Search Results

Search found 54 results on 3 pages for 'jedi'.

Page 2/3 | < Previous Page | 1 2 3  | Next Page >

  • Error with a getJSON call in jquery with ASP.NET MVC

    - by Jedi Master Spooky
    I have the following code in html, I cannot get the Function call back of JSON get call. Down is the code in controller. Please Help <script type="text/javascript"> $().ready(function() { $("#CuitDespachante").typeWatch({ highlight: true, wait: 500, captureLength: -1, callback: finished }); }); function finished(txt) { $.getJSON('/Documentacion/GetDatosDespachantes', { cuitDespachante: txt }, function (data) { alert('You typed: '); } ); }; </script> public ActionResult GetDatosDespachantes(string cuitDespachante) { cuitDespachante = cuitDespachante.Replace("-", "").Replace("_", ""); DepositarioFielWS.DepositarioFielWebService ws = new DepositarioFielWS.DepositarioFielWebService(); var res = ws.GetDespachante(cuitDespachante); if (res.Licencia.CodigoLicencia == DepositarioFielWS.CodigoLicencia.Ok) { DepositarioFielWS.Despachante desp = new DepositarioFielWS.Despachante(); desp.Cuit = res.Despachante.Cuit; desp.Nombre = res.Despachante.Nombre; var respuesta =new { cuit = desp.Cuit, nombre = desp.Nombre }; return Json(respuesta); } else { var respuesta = new { cuit = cuitDespachante, nombre = "Imposible Realizar Consulta" }; return Json(respuesta); } }

    Read the article

  • Image service for a Application

    - by Jedi Master Spooky
    I am creating and application that need to save images. I don't want to write it if it already exits, Anyone know of a product that I can use so I don't have to develop mine. I am using asp.net MVC. What I want is something with and API that I can save to and retrieve to ( I don't want to store the images in my system if its possible). Thanks

    Read the article

  • Star Wars Roguelike Combines Star Wars and Old School ASCII Adventures

    - by Jason Fitzpatrick
    Mashup ASCII-based adventuring, Star Wars, and some sweet light saber sound effects, and you’ve got this old-school in-browser adventure game: Star Wars Roguelike. Play a Jedi or Sith and move about the ASCII world with simple keyboard commands. You’re not going to be blow away by the photo-realistic graphics, but you are going to be able to play it on your aging work computer. Hit up the link below to take the game for a spin. Star Wars Roguelike [via Boing Boing] How To Boot Your Android Phone or Tablet Into Safe Mode HTG Explains: Does Your Android Phone Need an Antivirus? How To Use USB Drives With the Nexus 7 and Other Android Devices

    Read the article

  • How to use LINQ to query list of strings that do not contain substring entries from another list

    - by p.campbell
    string candidates = new string[] { "Luke_jedi", "Force_unknown", "Vader_jedi" , "Emperor_human", "r2d2_robot" }; string[] disregard = new string[] {"_robot", "_jedi"}; //find those that aren't jedi or robots. var nonJedi = candidates.Where(c=> c.??? //likely using EndsWith() and Any() ); How would you implement this solution using LINQ to find all those that do not end with any of the disregards items?

    Read the article

  • Apache redirect from one domain to another domain

    - by cpuguru
    Like many users, we tend to register the *.com and *.net versions of our domain names to prevent nefarious squatters. So if we wanted "foo.com" we'd also register "foo.net" and have them both resolve to the same IP address. Trying to set up Apache for the first time and need to know the proper way to redirect requests to "foo.net" to go to "foo.com" instead so that if a user types in "foo.net" they get magically redirected to "foo.com". I've been reading through the Apache URL Rewriting guide (http://httpd.apache.org/docs/1.3/misc/rewriteguide.html) and it's not readily apparent how to do this seemingly simple task. Please advise this apprentice oh wise Apache jedi...

    Read the article

  • Vim: How to install plugin for a particular filetype?

    - by ronnie
    Yesterday I came across jedi-vim plugin which provides auto-completion for python. I installed the plugin using pathogen by placing it in bundle directory and it is working fine. Now, as I have mentioned that this plugin is only for filetype: python so I want to load it only when I open files with .py extensions and not when I open other files like .java, .perl, .sh. So, how can this be achieved. I am a vim beginner/noob but I googled before asking and found that this can be achieved using vim ftplugin but I have no idea whatsoever where to place which file.

    Read the article

  • Sharing git repo without SSH

    - by user13323
    Hi. I'm trying to set-up a private git repo for code sharing, but found out that most of the implementations out there require use of SSH public keys, for example: http://www.jedi.be/blog/2009/05/06/8-ways-to-share-your-git-repository/ The only approach looking reasonable is the git-daemon, but it does not contain any authentication, and while it might be a good option for LAN, it is no go for remote working. Coming from SVN daemon, where all the access was conveniently controlled via single file, the SSH keys scheme quite a hurdle for me. Is there any way to securely share multiple Git repositories, without using SSH authentication? Thanks in advance!

    Read the article

  • Productive Toolset for C# Developer

    - by Marko Apfel
    Programming Visual Studio ReSharper Agent Johnson Agent Smith StyleCop for ReSharper Keymaps SettingsManager Git Source Control Provider Gist NuGet Package Manager NDepend Productivity Power Tools PowerCommands for Visual Studio PostSharp Indent Guides Typemock Isolator VSCommands Ressource Refactor Clone Detective GhostDoc CR_Documentor AnkSVN Expression Blend SharpDevelop Notepad++, PS Pad StyleCop, FxCop, .. .NET Reflector, ILSpy, dotPeek, Just Decompile Git Extensions inkl. MSysGit, MinGW Github for Windows SmartGit PoSH-Git Console Enhancement Project LINQPad Mercurial RapidSVN SQL Management Studio Adventure Works Sample DB AdventureWorksLT Toad for SQL Server yEd Graph Editor TeX, LateX MiKTeX, TeXworks Pandoc Jenkins, TeamCity KompoZer XML Notepad Kaxaml KDiff3, WinMerge, Perforce Merge Handle DbgView FusLogVw FTP Commander HTML Help Workshop, Sandcastle, SHFB WiX Enterprise Architect InsightProfiler Putty Cygwin DXCore, DXCore Plugins FreeMind ProcessExplorer, ProcessMonitor Social Networking, Community Windows Live Writer Disgsby Skype TweetDeck FeedReader Sytem and others Microsoft Office (notably OneNote!!!) Adobe Reader PDF Creator SRWare Iron (Chrome) AddThis bit-ly del.icio.us InstaPaper Leo Dictionary Google Bookmarks Proxy Switchy! StumbleUpon K-Meleon FreeCommander, FAR 7-Zip Keyboard Jedi Launchy TrueCrypt Dropbox Ditto Greenshot Rainlendar2 Everything Daemon Tools inSSIDer VirtualBox Stardock Fences Media Player Classic VLC Media Player Winamp WinAmp Cue Player LAME Encoder CamStudio Youtube to MP3 Converter VirtualDub Image Resizer Powertoy Clone 2.0 Paint.NET Picasa Windy JediConcentrate, Ghoster TeamViewer Timerle TreeSizeFree WinDirStat Windows Sizer, WinResizer ZoomIt Sometimes nice to have ArcGIS TortoiseSVN, TortoiseCVS XnView GitJungle CowSpy Grindstone Free Download Manager CDBurnerXP Free Audio CD Burner SmartAssembly intellibook GMX SMS Manager BlackBerry Desktop Cisco Any Connect eRoom Foxit Reader Google Earth ThinkVantage GPS Gridy Bluefish The GodFather Tor Browser, Charon YouTube Downloader NCover Network Stumbler Remote Debugger WScite XML Pad DBVisualizer Microsoft Network Monitor, Fiddler2 Eclipse IDE Oracle Client, Oracle SQL Developer Bookmarks, Links http://pastebin.de/, http://pastebin.com/ http://followup.cc  http://trello.com http://tumblr.com https://bitly.com/, http://is.gd http://www.famkruithof.net/uuid/uuidgen, http://www.guidgenerator.com/ https://github.com/, https://bitbucket.org/ http://dict.leo.org/, http://translate.google.com/ http://prezi.com/ http://geekswithblogs.net/Default.aspx, http://codebetter.com/ http://duckduckgo.com/bang.html   http://de.schreibtrainer.com/index.php?site=3&menuId=3 http://www.mr-wetter.de/ this is an update to http://geekswithblogs.net/mapfel/archive/2010/07/12/140877.aspx

    Read the article

  • CodePlex Daily Summary for Wednesday, June 16, 2010

    CodePlex Daily Summary for Wednesday, June 16, 2010New ProjectsAtomFeedBuilder: Simple and lightweight Atom feed builder. Developed in VB.Net.Cable and Wire harness tester: If you build lots of cable/wire harness' you know that testing them is a pain. I have wanted an automated cable tester for a while now but commerci...Carmenta Engine Power Pack: The target of Carmenta Engine Power Pack is to provide extensions, utilities and wrapper classes that allows developers to work more efficiently w...Customer Book: Customer Book, its like address book with facility for generating quotation for a business or a supplier to the clients.Dialector: Using this program, you can convert pure Turkish texts into different dialects; such as: Emmi, Kufurbaz, Kusdili, Laz, Peltek, Tiki, and many more....Downline Commision Generator: Analyze the compensations plan of the organizations in multi-level marketing or network marketing. Check with this tool the commision plan of the c...EmbeddedSpark 2010 Project M: Project M is a system for seamlessly interfacing a tabletop interface to portable devices placed upon it. Using image recognition and projectors, P...Event Log Creator by eVestment Alliance: Provides a simple utility to create a new source and log in the Windows event log. The utility checks if the current user is an administrator, and...ExchangeHog: Desktop/daemon application that aggregates emails from multiple pop3-accounts into single Microsoft Exchange 2010 account. For users receiving ema...Extra Time Calculator: Extra Time Calculator allows exam end times to be easily calculated for students receiving an extra time accommodation.Generic WCF Hosting Service: The Generic Host Service provides a simple, reusable, and reliable mechanism for hosting WCF services. Google Storage for .NET: Google Storage for .NET (GSN) is an open source library that provides .NET developers with easy access to the Google Storage API. The library allo...Helium: The Helium XNA game engine is a light portable game engine designed to work on many platforms and soon to be expanded on more. Currently the helium...IconizedButton Control Set: ASP.NET WebForms IconizedButton Custom Control Set. Replaces the dull Button/LinkButton/HyperLink controls with styling and left and right aligned...Jedi Council PM List: Allows for users to process Private Message Lists on the Jedi Council forums for TheForce.Net.JetPumpDesign: 本软件为蒸气喷射泵设计计算软件 作者:申阳 单位:西安交通大学过程装备与控制工程61班log4Nez: An high personalized implementation of a logging libraryMutantFramework: Provides a common set of building blocks for building enterprise applicationsNUnit Add-in for Growl Notifications: NUnit add-in which allows to send notifications to Growl when test run is started or finished, when a first test failure occurs and so on.Object Reports: Object Reports is a "proof of concept" application which provides users the ability to visualy build queries based on data stored in the relational...openTrionyx: openTrionyx is a set of tools to make easier web application development. Includes Data, Web and plain text documents tools. Developed in C#, compl...Partial Rendering control for MVC 2: This project shows a web custom control that allow to have partial rendering using async post-back (through JQuery) in a MVC 2 web application.PowerGUI Visual Studio Extension: The PowerGUI Visual Studio Extension exposes PowerGUI as an editor in Visual Studio. PowerShell developers can now write scripts directly in Visual...PowerShell Script Provider: Write your own PowerShell provider using only script, no C# required. Module definition is provided by a Windows PowerShell 2.0 Module, which may b...Scholar: Scholar is a solution/framework for .Net developers to help with the creation of distributed data processing (think SETI@home style apps). It is in...scrabb: Scrabb help people play scrabble over net.SharePointNuke: A DotNetNuke module that connects to a SharePoint server using web services API and displays the content of a specified list. SolidWorksBackConverter: a Project to Convert a solidwork file to an older version Soma - Sql Oriented MApping framework: Sql Oriented MApping framework.SPCreate: SPCreate auto store procedure creator. It's developed in c#. SpCreate as output ADO.NET Class (C# or VB.Net) and SQL Server or MS Access Store pro...std::streambuf wrapper for COM IStream: This provides a subclass of std::streambuf that wraps a COM IStream, so you can use an IStream with any C++ code that uses iostreams or the STL alg...VACID solutions: Solutions of verification problems posed in paper "Verification of Ample Correctness of Invariants of Data-structures". Developed with various tool...Viewer: Our Goal is to create a C# project that will centeralize Image and Movie Viewing in a forms application, It will also have a Specialized Webbrowser...vsXPathTester: vsXPathTester is a utility for Developer. This help them load XML file and the run their XPath Query. The Resultant is shown in window. It save the...New Releases.Net Max Framework: Version 1.0.0: Version 1.0.0 - EstableAndrew's XNA Helpers: V1.2: Features upgraded features based off of the V1.1 code for both X86 and XBOX Additions/Changes Reworked the Texture2D and Rectangle extender namesp...BaseCalendar: BaseControls 1.2: BaseControls 1.2 contains the BaseCalendar ASP.NET control. Changes: 1.2 Exposed EffectiveVisibleDate and FirstVisibleDay methods 1.1 Rendering ...Customer Book: Customer Book Code: Bronze Release PostgreSQL database dump for Customer Book. Open PgAdmin III and restore the database dump into your server. Notice User Name for t...Data Connection Suite: Data Connections Suite v1.0.0.0: This is the first release of this incomplete component, but good enought to use in a production environment (it's what we do).DigitArchive: Build 8: Now the software works on .NET 3.5 and above. So if you have Windows 7 it installs without any pre-requisites. Changes: -Works on .NET 3.5 -Now t...Doom 64 Ex (SVN Builds): Doom 64 Ex r-738: Finally a new build after so many months. There are way to many updates to even begin to write about here just download and frag away. There is a s...DotNetNuke® Media: 03.03.00a: This release is Beta!! There is no guaranteed upgrade path to the 03.03.00 release version! Please use this to help us and test what we have. Repor...Downline Commision Generator: Downline Commision Generator: Downline Commision GeneratorElmah2 : An extensable error logger for ASP.net: 1.0 Beta 1: This is a beta release be sure to report any errors etc. Be sure to check out the documentation tab on information on how to install and configure...EPiServer Template Foundation: First compiled release: First compiled release for experimenting only! :) An introductory post will be published shortly on the blog.Helium: Initial Release: This is the initial release of the Helium Engine. Please check out the documentation link for information on how to use the engine. To see a ful...IconizedButton Control Set: IconizedButton Control Set: Taking a line from Google's play book - marking everything as Beta. Seriously, I'd like to hear some feedback before moving the Development Status...JetPumpDesign: JetPumpDesign 1.0: 当前的软件可以设计5级以内的蒸汽喷射泵。Microsoft Silverlight Analytics Framework: Version 1.4.4 Installer: Tools TargetingVisual Studio 2010 Expression Blend 4 (part of Expression Studio 4) Analytics Services Included Vendor Behavior Silverlight 3...NHibernate Sidekick Library: 0.7.0: Added a few methods for use with the NHibernate 2nd level cache (EvictAllObjectsFromCache and EvictPersistentClass). I also added the boolean optio...NHibernate Sidekick Library: 0.7.5: Fix for http://nhprof.com/Learn/Alerts/DoNotUseImplicitTransactionsNito.KitchenSink: Version 9: Dependencies Nito.Linq 0.6 Beta (released 2010-06-14) Rx 1.0.2563.0 (released 2010-06-09) Supported Platforms .NET 4.0 Client Profile, with Rx. ...NQueue: Version 1.0.0.0: Version 1.0.0.0NUnit Add-in for Growl Notifications: NUnit Add-in for Growl Notifications 1.0 build 0: The very first stable releasePartial Rendering control for MVC 2: Partial Rendering control for MVC 2: Here there is the source code and a MVC 2 web site as testPowerShell Script Provider: PSProvider 0.1: Requires PowerShell 2.0 RTM The functions in the attached ps1 script are the bare minimum for a working container-style provider (no subfolders.) ...Quick Performance Monitor: Version 1.4.3: Fixed issue where if an instance name contains backslash characters (\) the program would not load the performance counter properly. Also added sta...SharePointNuke: SharePointNuke 2.00.08: SharePointNuke 2.00.08 - Binary DotNetNuke 5.x module.Skype Voice Changer: 1.0 Updated Sample Code: This updated release is the accompanying code for the Skype Voice Changer article on Coding4Fun. Changes in this release: Added support for PreEmp...std::streambuf wrapper for COM IStream: Beta release (tested in a commercial project): This code has been tested in a custom Windows Search filter and property handler I wrote for a proprietary binary format. There may be some bugs, b...Sunlit World Scheme: Sunlit World Scheme - 20100615 - source and binary: This is the result of building the current source code in Debug mode. The source code is included. The binaries are in the SchemeCode folder along...Timo-Design / 40FINGERS DotNetNuke® Skinning Extensions: Style Helper Skin Object Beta: The 40FINGERS Style Helper Skin object allows you to add CSS and Javascript links and meta tags to the head of your page. It can also remove CSS l...Umbraco CMS: Umbraco 4.1 RC: This is the final test version of Umbraco 4.1 before the final release. PLEASE BE AWARE THAT UMBRACO 4.1 RC IS A .NET 4.0 RELEASE AND WON'T WORK O...VCC: Latest build, v2.1.30615.0: Automatic drop of latest buildWCF 4 Templates for Visual Studio 2010: UserNameForCertificate Template: Produces a WCF service application supporting username and password authentication, relying on message security to protect messages en route. Suppl...WCF 4 Templates for Visual Studio 2010: UserNameOverHttps Template: Produces a WCF service application supporting username and password authentication over HTTPS/SSL, relying on transport security to protect message...xUnit.net Contrib: xunitcontrib 0.4.1 alpha (ReSharper 5.1.1709 only): xunitcontrib release 0.4.1 (ReSharper runner) This release targets the current nightly build of ReSharper 5.1's Early Access Programme (build 1709)...Most Popular ProjectsCommunity Forums NNTP bridgeRIA Services EssentialsNeatUploadBxf (Basic XAML Framework).NET Transactional File ManagerSOLID by exampleSSIS Expression Editor & TesterWEI ShareChirpy - VS Add In For Handling Js, Css, and DotLess FilesASP.NET MVC Time PlannerMost Active ProjectsdotSpatialRhyduino - Arduino and Managed CodeCassandraemonpatterns & practices – Enterprise LibraryCommunity Forums NNTP bridgeLightweight Fluent Workflowpatterns & practices: Enterprise Library ContribNB_Store - Free DotNetNuke Ecommerce Catalog ModuleBlogEngine.NETjQuery Library for SharePoint Web Services

    Read the article

  • Access USB devices through Delphi in Windows XP standard

    - by Lex Dean
    I have been studding this subject big time and got some code together big time Do not go near Jan Axelson's Lakeview Research its crap I'm telling you I found a jedi project not completed on the INtel web site that was a lot better. and much reading has opened doors to me I'm in desperate need for a registry reader that reads with out using TRegistry or the windows.pas call to find a registry key because this XP(+) call has a windows bug when calling HKEY_LOCAL_MACHINE root directory I'm using Delphi 4 that also does not have TBrkApart object if I had that object I can make my own registry access object or some one may know of an object Can any Some one one help please J Lex Dean email:- lexdeanair at hotmail.com

    Read the article

  • Why does my custom component raise AVs in the IDE?

    - by Mason Wheeler
    I'm trying to write a simple component that will allow you to embed one or more SDL rendering surfaces on a Delphi window, using the SDL 1.3 APIs. It will compile and install just fine, but when I try to use the component in the form designer, it raises AVs whenever I try to access its properties in the object inspector, save the form, or delete the component, and placing one on a form then trying to run gives a linker error: it apparently can't read the DFM properly for whatever reason. The DLL can be found at http://www.libsdl.org/tmp/SDL-1.3-dll.zip and the source code to my component can be downloaded here. SDL.pas is a JEDI-SDL header file; the rest is my own code. I don't see any reason for this to raise AVs in the form designer. If I dynamically create the control at runtime I don't have any stability issues. Can anyone take a look at this and maybe provide some feedback that might help me clear it up?

    Read the article

  • Conditional directive to identify C++ Builder personalities

    - by Narcís Calvet
    Hello, I have a Delphi component which I want to install and have it available at the component palette in Delphi but not in C++ Builder. In BDS/RAD 2006 and above I can either have it installed for both personalities or none. I need to do so because this component uses 3rd party libraries that doesn't support C++ Builder. I have looked at jedi.inc mentioned here but I'm not able to find the combination to be able to register the component in Delphi personalities only. The component should also work for D5, D6 and D7 but not for BCB5 and BCB6. Is this possible? BTW: Component is written in Delphi. C++ Builder shares same packages as Delphi. Thanks in advance.

    Read the article

  • Is there anyway to make Oracle faster?

    - by Husky110
    Hey people! I guess you people know more about this, than the ServerFault-Peps - If I'm wrong please correct me! Maybe you experienced it with the Oracle-Databasesystem too that it could use a hell of processorcapacity but it just takes something arround 10% so the processor is bored and your procedures are as fast as a snail in the desert. Do you know any way to say to the system something like: "Hey! You got a lot of power little database-jedi, so use it!" Thanks for your time and burned out braincells to answer this one! Greetz from Germany P.S.:I'm using Oracle 11gR1 here!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Delphi Exception handling problem with multiple Exception handling blocks

    - by Robert Oschler
    I'm using Delphi Pro 6 on Windows XP with FastMM 4.92 and the JEDI JVCL 3.0. Given the code below, I'm having the following problem: only the first exception handling block gets a valid instance of E. The other blocks match properly with the class of the Exception being raised, but E is unassigned (nil). For example, given the current order of the exception handling blocks when I raise an E1 the block for E1 matches and E is a valid object instance. However, if I try to raise an E2, that block does match, but E is unassigned (nil). If I move the E2 catching block to the top of the ordering and raise an E1, then when the E1 block matches E is is now unassigned. With this new ordering if I raise an E2, E is properly assigned when it wasn't when the E2 block was not the first block in the ordering. Note I tried this case with a bare-bones project consisting of just a single Delphi form. Am I doing something really silly here or is something really wrong? Thanks, Robert type E1 = class(EAbort) end; E2 = class(EAbort) end; procedure TForm1.Button1Click(Sender: TObject); begin try raise E1.Create('hello'); except On E: E1 do begin OutputDebugString('E1'); end; On E: E2 do begin OutputDebugString('E2'); end; On E: Exception do begin OutputDebugString('E(all)'); end; end; // try() end;

    Read the article

  • Delph Exception handling problem with multiple Exception handling blocks

    - by Robert Oschler
    I'm using Delphi Pro 6 on Windows XP with FastMM 4.92 and the JEDI JVCL 3.0. Given the code below, I'm having the following problem: only the first exception handling block gets a valid instance of E. The other blocks match properly with the class of the Exception being raised, but E is unassigned (nil). For example, given the current order of the exception handling blocks when I raise an E1 the block for E1 matches and E is a valid object instance. However, if I try to raise an E2, that block does match, but E is unassigned (nil). If I move the E2 catching block to the top of the ordering and raise an E1, then when the E1 block matches E is is now unassigned. With this new ordering if I raise an E2, E is properly assigned when it wasn't when the E2 block was not the first block in the ordering. Note I tried this case with a bare-bones project consisting of just a single Delphi form. Am I doing something really silly here or is something really wrong? Thanks, Robert type E1 = class(EAbort) end; E2 = class(EAbort) end; procedure TForm1.Button1Click(Sender: TObject); begin try raise E1.Create('hello'); except On E: E1 do begin OutputDebugString('E1'); end; On E: E2 do begin OutputDebugString('E2'); end; On E: Exception do begin OutputDebugString('E(all)'); end; end; // try() end;

    Read the article

  • Why is my Lucene index getting locked?

    - by Andrew Bullock
    I had an issue with my search not return the results I expect. I tried to run Luke on my index, but it said it was locked and I needed to Force Unlock it (I'm not a Jedi/Sith though) I tried to delete the index folder and run my recreate-indicies application but the folder was locked. Using unlocker I've found that there are about 100 entries of w3wp.exe (same PID, different Handle) with a lock on the index. Whats going on? I'm doing this in my NHibernate configuration: c.SetListener(ListenerType.PostUpdate, new FullTextIndexEventListener()); c.SetListener(ListenerType.PostInsert, new FullTextIndexEventListener()); c.SetListener(ListenerType.PostDelete, new FullTextIndexEventListener()); And here is the only place i query the index: var fullTextSession = NHibernate.Search.Search.CreateFullTextSession(this.unitOfWork.Session); var fullTextQuery = fullTextSession.CreateFullTextQuery(query, typeof (Person)); fullTextQuery.SetMaxResults(100); return fullTextQuery.List<Person>(); Whats going on? What am i doing wrong? Thanks

    Read the article

  • Upgrade to Delphi 2010, or stick with Delphi 7 "forever"?

    - by tim11g
    I am an individual user of Delphi, starting back in the early Turbo Pascal days. I have quite a bit of code developed over the years, but I have never sold software commercially or used it for business. Historically, Borland supported the non-professional users with lower cost versions, but Embarcadero does not. As I consider upgrading to Delphi 2010, I am put off by the high price. Embarcadero is also trying to "encourage" upgrading by threatening to charge "new user" prices for upgrades after Dec 31st. I have several questions for the community to help me decide whether to upgrade. 1) I have read about difficulties updating existing code to support the unicode string types. I have no need for unicode strings, and I am happy with the string support in D7. Will I have to modify existing code and components just to re-compile under D2010? Or are there compiler options to allow backward compatibility if new string types are not required? 2) The main reason I'm considering upgrading is for IDE improvements, and to get access to new APIs added to Windows since 2002. Are there any Windows 7 APIs or capabilities that would be impossible to support from my programs compiled using using Delphi 7 (assuming appropriate JEDI API libraries, for example)? 3) Is there anything else about Delphi 2010 that is really compelling for someone who is primarily interested in Win32 apps, and not working with databases? I have read that D2010 is slow to load, and other versions between D7 and D2010 have had stability issues, and the help system was "broken". What is the biggest benefit to D2010?

    Read the article

  • PHP: What is an efficient way to parse a text file containing very long lines?

    - by Shaun
    I'm working on a parser in php which is designed to extract MySQL records out of a text file. A particular line might begin with a string corresponding to which table the records (rows) need to be inserted into, followed by the records themselves. The records are delimited by a backslash and the fields (columns) are separated by commas. For the sake of simplicity, let's assume that we have a table representing people in our database, with fields being First Name, Last Name, and Occupation. Thus, one line of the file might be as follows [People] = "\Han,Solo,Smuggler\Luke,Skywalker,Jedi..." Where the ellipses (...) could be additional people. One straightforward approach might be to use fgets() to extract a line from the file, and use preg_match() to extract the table name, records, and fields from that line. However, let's suppose that we have an awful lot of Star Wars characters to track. So many, in fact, that this line ends up being 200,000+ characters/bytes long. In such a case, taking the above approach to extract the database information seems a bit inefficient. You have to first read hundreds of thousands of characters into memory, then read back over those same characters to find regex matches. Is there a way, similar to the Java String next(String pattern) method of the Scanner class constructed using a file, that allows you to match patterns in-line while scanning through the file? The idea is that you don't have to scan through the same text twice (to read it from the file into a string, and then to match patterns) or store the text redundantly in memory (in both the file line string and the matched patterns). Would this even yield a significant increase in performance? It's hard to tell exactly what PHP or Java are doing behind the scenes.

    Read the article

  • Button inside of anchor link works in Firefox but not in Internet Explorer?

    - by Jason
    Everything else in my site seems to be compatible with all browsers except for my links. They appear on the page, but they do not work. My code for the links are as follows- <td bgcolor="#ffffff" height="370" valign="top" width="165"> <p><a href="sc3.html"><button style="width:120;height:25">Super Chem #3</button></a> <a href="91hollywood.html"><button style="width:120;height:25">91 Hollywood</button></a> <a href="sbubba.html"><button style="width:120;height:25">Super Bubba</button></a> <a href="afgoohash.html"><button style="width:120;height:25">Afgoo Hash</button></a> <a href="superjack.html"><button style="width:120;height:25">Super Jack</button></a> <a href="sog.html"><button style="width:120;height:25">Sugar OG</button></a> <a href="91pk91.html"><button style="width:120;height:25">91 x PK</button></a> <a href="jedi1.html"><button style="width:120;height:25">Jedi</button></a></p> <p>&nbsp;</p> <a href="http://indynile99.blogspot.com"><button style="width:120;height:25">Blog</button></a> <p>&nbsp;</p> </td> THANKS for the help!

    Read the article

  • Migrate from MySQL to PostgreSQL on Linux (Kubuntu)

    - by Dave Jarvis
    Storyline Trying to migrate a database from MySQL to PostgreSQL. All the documentation I have read covers, in great detail, how to migrate the structure. I have found very little documentation on migrating the data. The schema has 13 tables (which have been migrated successfully) and 9 GB of data. MySQL version: 5.1.x PostgreSQL version: 8.4.x I want to use the R programming language to analyze the data using SQL select statements; PostgreSQL has PL/R, but MySQL has nothing (as far as I can tell). A long time ago in a galaxy far, far away... Create the database location (/var has insufficient space; also dislike having the PostgreSQL version number everywhere -- upgrading would break scripts!): sudo mkdir -p /home/postgres/main sudo cp -Rp /var/lib/postgresql/8.4/main /home/postgres sudo chown -R postgres.postgres /home/postgres sudo chmod -R 700 /home/postgres sudo usermod -d /home/postgres/ postgres All good to here. Next, restart the server and configure the database using these installation instructions: sudo apt-get install postgresql pgadmin3 sudo /etc/init.d/postgresql-8.4 stop sudo vi /etc/postgresql/8.4/main/postgresql.conf Change data_directory to /home/postgres/main sudo /etc/init.d/postgresql-8.4 start sudo -u postgres psql postgres \password postgres sudo -u postgres createdb climate pgadmin3 Use pgadmin3 to configure the database and create a schema. A New Hope The episode began in a remote shell known as bash, with both databases running, and the installation of a command with a most unusual logo: SQL Fairy. perl Makefile.PL sudo make install sudo apt-get install perl-doc (strangely, it is not called perldoc) perldoc SQL::Translator::Manual Extract a PostgreSQL-friendly DDL and all the MySQL data: sqlt -f DBI --dsn dbi:mysql:climate --db-user user --db-password password -t PostgreSQL > climate-pg-ddl.sql mysqldump --skip-add-locks --complete-insert --no-create-db --no-create-info --quick --result-file="climate-my.sql" --databases climate --skip-comments -u root -p The Database Strikes Back Recreate the structure in PostgreSQL as follows: pgadmin3 (switch to it) Click the Execute arbitrary SQL queries icon Open climate-pg-ddl.sql Search for TABLE " replace with TABLE climate." (insert the schema name climate) Search for on " replace with on climate." (insert the schema name climate) Press F5 to execute This results in: Query returned successfully with no result in 122 ms. Replies of the Jedi At this point I am stumped. Where do I go from here (what are the steps) to convert climate-my.sql to climate-pg.sql so that they can be executed against PostgreSQL? How to I make sure the indexes are copied over correctly (to maintain referential integrity; I don't have constraints at the moment to ease the transition)? How do I ensure that adding new rows in PostgreSQL will start enumerating from the index of the last row inserted (and not conflict with an existing primary key from the sequence)? Resources A fair bit of information was needed to get this far: https://help.ubuntu.com/community/PostgreSQL http://articles.sitepoint.com/article/site-mysql-postgresql-1 http://wiki.postgresql.org/wiki/Converting_from_other_Databases_to_PostgreSQL#MySQL http://pgfoundry.org/frs/shownotes.php?release_id=810 http://sqlfairy.sourceforge.net/ Thank you!

    Read the article

  • SQL SERVER – Powershell – Importing CSV File Into Database – Video

    - by pinaldave
    Laerte Junior is my very dear friend and Powershell Expert. On my request he has agreed to share Powershell knowledge with us. Laerte Junior is a SQL Server MVP and, through his technology blog and simple-talk articles, an active member of the Microsoft community in Brasil. He is a skilled Principal Database Architect, Developer, and Administrator, specializing in SQL Server and Powershell Programming with over 8 years of hands-on experience. He holds a degree in Computer Science, has been awarded a number of certifications (including MCDBA), and is an expert in SQL Server 2000 / SQL Server 2005 / SQL Server 2008 technologies. Let us read the blog post in his own words. I was reading an excellent post from my great friend Pinal about loading data from CSV files, SQL SERVER – Importing CSV File Into Database – SQL in Sixty Seconds #018 – Video,   to SQL Server and was honored to write another guest post on SQL Authority about the magic of the PowerShell. The biggest stuff in TechEd NA this year was PowerShell. Fellows, if you still don’t know about it, it is better to run. Remember that The Core Servers to SQL Server are the future and consequently the Shell. You don’t want to be out of this, right? Let’s see some PowerShell Magic now. To start our tour, first we need to download these two functions from Powershell and SQL Server Master Jedi Chad Miller.Out-DataTable and Write-DataTable. Save it in a module and add it in your profile. In my case, the module is called functions.psm1. To have some data to play, I created 10 csv files with the same content. I just put the SQL Server Errorlog into a csv file and created 10 copies of it. #Just create a CSV with data to Import. Using SQLErrorLog [reflection.assembly]::LoadWithPartialName(“Microsoft.SqlServer.Smo”) $ServerInstance=new-object (“Microsoft.SqlServer.Management.Smo.Server“) $Env:Computername $ServerInstance.ReadErrorLog() | export-csv-path“c:\SQLAuthority\ErrorLog.csv”-NoTypeInformation for($Count=1;$Count-le 10;$count++)  {       Copy-Item“c:\SQLAuthority\Errorlog.csv”“c:\SQLAuthority\ErrorLog$($count).csv” } Now in my path c:\sqlauthority, I have 10 csv files : Now it is time to create a table. In my case, the SQL Server is called R2D2 and the Database is SQLServerRepository and the table is CSV_SQLAuthority. CREATE TABLE [dbo].[CSV_SQLAuthority]( [LogDate] [datetime] NULL, [Processinfo] [varchar](20) NULL, [Text] [varchar](MAX) NULL ) Let’s play a little bit. I want to import synchronously all csv files from the path to the table: #Importing synchronously $DataImport=Import-Csv-Path ( Get-ChildItem“c:\SQLAuthority\*.csv”) $DataTable=Out-DataTable-InputObject$DataImport Write-DataTable-ServerInstanceR2D2-DatabaseSQLServerRepository-TableNameCSV_SQLAuthority-Data$DataTable Very cool, right? Let’s do it asynchronously and in background using PowerShell  Jobs: #If you want to do it to all asynchronously Start-job-Name‘ImportingAsynchronously‘ ` -InitializationScript  {IpmoFunctions-Force-DisableNameChecking} ` -ScriptBlock {    ` $DataImport=Import-Csv-Path ( Get-ChildItem“c:\SQLAuthority\*.csv”) $DataTable=Out-DataTable-InputObject$DataImport Write-DataTable   -ServerInstance“R2D2″`                   -Database“SQLServerRepository“`                   -TableName“CSV_SQLAuthority“`                   -Data$DataTable             } Oh, but if I have csv files that are large in size and I want to import each one asynchronously. In this case, this is what should be done: Get-ChildItem“c:\SQLAuthority\*.csv” | % { Start-job-Name“$($_)” ` -InitializationScript  {IpmoFunctions-Force-DisableNameChecking} ` -ScriptBlock { $DataImport=Import-Csv-Path$args[0]                $DataTable=Out-DataTable-InputObject$DataImport                Write-DataTable-ServerInstance“R2D2″`                               -Database“SQLServerRepository“`                               -TableName“CSV_SQLAuthority“`                               -Data$DataTable             } -ArgumentList$_.fullname } How cool is that? Let’s make the funny stuff now. Let’s schedule it on an SQL Server Agent Job. If you are using SQL Server 2012, you can use the PowerShell Job Step. Otherwise you need to use a CMDexec job step calling PowerShell.exe. We will use the second option. First, create a ps1 file called ImportCSV.ps1 with the script above and save it in a path. In my case, it is in c:\temp\automation. Just add the line at the end: Get-ChildItem“c:\SQLAuthority\*.csv” | % { Start-job-Name“$($_)” ` -InitializationScript  {IpmoFunctions-Force-DisableNameChecking} ` -ScriptBlock { $DataImport=Import-Csv-Path$args[0]                $DataTable=Out-DataTable-InputObject$DataImport                Write-DataTable-ServerInstance“R2D2″`                               -Database“SQLServerRepository“`                               -TableName“CSV_SQLAuthority“`                               -Data$DataTable             } -ArgumentList$_.fullname } Get-Job | Wait-Job | Out-Null Remove-Job -State Completed Why? See my post Dooh PowerShell Trick–Running Scripts That has Posh Jobs on a SQL Agent Job Remember, this trick is for  ALL scripts that will use PowerShell Jobs and any kind of schedule tool (SQL Server agent, Windows Schedule) Create a Job Called ImportCSV and a step called Step_ImportCSV and choose CMDexec. Then you just need to schedule or run it. I did a short video (with matching good background music) and you can see it at: That’s it guys. C’mon, join me in the #PowerShellLifeStyle. You will love it. If you want to check what we can do with PowerShell and SQL Server, don’t miss Laerte Junior LiveMeeting on July 18. You can have more information in : LiveMeeting VC PowerShell PASS–Troubleshooting SQL Server With PowerShell–English Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQL Utility, T SQL, Technology, Video Tagged: Powershell

    Read the article

  • LsaAddAccountRights not working for me

    - by SteveL
    Using: Delphi 2010 and the JEDI Windows API and JWSCL I am trying to assign the Logon As A Service privilege to a user using LsaAddAccountRights function but it does not work ie. after the function returns, checking in Group Policy Editor shows that the user still does not have the above mentioned privilege. I'm running the application on Windows XP. Would be glad if someone could point out what is wrong in my code: unit Unit1; interface uses Windows, Messages, SysUtils, Variants, Classes, Graphics, Controls, Forms, Dialogs, StdCtrls, JwaWindows, JwsclSid; type TForm1 = class(TForm) Button1: TButton; procedure Button1Click(Sender: TObject); private { Private declarations } public { Public declarations } end; var Form1: TForm1; implementation {$R *.dfm} function AddPrivilegeToAccount(AAccountName, APrivilege: String): DWORD; var lStatus: TNTStatus; lObjectAttributes: TLsaObjectAttributes; lPolicyHandle: TLsaHandle; lPrivilege: TLsaUnicodeString; lSid: PSID; lSidLen: DWORD; lTmpDomain: String; lTmpDomainLen: DWORD; lTmpSidNameUse: TSidNameUse; lPrivilegeWStr: String; begin ZeroMemory(@lObjectAttributes, SizeOf(lObjectAttributes)); lStatus := LsaOpenPolicy(nil, lObjectAttributes, POLICY_LOOKUP_NAMES, lPolicyHandle); if lStatus <> STATUS_SUCCESS then begin Result := LsaNtStatusToWinError(lStatus); Exit; end; try lTmpDomainLen := DNLEN; // In 'clear code' this should be get by LookupAccountName SetLength(lTmpDomain, lTmpDomainLen); lSidLen := SECURITY_MAX_SID_SIZE; GetMem(lSid, lSidLen); try if LookupAccountName(nil, PChar(AAccountName), lSid, lSidLen, PChar(lTmpDomain), lTmpDomainLen, lTmpSidNameUse) then begin lPrivilegeWStr := APrivilege; lPrivilege.Buffer := PChar(lPrivilegeWStr); lPrivilege.Length := Length(lPrivilegeWStr) * SizeOf(Char); lPrivilege.MaximumLength := lPrivilege.Length; lStatus := LsaAddAccountRights(lPolicyHandle, lSid, @lPrivilege, 1); Result := LsaNtStatusToWinError(lStatus); end else Result := GetLastError; finally FreeMem(lSid); end; finally LsaClose(lPolicyHandle); end; end; procedure TForm1.Button1Click(Sender: TObject); begin AddPrivilegeToAccount('Sam', 'SeServiceLogonRight'); end; end. Thanks in advance.

    Read the article

  • Migrate from MySQL to PostgreSQL on Linux (Kubuntu)

    - by Dave Jarvis
    A long time ago in a galaxy far, far away... Trying to migrate a database from MySQL to PostgreSQL. All the documentation I have read covers, in great detail, how to migrate the structure. I have found very little documentation on migrating the data. The schema has 13 tables (which have been migrated successfully) and 9 GB of data. MySQL version: 5.1.x PostgreSQL version: 8.4.x I want to use the R programming language to analyze the data using SQL select statements; PostgreSQL has PL/R, but MySQL has nothing (as far as I can tell). A New Hope Create the database location (/var has insufficient space; also dislike having the PostgreSQL version number everywhere -- upgrading would break scripts!): sudo mkdir -p /home/postgres/main sudo cp -Rp /var/lib/postgresql/8.4/main /home/postgres sudo chown -R postgres.postgres /home/postgres sudo chmod -R 700 /home/postgres sudo usermod -d /home/postgres/ postgres All good to here. Next, restart the server and configure the database using these installation instructions: sudo apt-get install postgresql pgadmin3 sudo /etc/init.d/postgresql-8.4 stop sudo vi /etc/postgresql/8.4/main/postgresql.conf Change data_directory to /home/postgres/main sudo /etc/init.d/postgresql-8.4 start sudo -u postgres psql postgres \password postgres sudo -u postgres createdb climate pgadmin3 Use pgadmin3 to configure the database and create a schema. The episode continues in a remote shell known as bash, with both databases running, and the installation of a set of tools with a rather unusual logo: SQL Fairy. perl Makefile.PL sudo make install sudo apt-get install perl-doc (strangely, it is not called perldoc) perldoc SQL::Translator::Manual Extract a PostgreSQL-friendly DDL and all the MySQL data: sqlt -f DBI --dsn dbi:mysql:climate --db-user user --db-password password -t PostgreSQL > climate-pg-ddl.sql mysqldump --skip-add-locks --complete-insert --no-create-db --no-create-info --quick --result-file="climate-my.sql" --databases climate --skip-comments -u root -p The Database Strikes Back Recreate the structure in PostgreSQL as follows: pgadmin3 (switch to it) Click the Execute arbitrary SQL queries icon Open climate-pg-ddl.sql Search for TABLE " replace with TABLE climate." (insert the schema name climate) Search for on " replace with on climate." (insert the schema name climate) Press F5 to execute This results in: Query returned successfully with no result in 122 ms. Replies of the Jedi At this point I am stumped. Where do I go from here (what are the steps) to convert climate-my.sql to climate-pg.sql so that they can be executed against PostgreSQL? How to I make sure the indexes are copied over correctly (to maintain referential integrity; I don't have constraints at the moment to ease the transition)? How do I ensure that adding new rows in PostgreSQL will start enumerating from the index of the last row inserted (and not conflict with an existing primary key from the sequence)? How do you ensure the schema name comes through when transforming the data from MySQL to PostgreSQL inserts? Resources A fair bit of information was needed to get this far: https://help.ubuntu.com/community/PostgreSQL http://articles.sitepoint.com/article/site-mysql-postgresql-1 http://wiki.postgresql.org/wiki/Converting_from_other_Databases_to_PostgreSQL#MySQL http://pgfoundry.org/frs/shownotes.php?release_id=810 http://sqlfairy.sourceforge.net/ Thank you!

    Read the article

< Previous Page | 1 2 3  | Next Page >