Search Results

Search found 54 results on 3 pages for 'pearl'.

Page 2/3 | < Previous Page | 1 2 3  | Next Page >

  • Storage Forum at Oracle OpenWorld

    - by kgee
    For anyone attending Oracle OpenWorld and involved in Storage, join us at the Storage Forum & Reception. This special engagement offers you the ability to meet Oracle’s top storage executives, architects and fellow storage colleagues. Features include interactive sessions and round-table discussions on Oracle's storage strategy, product direction, and real-world customer implementations. It’s your chance to ask questions and learn first-hand about Oracle's response to top trends and what keeps storage managers up at night, including how to contain storage costs, improve performance, and ensure seamless integration with Oracle software environments. Featured Speakers: Mike Workman, SVP of Pillar Axiom Storage Group; Phil Bullinger, SVP of Sun ZFS Storage Group; and Jim Cates, VP of Tape Systems Storage Group Added Bonus: The Storage Forum will be followed by an exclusive Wine and Cocktail Reception where you can... Meet and network with peers, and other storage professionals Interact with Oracle’s experts in a fun and relaxed setting Wind down and prepare for the Oracle Customer Appreciation Event featuring Pearl Jam and Kings of Leon Date & Times:Wednesday, October 3, 20123:30 – 5:00 p.m. Forum 5:00 – 7:00 p.m. Reception Disclaimer: Space is limited, so register at http://bit.ly/PULcyR as soon as possible! If you want any more information, feel free to email [email protected]

    Read the article

  • Oracle ADF at Oracle OpenWorld 2012

    - by Shay Shmeltzer
    This year is going to be very busy for Oracle ADF developers who'll attend Oracle Open World. Check out the list of Oracle ADF related sessions, labs, demos and other Oracle ADF activities.  This list will help you not to miss any ADF related activity. We have over 50 ADF related sessions, multiple labs including new ones on ADF Mobile, Application Life Cycle Management and ADF in Eclipse, we'll have several demo booths where you can meet product managers, and we'll be featured in several keynotes as well. While we have several "beginners" sessions, you'll find that we have a lot of in-depth technical sessions and sessions that cover best-practices too. Of course, it is not just us product managers presenting about Oracle ADF, there are a lot of Oracle ADF sessions presented by customers, Oracle ACEs, and other developers. So you can learn from the experience of real life implementations. Note that the ADF content starts early on Sunday with a full set of Oracle ADF sessions arranged for you by the Oracle ADF Enterprise Methodology Group - so plan your trip accordingly and be there early Sunday morning. First thing on Monday morning, don't miss the keynote for Oracle ADF developers at 10:45 at the Marriott Marquis - Salon 8 - "The Future of Development for Oracle Fusion—From Desktop to Mobile to Cloud". We are also arranging a meet-up of developers using Oracle ADF at the OTN Lounge on Wed at 4:30pm - and we would love to meet you there - this will also give you an opportunity to meet other Oracle ADF users and members of the community. And after that we can all head over to the big Wed party to see Pearl Jam and Kings of Leon. One recommendation for those who are already registered - start planning your schedule and booking your place in the sessions now through the schedule builder. This will guarantee that you won't be left out of sessions you want to attend due room size limitations. Oracle OpenWorld 2013 will be a must attend event for serious Oracle ADF developers - don't miss it.

    Read the article

  • 8 Reasons to Attend Oracle OpenWorld 2012

    - by kgee
    Every year, the Oracle Hardware team recognizes the unique buzz that accompanies the season of OpenWorld. During the late nights kept possible by the grace of caffeine combined with the stress and eagerness for the event to run smoothly, we like to remind ourselves of why all our hard work is going to pay off. So, now that we've registered, here are some of our top reasons that we’re excited for Oracle OpenWorld 2012: The KeynotesJust to name a few...Larry Ellison, Mark Hurd, Thomas Kurian, John Fowler and many more are speaking live. We're expecting to walk away from the keynotes with a new frame of reference on a vast array of hot topics. NetworkingWhether it's through means of the OpenWorld Lounges, social media, or bars and cafes around Moscone Center, we'll be surrounded by people who are experts in the hardware field. Hardware SessionsThere are enough sessions to satisfy every Oracle hardware knowledge need. Hardware Experts in GeneralSo many experts that we wish we could be in two places at once sometimes. Pearl Jam & Kings of LeonRock out with these two legendary bands at the Oracle Appreciation Event! Oracle Music FestivalJoss Stone, Macy Gray, the Hives, and Jimmy Cliff will be welcome escapes at the end of each day at OpenWorld, and are just a couple more reasons these all nighters before OpenWorld are worth it. ORACLE TEAM USA and the America's Cup trophyAfter the sailors take on San Francisco Bay for Fleet Week, we’ll be soliciting them for autographs and taking pictures with them at OpenWorld. Location, Location, LocationThe Moscone Center is beautiful and in the best location in San Francisco. We know the OpenWorld hype will get to us sometimes, and it's nice to know that we have pretty much everything San Francisco has to offer at our finger tips. Why are you excited for #OOW? Tell us why!

    Read the article

  • What's Up for "We're Almost There" Wednesday

    - by Oracle OpenWorld Blog Team
     By Karen Shamban Wow - can't believe we're looking at Wednesday already!  Still so much to do, places to go, people to talk with. The last day for the Exhibition Halls is Wednesday, so be sure to spend time there if you haven't done so already. And don't forget (as if you would) that the famed Oracle Appreciation Event is Wednesday night on Treasure Island.  Here are just some of the big things happening Wednesday, October 3: Registration Moscone West, Moscone South, Hilton San Francisco, Westin St. Francis, Hotel Nikko, 7:00 a.m. - 6:30 p.m. Oracle OpenWorld Keynote featuring Oracle executives John Fowler, Edward Screven, and Juan Loiaza Moscone North Hall D, 8:00 a.m. - 9:45 a.m. Exhibition Halls Open Moscone South and Moscone West, 9:45 a.m. - 4:00 p.m. General Sessions Various times and locations Sessions, Demos, Labs Various times and locations Oracle Appreciation Event, featuring Pearl Jam, with Kings of Leon and X Treasure Island, 7:30 p.m. - 1:00 a.m. (note: must have approved wristband to attend) After what is sure to be a late night, it's good to know that the Thursday keynotes don't start until 9:00 a.m. They're going to be really great, so you won't want to miss them!

    Read the article

  • JavaOne Countdown, Are you ready?

    - by Angela Caicedo
    This is a great time of the year!  Not only does the weather start cooling down a bit, but it's time to get ready for JavaOne 2012.  It feels so long since my last JavaOne (last year I missed it because I was on a mom duty), so this year I couldn't be happier to be this close to the action again.  Have you ever been at JavaOne?  There are a million great reasons to love JavaOne, and the most important for me is the atmosphere of the conference: The Java community is there, and Java is in the air! This year we have more than 450 sessions, and there are HOLs (Hands on labs) to get your hands dirty with code.  In addition, there will be very cool demos, an exhibition hall. and a DEMOground.  During the whole time, you will have the opportunity to interact with the speakers, discuss topics and concerns, and even have a drink! Oh yes, I almost forgot, there will be lots of fun even apart from the technology!  For example there will be a Geek Bike Ride, a Thirsty Bear party, and the Appreciation Party with Pearl Jam and Kings of Leon.  How can this get any better! So, are you ready yet?  Have you registered?  If not, just follow this "Register for JavaOne" link and we'll see you there! P.S.  Little known fact: If you are a student you can get your pass for free!!!

    Read the article

  • How to convince non-programmer his notions about computers are wrong?

    - by Suma
    Recently I came across a question about 64b on SuperUser for which the accepted answer seemed like a complete nonsense to me. I made two comments pointing out obvious mistakes. To my perplexion, the comments had an effect of the poster of the answer being alienated. I have no idea how could I convince him he is wrong, as he does not seem to understand the basics of the problem. He seems to be mixing concepts like bus size and address size - see the pearl sentence "it will allow you to address all of your RAM because your processor is reading from your RAM in 64 bit words.". The poster asks me to provide proves of my claim by quoting a respectable source, but I have no idea where to find such source, as I doubt anything I would consider relevant would be relevant for him (it would be probably too technical). I think this instance can serve as an illustration of communication problems between programmers and users (and to certain extent even to any expert vs. non-expert communication). How should a programmer handle a communication like this, so that is does not become a useless quarrel?

    Read the article

  • Web Designer looking to learn back-end programming...

    - by Tabetha Moe
    Hello, my name is Tabetha and I have a question... I am a web designer, but I always find that while designing the layout and coding the design I come up with great ideas for websites. I would like to know where I need to start in order to learn back-end programming not only for the knowledge, but also for the challenge of it. I have searched online but can't seem to find the information I am looking for. If anyone can give me a simple, straight-forward "this is what language you need to learn" answer, or perhaps guide me in the right direction I would appreciate it ten-fold. I am a complete noob when it comes to this, so even the most basic information is probably a pearl of wisdom for me. :)

    Read the article

  • SQLAuthority News – SafePeak’s SQL Server Performance Contest – Winners

    - by pinaldave
    SafePeak, the unique automated SQL performance acceleration and performance tuning software vendor, announced the winners of their SQL Performance Contest 2011. The contest quite unique: the writer of the best / most interesting and most community liked “performance story” would win an expensive gadget. The judges were the community DBAs that could participating and Like’ing stories and could also win expensive prizes. Robert Pearl SQL MVP, was the contest supervisor. I liked most of the stories and decided then to contact SafePeak and suggested to participate in the give-away and they have gladly accepted the same. The winner of best story is: Jason Brimhall (USA) with a story about a proc with a fair amount of business logic. Congratulations Jason! The 3 participants won the second prize of $100 gift card on amazon.com are: Michael Corey (USA), Hakim Ali (USA) and Alex Bernal (USA). And 5 participants won a printed copy of a book of mine (Book Reviews of SQL Wait Stats Joes 2 Pros: SQL Performance Tuning Techniques Using Wait Statistics, Types & Queues) are: Patrick Kansa (USA), Wagner Bianchi (USA), Riyas.V.K (India), Farzana Patwa (USA) and Wagner Crivelini (Brazil). The winners are welcome to send safepeak their mail address to receive the prizes (to “info ‘at’ safepeak.com”). Also SafePeak team asked me to welcome you all to continue sending stories, simply because they (and we all) like to read interesting stuff) as well as to send them ideas for future contests. You can do it from here: www.safepeak.com/SQL-Performance-Contest-2011/Submit-Story Congratulations to everybody! I found this very funny video about SafePeak: It looks like someone (maybe the vendor) played with video’s once and created this non-commercial like video: SafePeak dynamic caching is an immediate plug-n-play performance acceleration and scalability solution for cloud, hosted and business SQL server applications. By caching in memory result sets of queries and stored procedures, while keeping all those cache correct and up to date using unique patent pending technology, SafePeak can fix SQL performance problems and bottlenecks of most applications – most importantly: without actual code changes. By the way, I checked their website prior this contest announcement and noticed that they are running these days a special end year promotion giving between 30% to 45% discounts. Since the installation is quick and full testing can be done within couple of days – those have the need (performance problems) and have budget leftovers: I suggest you hurry. A free fully functional trial is here: www.safepeak.com/download, while those that want to start with a quote should ping here www.safepeak.com/quote. Good luck! Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Performance, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • 25 reasons to attend JavaOne 2012

    - by arungupta
    17th JavaOne is just around the corner, less than 3 weeks away! If you are still thinking about registering for the conference, here are my top 25 reasons to attend the conference: Biggest gathering of Java geeks in the world Latest and greatest content with 475 technical sessions/Birds of Feathers/Hands-on labs sessions (about 20% more from last year) Reduced number of keynotes to accommodate room for more technical content No product pitches, exclusive focus on technology (I can tell you that from my experience as a track lead) Sessions are divided in different in-depth technical tracks to focus on Java technology that most interests you Reruns of several popular sessions Experts and Practitioners-led HOLs and tutorials Rock star speakers, panelists, faculties, and instructors. Meet several Java Champions and JUG leaders from all around the world Engage with speakers and discuss with fellow developers in a casual setting with lots of networking space A complete conference dedicated for Java Embedded Extensive and fast-paced hands-on University Sessions on Sunday, learn while you are at the conference. You can register for Java University only or attend with the conference. Dukes Choice Awards recognize and celebrate the most innovative usage of the Java platform DEMOgrounds and Exhibition Hall provide extensive opportunities for networking and engagement with the biggest names in Java (dedicated hours on each day as well) Dedicated day for Java User Groups and Communities (GlassFish Community Event and NetBeans Community Day) Multiple registration packages to meet your needs Pay for 4 full conference passes and get a fifth one free Students and Bloggers get a free pass Geek Bike Ride with fellow speakers and attendees in a casual setting Greenest conference on the plane Enjoy different cuisines in the San Francisco city, take a trip to Alcatraz or Napa Valley or go running on the crooked street ;-) There are tons of tourist opportunities in/around San Francisco. Tons of parties during the conference, in the evening, late night, and early mornings. Don't forget Thirsty Bear Party! Pearl Jam and Kings of Leon at Appreciation Party Oracle Music Festival at Yerba Buena Gardens Grab the bragging rights "I have attended JavaOne"! Learn a new skill, build new connections, conceive a new idea and push the boundaries of Java in the most important educational and networking event of the year for Java developers and enthusiasts. With so much geekgasm going on during the 5 days of JavaOne, is there a reason for you to wait ? Register for the conference now! Grab your buttons, banners, and other collateral at JavaOne Toolkit. You can also send an email to [email protected]. And reach out to us using different social media channels ... As a 13 year veteran of the conference, I can tell this is some thing every Java developer must experience! I will be there, will you ?

    Read the article

  • Purple Cows, Copernicus, and Shampoo – Lessons in Customer Experience

    - by Christina McKeon
    What makes a great customer experience? And, why should you or your organization care? These are the questions that set the stage for the Oracle Customer Experience Summit, which kicked off yesterday in San Francisco. Day 1: The first day was filled with demos and insights from customer experience experts and Oracle customers sharing what it takes to deliver great customer experiences. Author Seth Godin delivered an entertaining presentation that included an in-depth exploration of the always-connected, always-sharing experience revolution that we are witnessing and yes, talked about the purple cow. It turns out that customer experience is your way to be the purple cow. Before everyone headed out to see Pearl Jam and Kings of Leon at the Oracle customer appreciation event, the day wrapped up with a discussion around building a customer-centric culture. Where do you start? Whom does it involve? What are some pitfalls to avoid? Day 2: The second day addressed the details behind all the questions brought up at the end of Day 1. Before you start on a customer experience initiative, Paul Hagen noted that you must understand you will forge a path similar to Copernicus. You will be proposing ideas and approaches that challenge current thinking in your organization. Just as Copernicus' heliocentric theory started a scientific revolution, your customer-centric efforts will start an experience revolution. If you think customer experience is like a traditional marketing approach, think again. It’s not about controlling your customers and leading them where you want them to go. It might sound like heresy to some, but your customers are already in control, whether or not your company realizes and acknowledges it. And, to survive and thrive, you'll have to focus on customers by thinking outside-in and working towards a brand that is better and more authentic. We learned how Vail Resorts takes this customer-centric approach. Employees must experience the mountain themselves and understand the experience from the guest’s standpoint. This has created a culture where employees do things for guests that are not expected. We also learned a valuable lesson in designing and innovating customer-centered experiences from Kerry Bodine. First you make the thing, and then you make the thing right. In this case, the thing is customer experience. Getting customer experience right means iterative prototyping and testing of your ideas. This is where shampoo comes in—think lather, rinse, repeat. Be prepared to keep repeating until the customer experience is right. Many of these sessions will be posted to YouTube in the coming weeks so be sure to subscribe to our CX channel.

    Read the article

  • A "First" at Oracle OpenWorld

    - by Kathryn Perry
    A guest post by Adam May, Director, Fusion CRM, Oracle Applications Development There are always firsts at OpenWorld. These firsts keep the conference fresh and are the reason people come back year after year. An important first this year is our Fusion CRM customers who are using the product and deriving real benefit from Fusion CRM. Everyone can learn from and interact with them -- including us!  We love talking to customers, especially those who are using our solutions in unexpected ways because they challenge us! At previous OpenWorlds, we presented our overall Fusion vision and our plans for Fusion CRM. Those presentations helped customers plan their strategies and map out their new release uptakes. Fast forward to March of this year when the first Fusion CRM customer went live. Since then we've watched the pace of go-lives accelerate every single month. Now we're at the threshold of another OpenWorld -- with over 45,000 attendees, 2,500 sessions and LOTS of other activities. To avoid having our customers curl into a ball with sensory overload, we designed a Focus On Document to outline the most important Fusion CRM activities. Here are some of the highlights: Anthony Lye's "Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap" on Monday at 3:15 p.m. The CRM Pavilion, open in Moscone West from Monday through Wednesday; features our strategic Fusion CRM partners and provides live demonstrations of their capabilities General Session: "Oracle Fusion CRM--Improving Sales Effectiveness, Efficiency, and Ease of Use" on Tuesday at 11:45 a.m.; features Anthony Lye and Deloitte "Meet the Fusion CRM Experts" on Tuesday at 5:00 p.m.; this session gives customers the opportunity to interact one-on-one with Fusion experts divided into eight categories of expertise CRM Social Reception on Tuesday from 6-8 p.m.; there's no better way to spend the early evening than discussing Fusion CRM with Oracle experts and strategic partners over appetizers and drinks Wednesday night is Oracle's Customer Appreciation event; enjoy Pearl Jam, Kings of Leon, etc. beginning at 7:30 p.m. at Treasure Island Be sure to drink plenty of water before sleeping Wednesday night and don't stay out too late because we have lots of great content on Thursday; at the top of the list is "Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement" at 11:15 a.m. We hope you have a fantastic experience at OpenWorld 2012! And here's a little video treat to whet your appetite: http://www.youtube.com/user/FusionAppsAtOracle

    Read the article

  • OpenWorld in Small Bites

    - by Kathryn Perry
    Fifty thousand attendees -- that's bigger than the cities some of us live in. Monday morning it took 20 minutes to get from Hall D in Moscone North to a conference room in Moscone South -- the crowds were crushing! A great start to a great week! Larry is as big a name as ever on the program schedule and on the Moscone stage. People were packed in Hall D and clustered around every big screen TV. He stayed on script as he laid out Oracle's SaaS, PaaS, and IaaS strategies. Every seat in Chris Leone's Fusion Apps Cloud Overview was filled on Monday morning. Oracle employees who wanted to get in were turned away. And the same thing happened in the repeat session on Wednesday. Our newest suite of apps is hot! Speaking of hot, the weather was made to order. Then it turned very San Francisco-like on Wednesday afternoon. Downright cold for those who trusted SF temps to hold in the 80's. Who did you follow on Twitter during the conference? So many voices, opinions, and convos! Great combo of social media and sharp minds. Be sure to follow @larryellison, @stevenrmiranda, and @Oracle for updates and MyPOVs. Keywords for the Apps customers at the conference were cloud, mobile, and social. Every day, every session, every speaker. Wednesday afternoon, 4 pm at the Four Seasons hotel. A large roomful of analysts and influencers firing questions at a panel of eight Fusion customers. Steve Miranda moderating. Good energy and a great exchange of information and confidence. Word on the street is that OpenWorld has outgrown San Francisco -- but moving it seems unthinkable. The city isn't just a backdrop for an industry conference - it's a headliner right up there with Larry Ellison and Pearl Jam. As you can imagine, electrical outlets were in high demand at every venue. The most popular hotels and bars near Moscone designed their interiors around accessible electrical power strips. People are plenty willing to buy a drink while they grab a charge. Wednesday afternoon, 4 pm at the Four Seasons hotel. A large roomful of analysts and influencers firing questions at a panel of eight Fusion customers. Steve Miranda moderating. Good energy and a great exchange of information and confidence. Treasure Island in the dark. Eddy Vedder has an amazing voice! And Kings of Leon over delivered on people's expectations. It was cold. It was windy. It was very fun. One analyst said it's the best customer appreciation party in the industry. 

    Read the article

  • Delphi - Proper way to page though data.

    - by Brad
    I have a string list (TStrings) that has a couple thousand items in it. I need to process them in groups of 100. I basically want to know what the best way to do the loop is in Delphi. I'm hitting a brick wall when I'm trying to figure it out. Thanks unit Unit2; interface uses Windows, Messages, SysUtils, Variants, Classes, Graphics, Controls, Forms, Dialogs, StdCtrls; type TForm2 = class(TForm) Memo1: TMemo; Memo2: TMemo; Button1: TButton; procedure Button1Click(Sender: TObject); private { Private declarations } public { Public declarations } end; var Form2: TForm2; implementation Uses math; {$R *.dfm} procedure TForm2.Button1Click(Sender: TObject); var I:Integer; pages:Integer; str:string; begin pages:= ceil(memo1.Lines.Count/100) ; memo2.Lines.add('Total Pages: '+inttostr(pages)); memo2.Lines.add('Total Items: '+inttostr(memo1.Lines.Count)); // Should just do in batches of 100 VS entire list for I := 0 to memo1.lines.Count - 1 do begin if str '' then str:= str+#10+ memo1.Lines.Strings[i] else str:= memo1.Lines.Strings[i]; end; //I need to stop here every 100 items, then process the items. memo2.Lines.Add(str); end; end. Example form object Form2: TForm2 Left = 0 Top = 0 Caption = 'Form2' ClientHeight = 245 ClientWidth = 527 Color = clBtnFace Font.Charset = DEFAULT_CHARSET Font.Color = clWindowText Font.Height = -11 Font.Name = 'Tahoma' Font.Style = [] OldCreateOrder = False PixelsPerInch = 96 TextHeight = 13 object Memo1: TMemo Left = 16 Top = 8 Width = 209 Height = 175 Lines.Strings = ( '4xlt columbia thunder storm jacket' '5 things about thunder storms' 'a thunder storm with a lot of thunder ' 'and lighting sccreensaver' 'a thunder storm with a lot of thunder ' 'and lighting screensaver with no nag ' 'screens' 'all about thunder storms' 'all about thunderstorms for kids' 'amazing tornado videos and ' 'thunderstorm videos' 'are thunder storms louder in ohio?' 'bad thunder storms' 'bathing in thunder storm' 'best thunderstorm pictures' 'cartoon thunder storms' 'celtic thunder storm' 'central valley thunder storm' 'chicago thunderstorm pictures' 'cool thunderstorm pictures' 'current thunderstorm warnings' 'does thunder storms in december mean ' 'snow will be coming' 'facts about thunderstorms for kids' 'facts on thunderstorms for kids' 'fedex thunderstorm video' 'florida thunderstorms facts' 'free relaxing thunderstorm music' 'free soothing thunderstorm sounds ' 'online' 'free thunderstorm mp3' 'free thunderstorm mp3 download' 'free thunderstorm mp3 downloads' 'free thunderstorm mp3s' 'free thunderstorm music' 'free thunderstorm pictures' 'free thunderstorm sound effects' 'free thunderstorm sounds' 'free thunderstorm sounds cd' 'free thunderstorm sounds mp3' 'free thunderstorm sounds online' 'free thunderstorm soundscape' 'free thunderstorm video' 'free thunderstorm video download' 'free thunderstorm videos' 'god of storm and thunder' 'horses storm thunder rain' 'how do thunder storms form' 'how far away is a thunder storm' 'how long do thunder storms last' 'ice cube in a thunder storm' 'indoor thunderstorm safety tips' 'information about thunderstorms for kids' 'interesting thunderstorm facts' 'is it dangerous to shower during thunder ' 'storm' 'is there frequently thunder during snow ' 'storms' 'isolated thunderstorms' 'it'#39's just a thunder storm baby there is ' 'nothing you should fear lyrics' 'lightning & thunder storm safety' 'lightning and thunderstorm facts' 'lightning and thunderstorms facts' 'lightning and thunderstorms for kids' 'listen to thunderstorm sounds online' 'mississauga thunder storm' 'nature sounds free mp3 thunder storm' 'only about thunderstorms facts' 'original storm deep thunderstick' 'phone use during thunder storms' 'pictures of thunderstorms' 'pocono thunder storm' 'posters of thunder storms' 'power rangers ninja storm' 'power rangers thunder storm' 'power rangers thunder storm cast' 'power rangers thunder storm games' 'power rangers thunder storm morphers' 'power rangers thunder storm part 1' 'power rangers thunder storm part 2' 'power rangers thunderstorm' 'power rangers thunderstorm cannon' 'power rangers thunderstorm deluxe ' 'megazord' 'power rangers thunderstorm games' 'power rangers thunderstorm megazord' 'power rangers thunderstorm part 2' 'power rangers thunderstorm pictures' 'power rnager ninja storm thunder staff' 'powerful thunder and lightning storms' 'precambrian thunder storms' 'rain thunderstorm mp3' 'rain thunderstorm pictures' 'relaxing thunderstorm music' 'reminds me of ohio river thunder lighten ' 'storms' 'sacramento thunder storm' 'safety tips for when your caught in a ' 'thunder storm' 'scattered thunderstorms' 'schemer puts his head in the thunder ' 'storm' 'sedative thunder storm' 'server thunder storms' 'severe supercell thunderstorm pictures' 'severe thunder storm pictures' 'severe thunder storms' 'severe thunderstorm facts' 'severe thunderstorm pictures' 'severe thunderstorm pictures hail' 'severe thunderstorm pictures in alberta' 'severe thunderstorm pictures tornado' 'severe thunderstorm safety' 'severe thunderstorm safety tips' 'severe thunderstorm videos' 'severe thunderstorm warning' 'severe thunderstorm warning los ' 'angeles' 'severe thunderstorm warning signs' 'severe thunderstorm warnings' 'severe thunderstorms' 'severe thunderstorms facts' 'shakespeare use thunder storm for ' 'cosmic disorder julius caesar' 'soothing thunderstorm sounds online' 'sound effects of severe thunder storm' 'sound of rain storm finger snapping ' 'thunder chorus' 'split thunder storm' 'storm 3d thunder power' 'storm dark thunder' 'storm dark thunder bowling ball' 'storm dark thunder bowling ball sale' 'storm dark thunder for sale' 'storm dark thunder pearl' 'storm dark thunder pearl bowling ball' 'storm dark thunder review' 'storm dark thunder shirt' 'storm dark thunderball' 'storm deep thunder' 'storm deep thunder 11' 'storm deep thunder 15' 'storm deep thunder 15 lure' 'storm deep thunder 2' 'storm deep thunder lures' 'storm deep thunderstick' 'storm deep thunderstick crankbaits' 'storm deep thunderstick dts09' 'storm deep thunderstick jr' 'storm deep thunderstick lures' 'storm deep thundersticks' 'storm rolling thunder 3 ball roller' 'storm rolling thunder bowling bag' 'storm rolling thunder three ball bowling ' 'bag' 'storm shallow thunder' 'storm shallow thunder 15' 'storm thunder claw' 'storm thunder craw' 'storm watches thunder' 'storms with constant lightning and ' 'thunder non-stop' 'supercell thunder storms' 'supercell thunderstorm pictures' 'supercell thunderstorms' 'swimming pools thunder storms' 'tampa + lightning strikes + thunder ' 'storms' 'texas thunderstorm pictures' 'texas thunderstorm warnings' 'thunder and lightning storm' 'thunder and lighting storms' 'thunder and lightning storms' 'thunder bay snow storm video' 'thunder storm' 'thunder storm and windmill' 'thunder storm cd' 'thunder storm cloud' 'thunder storm clouds' 'thunder storm dog peppermint oil' 'thunder storm in winter' 'thunder storm in winter and weather ' 'prediction' 'thunder storm lx-3 & road blaster psx ' 'download' 'thunder storm occurances' 'thunder storm photos' 'thunder storm poems' 'thunder storm safety' 'thunder storm sign' 'thunder storm sounds' 'thunder storms' 'thunder storms and deaths' 'thunder storms and ilghting' 'thunder storms and lighting' 'thunder storms cd' 'thunder storms in the arctic arctic ' 'weather' 'thunder storms in winter' 'thunder storms on you tub' 'thunder storms pics' 'thunder storms with rain' 'thunderstorm' 'thunderstorm backgrounds' 'thunderstorm capital' 'thunderstorm capital 2008 dorfman' 'thunderstorm capital in boston' 'thunderstorm capital llc' 'thunderstorm capital of canada' 'thunderstorm capital of the us' 'thunderstorm capital of the world' 'thunderstorm facts' 'thunderstorm facts for kids' 'thunderstorm facts hail' 'thunderstorm facts tornadoes' 'thunderstorm mp3' 'thunderstorm mp3 download' 'thunderstorm mp3 download free' 'thunderstorm mp3 downloads' 'thunderstorm mp3 downloads free' 'thunderstorm mp3 files' 'thunderstorm mp3 free' 'thunderstorm mp3 free download' 'thunderstorm mp3 free downloads' 'thunderstorm mp3 torrent' 'thunderstorm mp3s' 'thunderstorm music' 'thunderstorm music cd' 'thunderstorm music downloads' 'thunderstorm music free' 'thunderstorm music playlists' 'thunderstorm music rain' 'thunderstorm pics' 'thunderstorm pictures' 'thunderstorm pictures for kids' 'thunderstorm safety' 'thunderstorm safety for kids' 'thunderstorm safety precautions' 'thunderstorm safety procedures' 'thunderstorm safety rules' 'thunderstorm safety tips' 'thunderstorm safety tips for kids' 'thunderstorm safety tips shelter' 'thunderstorm safety tips trees' 'thunderstorm sound effects' 'thunderstorm sound effects cd' 'thunderstorm sound effects download' 'thunderstorm sound effects free' 'thunderstorm sound effects free ' 'download' 'thunderstorm sound effects free music ' 'feature audio' 'thunderstorm sound effects mp3' 'thunderstorm sound effects rain' 'thunderstorm sounds' 'thunderstorm sounds cd' 'thunderstorm sounds download' 'thunderstorm sounds for sleep' 'thunderstorm sounds for sleeping' 'thunderstorm sounds free' 'thunderstorm sounds free download' 'thunderstorm sounds free downloads' 'thunderstorm sounds mp3' 'thunderstorm sounds mp3 download' 'thunderstorm sounds mp3 free' 'thunderstorm sounds online' 'thunderstorm sounds online for free' 'thunderstorm sounds online free' 'thunderstorm sounds sleep' 'thunderstorm sounds streaming' 'thunderstorm sounds torrent' 'thunderstorm soundscape' 'thunderstorm soundscapes' 'thunderstorm video' 'thunderstorm video clips' 'thunderstorm video download' 'thunderstorm video downloads' 'thunderstorm videos' 'thunderstorm videos for kids' 'thunderstorm videos lightning' 'thunderstorm videos online' 'thunderstorm wallpaper' 'thunderstorm warning' 'thunderstorm warning brisbane' 'thunderstorm warning definition' 'thunderstorm warning los angeles' 'thunderstorm warning san diego' 'thunderstorm warning san mateo county' 'thunderstorm warning santa barbara' 'thunderstorm warning santa clara' 'thunderstorm warning santa clara ' 'county' 'thunderstorm warning signal' 'thunderstorm warning signs' 'thunderstorm warning vs watch' 'thunderstorm warnings' 'thunderstorm warnings and watches' 'thunderstorm warnings for nj' 'thunderstorm warnings qld' 'thunderstorms' 'thunderstorms facts' 'thunderstorms facts for kids' 'thunderstorms for kids' 'tornados and thunder storms animated' 'understanding thunderstorms for kids' 'watch thunderstorm videos' 'weather underground forecast ' 'thunderstorms' 'what causes thunder storms' 'what is a thunder storm' 'where d thunder storms occur') TabOrder = 0 end object Memo2: TMemo Left = 240 Top = 8 Width = 265 Height = 129 Lines.Strings = ( 'Memo2') TabOrder = 1 end object Button1: TButton Left = 384 Top = 184 Width = 75 Height = 25 Caption = 'Button1' TabOrder = 2 OnClick = Button1Click end end

    Read the article

  • Buy iPads In India From eZone, Reliance iStores [Chennai, Bangalore, Delhi, Mumbai]

    - by Gopinath
    Close to an year wait for Apple iPad in India is over. Now everyone can buy a genuine iPad with manufacturers’ warranty from dozens of retail outlets set up by Future Bazar’s eZone and Reliance iStore. This puts an end to the grey market that was importing iPads through illegal channels, selling them at staggering high prices and with no warranty. iPad Retail Price at eZone & Outlet Address The iPad page on eZone’s website has price details of various models and they range from Rs.27,900/- to Rs.44,000/-. iPad 16 GB WiFi  – Rs. 27900.00 iPad 32 GB WiFi  – Rs. 32900.00 iPad 64 GB WiFi  – Rs. 37900.00 iPad 16 GB WiFi  + 3G – Rs. 34900.00 iPad 32 GB WiFi  + 3G – Rs. 39900.00 iPad 64 GB WiFi  + 3G – Rs. 44900.00 Here is the list of eZone stores selling iPads Chennai Stores eZone :: CHENNAI-GANDHI SQUARE Gandhi Square, ( G2),No. 46, Old Mahabalipuram Road, Kandanchavadi, Chennai ( Before Lifeline Hospital) – 600096. Phone : 24967771/7 eZone :: CHENNAI-MYLAPORE Grand Terrace, Old no. 94, new door no. 162, Luz Church Road, Mylapore, Chennai – . Tamil Nadu. Phone : 24987867/68. Mumbai Stores eZone :: MUMBAI-GOREGAON Shop No-S-23, 2nd Floor, Oberoi Mall Off Western Express Highway , Goregaon(E) , Mumbai – 400063, Phone: 28410011/40214771. eZone :: MUMBAI-POWAI-HAIKO MALL Hailko Mall, Level 2, Central Avenue, Hiranandani Garden, Powai, Mumbai, 400076. Phone: 25717355/56. eZone :: EZ-Sobo Central C wing,SOBO Central, Next to Tardoe AC Market, Pandit Madan Mohan Malviya Road, Mumbai – 400034. Phone : 022-30089344. Bangalore Stores eZone :: Koramangala (Bnglr) Regent Insignia, Ground Floor,# 414, 100 Ft Road, Koramangala, Bangalore – 560034 Phone : 080-25520241/242/243. eZone :: BANGALORE-INDIRA NAGAR No.62, Asha Pearl,100 Feet Road, Opp.AXIS Bank.Indiranagar, Bangalore – 560038 Phone : 25216857/6855/6856. eZone :: BANGALORE-PASADENA pasadena’ (Ground floor),18/1.(old number 125/a),10th main,Ashoka pillar road,Jaynagar 1st block,Bangalore – 560 011. Phone : 26577527. Delhi Stores eZone :: NEW DELHI-PUSA ROAD Ground/Lower Ground Floor, Plot # 26, Pusa Road, Adjacent to Karol Bagh Metro Station, Karol Bagh, New Delhi – 110005. Phone :28757040/41. For more details check eZone iPad Product Page iPads at Reliance iStore Reliance iStores are exclusive outlets for selling Apple products in India. All the models of iPad are available at Reliance iStore and the price details are not available on their websites. You may walk into any of the iStore close by your locality or call them to get the details. To locate the stores close by your locality please check store locator page on iStore Website. Do you know any other retail stores selling iPads in India? This article titled,Buy iPads In India From eZone, Reliance iStores [Chennai, Bangalore, Delhi, Mumbai], was originally published at Tech Dreams. Grab our rss feed or fan us on Facebook to get updates from us.

    Read the article

  • ArchBeat Link-o-Rama for October 14-20, 2012

    - by Bob Rhubart
    The Top 10 items shared on the OTN ArchBeat Facebook page for the week of October 14-21, 2012. Panel: On the Impact of Software | InfoQ Les Hatton (Oakwood Computing Associates), Clive King (Oracle), Paul Good (Shell), Mike Andrews (Microsoft) and Michiel van Genuchten (moderator) discuss the impact of software engineering on our lives in this panel discussion recorded at the Computer Society Software Experts Summit 2012. ResCare Solves Content Lifecycle Challenges with Oracle WebCenter Learn how ResCare solves content lifecycle challenges with Oracle WebCenter. Speakers: Joe Lichtefeld, VP of Application Services & PMO, ResCare Wayne Boerger, Product Manager, TEAM Informatics Doug Thompson, EVP Global Development, TEAM Informatics Date: Tuesday, October 30, 2012 Time: 10:00 a.m. PT / 1:00 p.m. ET WebLogic Server 11gR1 Interactive Quick Reference "The WebLogic Server 11gR1 Administration interactive quick reference," explains Juergen Kress, "is a multimedia tool for various terms and concepts used in WebLogic Server architecture. This tool is available for administrators for online or offline use. This is built as a multimedia web page which provides descriptions of WebLogic Server Architectural components, and references to relevant documentation. This tool offers valuable reference information for any complex concept or product in an intuitive and useful manner." Oracle ACE Directors Nordic Tour 2012 : Venues and BI Presentations | Mark Rittman Oracle ACE Director Mark Rittman shares information on the Oracle ACE Director Tour, as the community leaders make their way through the land of the midnight sun, with events in Copenhagen, Stockholm, Oslo and Helsinki. Mobile Apps for EBS | Capgemini Oracle Blog Capgemini solution architect Satish Iyer breifly describes how Oracle ADF and Oracle SOA Suite can be used to fill the gap in mobile applications for Oracle EBS. Introducing the New Face of Fusion Applications | Misha Vaughan Oracle ACE Directors Debra Lilly and Floyd Teter have already blogged about the the new face of Oracle Fusion Applications. Now Applications User Experience Architect Misha Vaughan shares a brief overview of how the Oracle Applications User Experience (UX) team developed the new look. BPM 11g - Dynamic Task Assignment with Multi-level Organization Units | Mark Foster "I've seen several requirements to have a more granular level of task assignment in BPM 11g based on some value in the data passed to the process," says Fusion Middleware A-Team architect Mark Foster. "Parametric Roles is normally the first port of call to try to satisfy this requirement, but in this blog we will show how a lot of use-cases can be satisfied by the easier to implement and flexible Organization Unit." OTN Architect Day Los Angeles - Oct 25 Oracle Technology Network Architect Day in Los Angeles happens in one week. Register now to make sure you don't miss out on a rich schedule of expert technical sessions and peer interaction covering the use of Oracle technologies in cloud computing, SOA, and more. Even better: it's all free. When: October 25, 2012, 8:30am - 5:00pm. Where: Sofitel Los Angeles, 8555 Beverly Boulevard, Los Angeles, CA 90048. Oracle VM VirtualBox 4.2.2 released | Oracle's Virtualization Blog The Fat Bloke weighs in with a short post with information on where you can find information and the download for the latest VirtualBox release. Advanced Oracle SOA Suite #OOW 2012 SOA Presentations The Oracle SOA Product Management team has compiled a complete list of all twelve of their Oracle SOA Suite presentations from Oracle OpenWorld 2012, with links to the slide decks. Thought for the Day "Software: do you write it like a book, grow it like a plant, accrete it like a pearl, or construct it like a building?" — Jeff Atwood Source: softwarequotes.com

    Read the article

  • Two Weeks To Go, Still Time to Register

    - by speakjava
    Yes, it's now only two weeks to the start of the 17th JavaOne conference! This will be my ninth JavaOne, I came fairly late to this event, attending for the first time in 2002.  Since then I've missed two conferences, 2006 for the birth of my son (a reasonable excuse I think) and 2010 for reasons we'll not go into here.  I have quite the collection of show devices, I've still got the WoWee robot, the HTC phone for JavaFX, the programmable pen and the Sharp Zaurus.  The only one I didn't keep was the homePod music player (I wonder why?) JavaOne is a special conference for many reasons, some of which I list here: A great opportunity to catch up on the latest changes in the Java world.  This is not just in terms of the platform, but as much about what people are doing with Java to build new and cool applications. A chance to meet people.  We have these things called BoFs, which stands for "Birds of a Feather", as in "Birds of a feather, flock together".  The idea being to have sessions where people who are interested in the same topic don't just get to listen to a presentation, but get to talk about it.  These sessions are great, but I find that JavaOne is as much about the people I meet in the corridors and the discussions I have there as it is about the sessions I get to attend. Think outside the box.  There are a lot of sessions at JavaOne covering the full gamut of Java technologies and applications.  Clearly going to sessions that relate to your area of interest is great, but attending some of the more esoteric sessions can often spark thoughts and stimulate the imagination to go off and do new and exciting things once you get back. Get the lowdown from the Java community.  Java is as much about community as anything else and there are plenty of events where you can get involved.  The GlassFish party is always popular and for Java Champions and JUG leaders there's a couple of special events too. Not just all hard work.  Oracle knows how to throw a party and the appreciation event will be a great opportunity to mingle with peers in a more relaxed environment.  This year Pearl Jam and Kings of Leon will be playing live.  Add free beer and what more could you want? So there you have it.  Just a few reasons for why you want to attend JavaOne this year.  Oh, and of course I'll be presenting three sessions which is even more reason to go.  As usual I've gone for some mainstream ("Custom Charts" for JavaFX) and some more 'out there' ("Java and the Raspberry Pi" and "Gestural Interfaces for JavaFX").  Once again I'll be providing plenty of demos so more than half my luggage this year will consist of a Kinect, robot arm, Raspberry Pis, gamepad and even an EEG sensor. If you're a student there's one even more attractive reason for going to JavaOne: It's Free! Registration is here.  Hope to see you there!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • What framework would allow for the largest coverage of freelance developers in the media/digital mar

    - by optician
    This question is not about which is the best, it is about which makes the most business sense to use as a company's platform of choice for ongoing freelance development. I'm currently trying to decide what framework to move my company in regarding frameworks for web application work. Options are ASP.NET MVC Django CakePHP/Symfony etc.. Struts Pearl on Rails Please feel free to add more to the discussion. I currently work in ASP.NET MVC in my Spare time, and find it incredibly enjoyable to work with. It is my first experince with an MVC framework for the web, so I can't talk on the others. The reason for not pushing this at the company is that I feel that there are not many developers in the Media/Marketing world who would work with this, so it may be hard to extend the team, or at least cost more. I would like to move into learning and pushing Django, partly to learn python, partly to feel a bit cooler (all my geeky friends use Java/Python/c++). Microsoft is the dark side to most company's I work with (Marketing/Media focused). But again I'm worried about developers in this sector. PHP seems like the natural choice, but I'm scared by the sheer amount of possible frameworks, and also that the quality of developer may be lower. I know there are great php developers out there, but how many of them know multiple frameworks? Are they similar enough that anyone decent at php can pick them up? Just put struts in the list as an option, but personally I live with a Java developer, and considering my experience with c#, I'm just not that interested in learning Java (selfish personal geeky reasons) Final option was a joke http://www.bbc.co.uk/blogs/radiolabs/2007/11/perl_on_rails.shtml

    Read the article

  • Best architecture for a social media app

    - by Sky
    Hey guys, Im working on promising project that develops a new social media app for web and mobile. We are at begin defining functionalities. Nevertheless, I'm thinking ahead on architecture. So I'm asking: 1 - Whats the best plataform to develop the core of this aplication that will have a Rest API interface. 2 - Whats the best database that will scale and grow with my application. As far as I researched, these were the answers I found most interesting: For database: Cassandra NoSQL DB, amazing scalabilty, amazing write performance, good read performance (will be improved on 0.6). I think i will choose that one. Zookeer for transactions on Cassandra. I think that 2 technologies rly good for that propose. What do you think guys? On the front end that will serve the REST API, i dont have a final candidate. For this one i have questions based on Perfomance X Scalabilty X Fast Development/Maintenance. Java or .Net As far as I researched, brings the best balance of this requisits. Python, pearl and Rail, has the best (Fast Development/Maintenance), but sux on all other. C or C++ I dont even consider, because its (Fast Development/Maintenance) sux... So what do you guy think about it?

    Read the article

  • How to figure out which key was pressed on a BlackBerry

    - by Skrud
    What I want: To know when the user has pressed the button that has the number '2' on it, for example. I don't care whether "Alt" or "Shift" has been pressed. The user has pressed a button, and I want to evaluate whether this button has '2' printed on it. Naturally, if I switch devices this key will change. On a Bold 9700/9500 this is the 'E' key. On a Pearl, this is the 'T'/'Y' key. I've managed to get this working in what appears to be a roundabout way, by looking up the keycode of the '2' character with the ALT button enabled and using Keypad.key() to get the actual button: // figure out which key the '2' is on: final int BUTTON_2_KEY = Keypad.key(KeypadUtil.getKeyCode('2', KeypadListener.STATUS_ALT, KeypadUtil.MODE_EN_LOCALE)); protected boolean keyDown(int keycode, int time) { int key = Keypad.key(keycode); if ( key == BUTTON_2_KEY ) { // do something return true; } return super.keyDown(keycode,time); } I can't help but wonder if there is a better way to do this. I've looked at the constants defined in KeypadListener and Keypad but I can't find any constants mapped to the actual buttons on the device. Would any more experienced BlackBerry devs care to lend a helping hand? Thanks!

    Read the article

  • im unable to validate a login of users ,since if im entering the wrong values my datareader is not getting executed y ?

    - by Salman_Khan
    //code private void glassButton1_Click(object sender, EventArgs e) { if (textBox1.Text == "" || textBox1.Text == "" || comboBox1.SelectedIndex == 0) { Message m = new Message(); m.ShowDialog(); } else { try { con.ConnectionString = "Data source=BLACK-PEARL;Initial Catalog=LIFELINE ;User id =sa; password=143"; con.Open(); SqlCommand cmd = new SqlCommand("Select LoginID,Password,Department from Login where LoginID=@loginID and Password=@Password and Department=@Department", con); cmd.Parameters.Add(new SqlParameter("@loginID", textBox1.Text)); cmd.Parameters.Add(new SqlParameter("@Password", textBox2.Text)); cmd.Parameters.Add(new SqlParameter("@Department", comboBox1.Text)); SqlDataReader dr = cmd.ExecuteReader(); if (dr.Read()) { string Strname = dr[0].ToString(); string StrPass = dr[1].ToString(); string StrDept = dr[2].ToString(); if(dr[2].ToString().Equals(comboBox1.Text)&&dr[0].ToString().Equals(textBox1.Text)&&dr[1].ToString().Equals(textBox2.Text)) { MessageBox.Show("Welcome"); } else { MessageBox.Show("Please Enter correct details"); } } dr.Close(); } catch (Exception ex) { MessageBox.Show("Exception" + ex); } finally { con.Close(); } } }

    Read the article

  • Designing a different kind of tag cloud.

    - by animuson
    Rather than having a bunch of links that are all different sizes, I want all of my tags to be the same size. However, my goal is to minimize the amount of space required to make the cloud, aka minimizing the number of lines used. Take this example: Looks like any normal tag cloud. However, look at all that extra space around the 'roughdiamond' tag, which could be filled in by other tags like 'stone' down near the bottom, which could effectively eliminate an entire extra line from the cloud. How would I go about getting the words to fill in whatever space possible above them before starting a new line? I'm not talking about reorganizing them to find the absolute minimum number of lines required. If I was going through the list in the image, 'pendant', 'howlite', and 'igrice' would go to line 1 filling it up, 'roughdiamond' would go to line 2 because line 1 is full, 'tourmaline' would go to line 3 because it can't fit on lines 1 or 2, same with 'emberald', but 'pearl' would go to line 2 because it can fit there since there is extra space. I figure there would probably be some way of doing this in CSS that would simply cause the links to collapse into any fillable space it can fit in to.

    Read the article

  • What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12

    - by Tony Berk
    There is plenty to SEE for CRM during OpenWorld in San Francisco, September 30 - October 4! As I mentioned in my earlier post about some of the keynote sessions, Is There a Cloud Over OpenWorld?, I'm going try to highlight some key sessions to help you find the best sessions for you. Interested to find out where Oracle CRM products are headed, then find your "roadmap" session. Here are some of the sessions in the CRM Track that you might want to consider attending for products you currently own or might consider for the future. I think you'll agree, there is quite a bit of investment going on across Oracle CRM. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. General Session: Oracle Fusion CRM—Improving Sales Effectiveness, Efficiency, and Ease of Use (Session ID: GEN9674) - Oct 2, 11:45 AM - 12:45 PM. Anthony Lye, Senior VP, Oracle leads this general session focused on Oracle Fusion CRM. Oracle Fusion CRM optimizes territories, combines quota management and incentive compensation, integrates sales and marketing, and cleanses and enriches data—all within a single application platform. Oracle Fusion can be configured, changed, and extended at runtime by end users, business managers, IT, and developers. Oracle Fusion CRM can be used from the Web, from a smartphone, from Microsoft Outlook, or from an iPad. Deloitte, sponsor of the CRM Track, will also present key concepts on CRM implementations. Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap (CON9407) - Oct 1, 3:15PM - 4:15PM. In this session, learn how Oracle Fusion CRM enables companies to create better sales plans, generate more quality leads, and achieve higher win rates and find out why customers are adopting Oracle Fusion CRM. Gain a deeper understanding of the unique capabilities only Oracle Fusion CRM provides, and learn how Oracle’s commitment to CRM innovation is driving a wide range of future enhancements. Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM - 11:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Siebel CRM Overview, Strategy, and Roadmap (CON9700) - Oct 1, 12:15PM - 1:15PM. The world’s most complete CRM solution, Oracle’s Siebel CRM helps organizations differentiate their businesses. Come to this session to learn about the Siebel product roadmap and how Oracle is committed to accelerating the pace of innovation and value for its customers on this platform. Additionally, the session covers how Siebel customers can leverage many Oracle assets such as Oracle WebCenter Sites; InQuira, RightNow, and ATG/Endeca applications, and Oracle Policy Automation in conjunction with their current Siebel investments. Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement (CON9750) - Oct 4, 11:15 AM - 12:15 PM. Social is changing the customer experience! Come find out how Oracle can help you know your customers better, encourage brand affinity, and improve collaboration within your ecosystem. This session reviews Oracle’s social media solution and shows how you can discover hidden insights buried in your enterprise and social data. Also learn how Oracle Social Network revolutionizes how enterprise users work, collaborate, and share to achieve successful outcomes. Oracle CRM On Demand Strategy and Roadmap (CON9727) - Oct 1, 10:45AM - 11:45AM. Oracle CRM On Demand is a powerful cloud-based customer relationship management solution. Come to this session to learn directly from Oracle experts about future product plans and hear how Oracle is committed to accelerating the pace of innovation and value to its customers. Knowledge Management Roadmap and Strategy (CON9776) - Oct 1, 12:15PM - 1:15PM. Learn how to harness the knowledge created as a natural byproduct of day-to-day interactions to lower costs and improve customer experience by delivering the right answer at the right time across channels. This session includes an overview of Oracle’s product roadmap and vision for knowledge management for both the Oracle RightNow and Oracle Knowledge (formerly InQuira) product families. Oracle Policy Automation Roadmap: Supercharging the Customer Experience (CON9655) - Oct 1, 12:15PM - 1:15PM. Oracle Policy Automation delivers rapid customer value by streamlining the capture, analysis, and deployment of policies across every facet of the customer experience. This session discusses recent Oracle Policy Automation enhancements for policy analytics; the latest Oracle Policy Automation Connector for Siebel; and planned new capabilities, including availability with the Oracle RightNow product line. There is much more, so stay tuned for more highlights or check out the Content Catalog and search for your areas of interest. Which session are you most interested in? Make your suggestions! But no voting for Pearl Jam or Kings of Leon. Those are after hours! 

    Read the article

  • How to pass parameters to Apache Pivot's wtkx:include tag?

    - by Andrew Swan
    I need to create a reusable UI component that accepts a number of parameters (e.g. an image URL and some label text), similar to how JSP tags can accept parameters. The Pivot docs for the "wtkx:include" tag say: The tag allows a WTKX file to embed content defined in an external WTKX file as if it was defined in the source file itself. This is useful for ... defining reusable content templates I was hoping that I could define my component in a WTKX file using standard Pivot components (e.g. a TextInput) and pass it one or more parameters; for example my reusable template called "row.wtkx" might contain a row with an image and a text field, like this (where the ${xxx} bits are the parameters): <TablePane.Row xmlns="org.apache.pivot.wtk"> <ImageView image="@images/${image_url}" /> <TextInput text="${title}" /> </TablePane.Row> I could then reuse this component within a TablePane as follows: <rows> <TablePane.Row> <Label text="Painting"/> <Label text="Title"/> </TablePane.Row> <wtkx:include src="row.wtkx" image_url="mona_lisa.jpg" title="Mona Lisa"/> <wtkx:include src="row.wtkx" image_url="pearl_earring.jpg" title="Girl with a Pearl Earring"/> <wtkx:include src="row.wtkx" image_url="melting_clocks.jpg" title="Melting Clocks"/> </rows> I've made up the ${...} syntax myself just to show what I'm trying to do. Also, there could be other ways to pass the parameter values other than using attributes of the "wtkx:include" tag itself, e.g. pass a JSON-style map called say "args". The ability to pass parameters like this would make the include tag much more powerful, e.g. in my case allow me to eliminate a lot of duplication between the table row declarations. Or is "wtkx:include" not the right way to be doing this?

    Read the article

  • The True Cost of a Solution

    - by D'Arcy Lussier
    I had a Twitter chat recently with someone suggesting Oracle and SQL Server were losing out to OSS (Open Source Software) in the enterprise due to their issues with scaling or being too generic (one size fits all). I challenged that a bit, as my experience with enterprise sized clients has been different – adverse to OSS but receptive to an established vendor. The response I got was: Found it easier to influence change by showing how X can’t solve our problems or X is extremely costly to scale. Money talks. I think this is definitely the right approach for anyone pitching an alternate or alien technology as part of a solution: identify the issue, identify the solution, then present pros and cons including a cost/benefit analysis. What can happen though is we get tunnel vision and don’t present a full view of the costs associated with a solution. An “Acura”te Example (I’m so clever…) This is my dream vehicle, a Crystal Black Pearl coloured Acura MDX with the SH-AWD package! We’re a family of 4 (5 if my daughters ever get their wish of adding a dog), and I’ve always wanted a luxury type of vehicle, so this is a perfect replacement in a few years when our Rav 4 has hit the 8 – 10 year mark. MSRP – $62,890 But as we all know, that’s not *really* the cost of the vehicle. There’s taxes and fees added on, there’s the extended warranty if I choose to purchase it, there’s the finance rate that needs to be factored in… MSRP –   $62,890 Taxes –      $7,546 Warranty - $2,500 SubTotal – $72,936 Finance Charge – $ 1094.04 Grand Total – $74,030 Well! Glad we did that exercise – we discovered an extra $11k added on to the MSRP! Well now we have our true price…or do we? Lifetime of the Vehicle I’m expecting to have this vehicle for 7 – 10 years. While the hard cost of the vehicle is known and dealt with, the costs to run and maintain the vehicle are on top of this. I did some research, and here’s what I’ve found: Fuel and Mileage Gas prices are high as it is for regular fuel, but getting into an MDX will require that I *only* purchase premium fuel, which comes at a premium price. I need to expect my bill at the pump to be higher. Comparing the MDX to my 2007 Rav4 also shows I’ll be gassing up more often. The Rav4 has a city MPG of 21, while the MDX plummets to 16! The MDX does have a bigger fuel tank though, so all in all the number of times I hit the pumps might even out. Still, I estimate I’ll be spending approximately $8000 – $10000 more on gas over a 10 year period than my current Rav4. Service Options Limited Although I have options with my Toyota here in Winnipeg (we have 4 Toyota dealerships), I do go to my original dealer for any service work. Still, I like the fact that I have options. However, there’s only one Acura dealership in all of Winnipeg! So if, for whatever reason, I’m not satisfied with the level of service I’m stuck. Non Warranty Service Work Also let’s not forget that there’s a bulk of work required every year that is *not* covered under warranty – oil changes, tire rotations, brake pads, etc. I expect I’ll need to get new tires at the 5 years mark as well, which can easily be $1200 – $1500 (I just paid $1000 for new tires for the Rav4 and we’re at the 5 year mark). Now these aren’t going to be *new* costs that I’m not used to from our existing vehicles, but they should still be factored in. I’d budget $500/year, or $5000 over the 10 years I’ll own the vehicle. Final Assessment So let’s re-assess the true cost of my dream MDX: MSRP                    $62,890 Taxes                       $7,546 Warranty                 $2,500 Finance Charge         $1094 Gas                        $10,000 Service Work            $5000 Grand Total           $89,030 So now I have a better idea of 10 year cost overall, and I’ve identified some concerns with local service availability. And there’s now much more to consider over the original $62,890 price tag. Tying This Back to Technology Solutions The process that we just went through is no different than what organizations do when considering implementing a new system, technology, or technology based solution, within their environments. It’s easy to tout the short term cost savings of particular product/platform/technology in a vacuum. But its when you consider the wider impact that the true cost comes into play. Let’s create a scenario: A company is not happy with its current data reporting suite. An employee suggests moving to an open source solution. The selling points are: - Because its open source its free - The organization would have access to the source code so they could alter it however they wished - It provided features not available with the current reporting suite At first this sounds great to the management and executive, but then they start asking some questions and uncover more information: - The OSS product is built on a technology not used anywhere within the organization - There are no vendors offering product support for the OSS product - The OSS product requires a specific server platform to operate on, one that’s not standard in the organization All of a sudden, the true cost of implementing this solution is starting to become clearer. The company might save money on licensing costs, but their training costs would increase significantly – developers would need to learn how to develop in the technology the OSS solution was built on, IT staff must learn how to set up and maintain a new server platform within their existing infrastructure, and if a problem was found there was no vendor to contact for support. The true cost of implementing a “free” OSS solution is actually spinning up a project to implement it within the organization – no small cost. And that’s just the short-term cost. Now the organization must ensure they maintain trained staff who can make changes to the OSS reporting solution and IT staff that will stay knowledgeable in the new server platform. If those skills are very niche, then higher labour costs could be incurred if those people are hard to find or if trained employees use that knowledge as leverage for higher pay. Maybe a vendor exists that will contract out support, but then there are those costs to consider as well. And let’s not forget end-user training – in our example, anyone that runs reports will need to be trained on how to use the new system. Here’s the Point We still tend to look at software in an “off the shelf” kind of way. It’s very easy to say “oh, this product is better than vendor x’s product – and its free because its OSS!” but the reality is that implementing any new technology within an organization has a cost regardless of the retail price of the product. Training, integration, support – these are real costs that impact an organization and span multiple departments. Whether you’re pitching an improved business process, a new system, or a new technology, you need to consider the bigger picture costs of implementation. What you define as success (in our example, having better reporting functionality) might not be what others define as success if implementing your solution causes them issues. A true enterprise solution needs to consider the entire enterprise.

    Read the article

< Previous Page | 1 2 3  | Next Page >