,SUM(Case When Sku2=157 Then Quantity Else 0 End) As [157 -..., SUM(Case ... The T-SQL code does exactly what I want, which is to make a single result based on the results of a query, which will then be used in another query. However, I can't figure out how the SELECT @column_list =... statement is putting multiple values into a single string of characters by being inside a SELECT statement. Without the assignment to @column_list, the SELECT statement would simply return multiple rows. How is it that by having the variable within the SELECT statement that the results get "flattened" down into one value? How should I read this T-SQL to properly understand what's going on?

  Read the article

• Editing a labels text value through JavaScript in VB ASP.NET

  - by Ronnie

  I have a simple form containing two text boxes, I am attempting to apply some validation to the first text box using JavaScript. This is the first time I have attempted this and am having some trouble. I have a label beside the text box stating an error, this labels visibility property is set to False. I wish the labels visibility to turn true if the text box is empty when the user loses focus. For this I have used the onBlur option within the tags of the text box. It then calls the JavaScript function and should set the label to Visible but it does not. I have tested to see if it is entering the function by using an alert instead and that works. The problem seems to be trying to alter the visibility property of the label. Here is the portion of my code: The JavaScript: function myRegEx(frm) { if ( boxUsername.value == "" ) { invalidUser.visible = True; return false; } } The form: <asp:TextBox onblur="return myRegEx(this)" id="boxUsername" runat="server" Width="200px"></asp:TextBox> <asp:Label id="invalidUser" runat="server" visible="False" forecolor="Red" text="* Username must be alphanumeric with no special characters"></asp:Label> Any help would be brilliant.

  Read the article

• How can I store HTML in a Doctrine YML fixture

  - by argibson

  I am working with a CMS-type site in Symfony 1.4 (Doctrine 1.2) and one of the things that is frustrating me is not being able to store HTML pages in YML fixtures. Instead I have to create SQL backups of the data if I want to drop and rebuild which is a bit of a pest when Symfony/Doctrine has a fantastic mechanism for doing exactly this. I could write a mechanism that reads in a set of HTML files for each page and fills the data in that way (or even write it as a task). But before I go down that road I am wondering if there is any way for HTML to be stored in a YML fixture so that Doctrine can simply import it into the database. Update: I have tried using symfony doctrine:data-dump and symfony doctrine:data-load however despite the dump correctly creating the fixture with the HTML, the load task appears to 'skip' the value of the column with the HTML and enters everything else into the row. In the database the field doesn't show up as 'NULL' but rather empty so I believe Doctrine is adding the value of the column as ''. Below is a sample of the YML fixture that symfony doctrine:data-dump created. I have tried running symfony doctrine:data-load against various forms of this including removing all the escaped characters (new lines and quotes leaving only angle brackets) but it still doesn't work. Product_69: name: 'My Product' Developer: Developer_30 tagline: 'Text that briefly describes the product' version: '2008' first_published: '' price_code: A79 summary: '' box_image: '' description: "<div id=\"featureSlider\">\n <ul class=\"slider\">\n <li class=\"sliderItem\" title=\"Summary\">\n <div class=\"feature\">\n Some text goes in here</div>\n </li>\n </ul>\n </div>\n" is_visible: true

  Read the article

• Parsing Lisp S-Expressions with known schema in C#

  - by Drew Noakes

  I'm working with a service that provides data as a Lisp-like S-Expression string. This data is arriving thick and fast, and I want to churn through it as quickly as possible, ideally directly on the byte stream (it's only single-byte characters) without any backtracking. These strings can be quite lengthy and I don't want the GC churn of allocating a string for the whole message. My current implementation uses CoCo/R with a grammar, but it has a few problems. Due to the backtracking, it assigns the whole stream to a string. It's also a bit fiddly for users of my code to change if they have to. I'd rather have a pure C# solution. CoCo/R also does not allow for the reuse of parser/scanner objects, so I have to recreate them for each message. Conceptually the data stream can be thought of as a sequence of S-Expressions: (item 1 apple)(item 2 banana)(item 3 chainsaw) Parsing this sequence would create three objects. The type of each object can be determined by the first value in the list, in the above case "item". The schema/grammar of the incoming stream is well known. Before I start coding I'd like to know if there are libraries out there that do this already. I'm sure I'm not the first person to have this problem.

  Read the article

< Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >