Search Results

Search found 7399 results on 296 pages for 'character entities'.

Page 20/296 | < Previous Page | 16 17 18 19 20 21 22 23 24 25 26 27  | Next Page >

  • What is the best way to add attributes to auto-generated entities (using VS2010 and EF4)

    - by Dani
    ASP.NET MVC2 has strong support for using attributes on entities (validation, and extending Html helper class and more). If I generated my Model from the Database using VS2010 EF4 Entity Data Model (edmx and it's cs class), And I want to add attributes on some of the entities. what would be the best practice ? how should I cope with updating the model (adding more fields / tables to the database and merging them into the edmx) - will it keep my attributes or generate a new cs file erasing everything ? (Manual changes to this file may cause unexpected behavior in your application.) (Manual changes to this file will be overwritten if the code is regenerated.)

    Read the article

  • Returning EF entities using WCF - Read only web service / public API

    - by alex
    I'm currently migrating an application from Linq-to-SQL & ASP.net Web Services (asmx) to Entity Framework and WCF. My question is, I have a bunch of POCO classes which i have xml mapping files for (for the linq to sql) I've replaced my linq to sql with an entity framework data model I've got an interface - something like IService - that has all the methods on it that i need my service to implement - for example: Product[] GetProductsByKeyword(string keyword); In the above case, Product is a POCO. I now have them as entities within my ef data model - i'm using .net 4, and could take advantage of poco support, but don't really see the need - This service is strictly read only. What's the best way of returning entities in my WCF service? I want it to support other client platforms, not just .net (so php guys could use it)

    Read the article

  • PLINQO Not Naming Entities Correctly

    - by Clever Human
    I have my CSP file set up to use TableNaming and EntityNaming as Singular: <TableNaming>Singular</TableNaming> <EntityNaming>Singular</EntityNaming> Yet the generated entities are plural. For instance, I have a table called Companies. The generated name is "Companies" I expected "Company" (like LinqToSql did -- I am upgrading a project.) I have a table named EntityStorageItems (no relation to these entities.) The generated name is "EntityStorageItems" I expected the entity name to be "EntityStorageItem" IOW, it is creating plural names. And I need them to be singular (to work with existing code.) Am I doing something wrong?

    Read the article

  • Updating the collections of entities with NHibernate the correct way

    - by karel_evzen
    A simple question regarding how NHibernate works: I have a parent entity that has a collection of other child entities. Those child entities have a reference to the parent entity they belong to. Now I want to implement an Add method to the parent entity that would add a child to it. Should that Add method only add the child to its new parents collection, or should it also update the parent reference of the child or should it also remove the added entity from its previous parents collection? Do I have to do all these things in that method or will NHibernate do something for me? Thanks.

    Read the article

  • DataContractJsonSerializer not deserializing html entities.

    - by RedDeckWins
    I am receiving data from a web service, and some of the strings have html entities in them, for example: {"prop": "htmlentity - é"} The &eacute; is not being parsed to é. My question is twofold: 1. Is this even supposed to happen? I looked through the JSON spec the best I could, but couldn't find any reference to html entities. 2. What is the right way to do this with a DataContractJsonSerializer, if there is a right way?

    Read the article

  • Setting up a new Silverlight 4 Project with WCF RIA Services

    - by Kevin Grossnicklaus
    Many of my clients are actively using Silverlight 4 and RIA Services to build powerful line of business applications.  Getting things set up correctly is critical to being to being able to take full advantage of the RIA services plumbing and when developers struggle with the setup they tend to shy away from the solution as a whole.  I’m a big proponent of RIA services and wanted to take the opportunity to share some of my experiences in setting up these types of projects.  In late 2010 I presented a RIA Services Master Class here in St. Louis, MO through my firm (ArchitectNow) and the information shared in this post was promised during that presentation. One other thing I want to mention before diving in is the existence of a number of other great posts on this subject.  I’ve learned a lot from many of them and wanted to call out a few of them.  The purpose of my post is to point out some of the gotchas that people get caught up on in the process but I would still encourage you to do as much additional research as you can to find the perfect setup for your needs. Here are a few additional blog posts and articles you should check out on the subject: http://msdn.microsoft.com/en-us/library/ee707351(VS.91).aspx http://adam-thompson.com/post/2010/07/03/Getting-Started-with-WCF-RIA-Services-for-Silverlight-4.aspx Technologies I don’t intend for this post to turn into a full WCF RIA Services tutorial but I did want to point out what technologies we will be using: Visual Studio.NET 2010 Silverlight 4.0 WCF RIA Services for Visual Studio 2010 Entity Framework 4.0 I also wanted to point out that the screenshots came from my personal development box which has a number of additional plug-ins and frameworks loaded so a few of the screenshots might not match 100% with what you see on your own machines. If you do not have Visual Studio 2010 you can download the express version from http://www.microsoft.com/express.  The Silverlight 4.0 tools and the WCF RIA Services components are installed via the Web Platform Installer (http://www.microsoft.com/web/download). Also, the examples given in this post are done in C#…sorry to you VB folks but the concepts are 100% identical. Setting up anew RIA Services Project This section will provide a step-by-step walkthrough of setting up a new RIA services project using a shared DLL for server side code and a simple Entity Framework model for data access.  All projects are created with the consistent ArchitectNow.RIAServices filename prefix and default namespace.  This would be modified to match your companies standards. First, open Visual Studio and open the new project window via File->New->Project.  In the New Project window, select the Silverlight folder in the Installed Templates section on the left and select “Silverlight Application” as your project type.  Verify your solution name and location are set appropriately.  Note that the project name we specified in the example below ends with .Client.  This indicates the name which will be given to our Silverlight project. I consider Silverlight a client-side technology and thus use this name to reflect that.  Click Ok to continue. During the creation on a new Silverlight 4 project you will be prompted with the following dialog to create a new web ASP.NET web project to host your Silverlight content.  As we are demonstrating the setup of a WCF RIA Services infrastructure, make sure the “Enable WCF RIA Services” option is checked and click OK.  Obviously, there are some other options here which have an effect on your solution and you are welcome to look around.  For our example we are going to leave the ASP.NET Web Application Project selected.  If you are interested in having your Silverlight project hosted in an MVC 2 application or a Web Site project these options are available as well.  Also, whichever web project type you select, the name can be modified here as well.  Note that it defaults to the same name as your Silverlight project with the addition of a .Web suffix. At this point, your full Silverlight 4 project and host ASP.NET Web Application should be created and will now display in your Visual Studio solution explorer as part of a single Visual Studio solution as follows: Now we want to add our WCF RIA Services projects to this same solution.  To do so, right-click on the Solution node in the solution explorer and select Add->New Project.  In the New Project dialog again select the Silverlight folder under the Visual C# node on the left and, in the main area of the screen, select the WCF RIA Services Class Library project template as shown below.  Make sure your project name is set appropriately as well.  For the sample below, we will name the project “ArchitectNow.RIAServices.Server.Entities”.   The .Server.Entities suffix we use is meant to simply indicate that this particular project will contain our WCF RIA Services entity classes (as you will see below).  Click OK to continue. Once you have created the WCF RIA Services Class Library specified above, Visual Studio will automatically add TWO projects to your solution.  The first will be an project called .Server.Entities (using our naming conventions) and the other will have the same name with a .Web extension.  The full solution (with all 4 projects) is shown in the image below.  The .Entities project will essentially remain empty and is actually a Silverlight 4 class library that will contain generated RIA Services domain objects.  It will be referenced by our front-end Silverlight project and thus allow for simplified sharing of code between the client and the server.   The .Entities.Web project is a .NET 4.0 class library into which we will put our data access code (via Entity Framework).  This is our server side code and business logic and the RIA Services plumbing will maintain a link between this project and the front end.  Specific entities such as our domain objects and other code we set to be shared will be copied automatically into the .Entities project to be used in both the front end and the back end. At this point, we want to do a little cleanup of the projects in our solution and we will do so by deleting the “Class1.cs” class from both the .Entities project and the .Entities.Web project.  (Has anyone ever intentionally named a class “Class1”?) Next, we need to configure a few references to make RIA Services work.  THIS IS A KEY STEP THAT CAUSES MANY HEADACHES FOR DEVELOPERS NEW TO THIS INFRASTRUCTURE! Using the Add References dialog in Visual Studio, add a project reference from the *.Client project (our Silverlight 4 client) to the *.Entities project (our RIA Services class library).  Next, again using the Add References dialog in Visual Studio, add a project reference from the *.Client.Web project (our ASP.NET host project) to the *.Entities.Web project (our back-end data services DLL).  To get to the Add References dialog, simply right-click on the project you with to add a reference to in the Visual Studio solution explorer and select “Add Reference” from the resulting context menu.  You will want to make sure these references are added as “Project” references to simplify your future debugging.  To reiterate the reference direction using the project names we have utilized in this example thus far:  .Client references .Entities and .Client.Web reference .Entities.Web.  If you have opted for a different naming convention, then the Silverlight project must reference the RIA Services Silverlight class library and the ASP.NET host project must reference the server-side class library. Next, we are going to add a new Entity Framework data model to our data services project (.Entities.Web).  We will do this by right clicking on this project (ArchitectNow.Server.Entities.Web in the above diagram) and selecting Add->New Project.  In the New Project dialog we will select ADO.NET Entity Data Model as in the following diagram.  For now we will call this simply SampleDataModel.edmx and click OK. It is worth pointing out that WCF RIA Services is in no way tied to the Entity Framework as a means of accessing data and any data access technology is supported (as long as the server side implementation maps to the RIA Services pattern which is a topic beyond the scope of this post).  We are using EF to quickly demonstrate the RIA Services concepts and setup infrastructure, as such, I am not providing a database schema with this post but am instead connecting to a small sample database on my local machine.  The following diagram shows a simple EF Data Model with two tables that I reverse engineered from a local data store.   If you are putting together your own solution, feel free to reverse engineer a few tables from any local database to which you have access. At this point, once you have an EF data model generated as an EDMX into your .Entites.Web project YOU MUST BUILD YOUR SOLUTION.  I know it seems strange to call that out but it important that the solution be built at this point for the next step to be successful.  Obviously, if you have any build errors, these must be addressed at this point. At this point we will add a RIA Services Domain Service to our .Entities.Web project (our server side code).  We will need to right-click on the .Entities.Web project and select Add->New Item.  In the Add New Item dialog, select Domain Service Class and verify the name of your new Domain Service is correct (ours is called SampleService.cs in the image below).  Next, click "Add”. After clicking “Add” to include the Domain Service Class in the selected project, you will be presented with the following dialog.  In it, you can choose which entities from the selected EDMX to include in your services and if they should be allowed to be edited (i.e. inserted, updated, or deleted) via this service.  If the “Available DataContext/ObjectContext classes” dropdown is empty, this indicates you have not yes successfully built your project after adding your EDMX.  I would also recommend verifying that the “Generate associated classes for metadata” option is selected.  Once you have selected the appropriate options, click “OK”. Once you have added the domain service class to the .Entities.Web project, the resulting solution should look similar to the following: Note that in the solution you now have a SampleDataModel.edmx which represents your EF data mapping to your database and a SampleService.cs which will contain a large amount of generated RIA Services code which RIA Services utilizes to access this data from the Silverlight front-end.  You will put all your server side data access code and logic into the SampleService.cs class.  The SampleService.metadata.cs class is for decorating the generated domain objects with attributes from the System.ComponentModel.DataAnnotations namespace for validation purposes. FINAL AND KEY CONFIGURATION STEP!  One key step that causes significant headache to developers configuring RIA Services for the first time is the fact that, when we added the EDMX to the .Entities.Web project for our EF data access, a connection string was generated and placed within a newly generated App.Context file within that project.  While we didn’t point it out at the time you can see it in the image above.  This connection string will be required for the EF data model to successfully locate it’s data.  Also, when we added the Domain Service class to the .Entities.Web project, a number of RIA Services configuration options were added to the same App.Config file.   Unfortunately, when we ultimately begin to utilize the RIA Services infrastructure, our Silverlight UI will be making RIA services calls through the ASP.NET host project (i.e. .Client.Web).  This host project has a reference to the .Entities.Web project which actually contains the code so all will pass through correctly EXCEPT the fact that the host project will utilize it’s own Web.Config for any configuration settings.  For this reason we must now merge all the sections of the App.Config file in the .Entities.Web project into the Web.Config file in the .Client.Web project.  I know this is a bit tedious and I wish there were a simpler solution but it is required for our RIA Services Domain Service to be made available to the front end Silverlight project.  Much of this manual merge can be achieved by simply cutting and pasting from App.Config into Web.Config.  Unfortunately, the <system.webServer> section will exist in both and the contents of this section will need to be manually merged.  Fortunately, this is a step that needs to be taken only once per solution.  As you add additional data structures and Domain Services methods to the server no additional changes will be necessary to the Web.Config. Next Steps At this point, we have walked through the basic setup of a simple RIA services solution.  Unfortunately, there is still a lot to know about RIA services and we have not even begun to take advantage of the plumbing which we just configured (meaning we haven’t even made a single RIA services call).  I plan on posting a few more introductory posts over the next few weeks to take us to this step.  If you have any questions on the content in this post feel free to reach out to me via this Blog and I’ll gladly point you in (hopefully) the right direction. Resources Prior to closing out this post, I wanted to share a number or resources to help you get started with RIA services.  While I plan on posting more on the subject, I didn’t invent any of this stuff and wanted to give credit to the following areas for helping me put a lot of these pieces into place.   The books and online resources below will go a long way to making you extremely productive with RIA services in the shortest time possible.  The only thing required of you is the dedication to take advantage of the resources available. Books Pro Business Applications with Silverlight 4 http://www.amazon.com/Pro-Business-Applications-Silverlight-4/dp/1430272074/ref=sr_1_2?ie=UTF8&qid=1291048751&sr=8-2 Silverlight 4 in Action http://www.amazon.com/Silverlight-4-Action-Pete-Brown/dp/1935182374/ref=sr_1_1?ie=UTF8&qid=1291048751&sr=8-1 Pro Silverlight for the Enterprise (Books for Professionals by Professionals) http://www.amazon.com/Pro-Silverlight-Enterprise-Books-Professionals/dp/1430218673/ref=sr_1_3?ie=UTF8&qid=1291048751&sr=8-3 Web Content RIA Services http://channel9.msdn.com/Blogs/RobBagby/NET-RIA-Services-in-5-Minutes http://silverlight.net/riaservices/ http://www.silverlight.net/learn/videos/all/net-ria-services-intro/ http://www.silverlight.net/learn/videos/all/ria-services-support-visual-studio-2010/ http://channel9.msdn.com/learn/courses/Silverlight4/SL4BusinessModule2/SL4LOB_02_01_RIAServices http://www.myvbprof.com/MainSite/index.aspx#/zSL4_RIA_01 http://channel9.msdn.com/blogs/egibson/silverlight-firestarter-ria-services http://msdn.microsoft.com/en-us/library/ee707336%28v=VS.91%29.aspx Silverlight www.silverlight.net http://msdn.microsoft.com/en-us/silverlight4trainingcourse.aspx http://channel9.msdn.com/shows/silverlighttv

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • how can I code a recursive query in an Entity Framework model?

    - by Greg
    Hi, I have a model which includes NODES, and RELATIONSHIPS (that tie the nodes together, via a parent_node, child_node arrangement). Q1 - Is there any way in EF / Linq-to-entities to perform a query on nodes (e.g. context.Nodes..) to find say "all parents" or "or children" in the graph? Q2 - If there's not in Linq-to-entities, is there any other way to do this other than writing a method that manually goes through and doing it? Q3 - If manual is the only way to do it, should I be concerned about the number of database hits that will be going out to the database as the method keeps recursing through the data? Or more specifically, is there any EF caching type feature that might assist here in ensuring the method is performance from a "number of database hits" point of view? thanks thanks

    Read the article

  • Is LINQ to SQL deprecated?

    - by Mayo
    Back in late 2008 there was alot of debate about the future of LINQ to SQL. Many suggested that Microsoft's investments in the Entity Framework in .NET 4.0 were a sign that LINQ to SQL had no future. I figured I'd wait before making my own decision since folks were not in agreement. Fast-forward 18 months and I've got vendors providing solutions that rely on LINQ to SQL and I have personally given it a try and really enjoyed working with it. I figured it was here to stay. But I'm reading a new book (C# 4.0 How-To by Ben Watson) and in chapter 21 (LINQ), he suggests that it "has been more or less deprecated by Microsoft" and suggests using LINQ to Entity Framework. My question to you is whether or not LINQ to SQL is officially deprecated and/or if authoritative entities (Microsoft, Scott Gu, etc.) officially suggest using LINQ to Entities instead of LINQ to SQL.

    Read the article

  • EF4, self tracking, repository pattern, SQL Server 2008 AND SQL Server Compact

    - by Darren
    Hi, I am creating a project using Entity Frameworks 4 and self tracking entities. I want to be able to either get the data from a sql server 2008 database or from sql server compact database (with the switch being in the config file). I am using the repository pattern and I will have the self tracking entities sitting in a separate assembly. Do I need two edmx files? If so, how do I generate only one set of STE's in the separate assembly? Also do I need to generate two context classes as well? I am unsure of the plumbing for all this. Can anyone help? Darren I forgot to add that the two databases will be identical and that the compact version is for offline usage.

    Read the article

  • Converting HTML special characters into their value using Python

    - by tipu
    I have a file that's littered with these: http://www.utexas.edu/learn/html/spchar.html That link just displays all sorts of HTML entities, such as – &ndash; — &mdash; ¡ &iexcl; and so on. Is it possible in Python to natively convert these characters back into their values so any occurrences of &ndash; will appear as – instead? My current approach was just to make a dict of key html entities and their utf-8 values and do search and replace, but I was wondering if there are any libraries that can take care of this for me.

    Read the article

  • Best practice. Do I save html tags in DB or store the html entity value?

    - by Matt
    Hi Guys, I was wondering about which way i should do the following. I am using the tiny MCE wysiwyg editor which formats the users data with the right html tags. Now, i need to save this data entered into the editor into a database table. Should I encode the html tags to their corresponding entities when inserting into the DB, then when i get the data back from the table, not have the encode it for XSS purposes but I'd still have to use eval for the html tags to format the text. OR Do i save the html tags into the database, then when i get the data back from the database encode the html tags to their entities, but then as the tags will appear to the user, I'd have to use the eval function to actually format the data as it was entered. My thoughts are with the first option, I just wondered on what you guys thought.

    Read the article

  • How do I get a right outer join in L2E?

    - by Dan
    I have two tables that I set up through the VS Entity Data Model Diagram tool. I'm trying to do a right outer join and it doesn't return results from the 2nd table. I have set up a 0..1 to MANY relationship from the diagram tool. When I run a Linq-To-Entities query, it still defaults to an INNER JOIN. From my understanding of entities, if I set up the relationship using VS, when I join the tables, it should automagically figure out the join syntax based on the relationship I supply. It doesn't seem to be doing that. I am using EF v1 (not Linq-to-Sql). Query I'm running: from s in SomeTable join t in SomeOtherTable on s.ID equals t.ID select new { s.MyFieldName, t.MyOtherFieldName }

    Read the article

  • Can't get results from a IQueryable.

    - by StackPointer
    Hi! I have the following code in Linq to Entity: var policy= from pol in conn.Policy where pol.Product.DESCRIPTION=="someProduct" SELECT pol; Then, the table Policy, has some dependencies for a table called Entity. If I do this: foreach(Policy p in policy){ if(!p.Entity.IsLoaded) p.Entity.Load(); IEnumerable<Entity> entities= from ent in p.Entity Where ent.EntityType.DESCRIPTION=="SomeEntityType" select ent; Console.Writeline(entities.ElementAt(0).NAME); } It says, "Object not set to an instance", but if I do: foreach(Policy p in policy){ if(!p.Entity.IsLoaded) p.Entity.Load(); foreach(Entity et in p.Entity)Console.Write(et.NAME); } It works! Can anyone tell me why? Thank you, Best regards.

    Read the article

  • RegEx to replace html entities

    - by DeltaFox
    Hi, all. I'm looking for a way to replace the bullet character in Greasemonkey. I assume a Regular Expression will do the trick, but I'm not as well-versed in it as many of you. For example, "SampleSite.com • Page Title" becoming "SampleSite.com Page Title". The issue is that the character has already been parsed by the time Greasemonkey has gotten to it, and I don't know how to make it recognize the symbol. I've tried these so far, but they haven't worked: newTitle = document.title.replace(/•/g, ""); newTitle = document.title.replace("•", ""); //just for grins, but didn't work anyway

    Read the article

  • PHP: best practice. Do i save html tags in DB or store the html entity value?

    - by Matt
    Hi Guys, I was wondering about which way i should do the following. I am using the tiny MCE wysiwyg editor which formats the users data with the right html tags. Now, i need to save this data entered into the editor into a database table. Should i encode the html tags to their corresponding entities when inserting into the DB, then when i get the data back from the table, not have the encode it for XSS purposes but i'd still have to use eval for the html tags to format the text. OR Do i save the html tags into the database, then when i get the data back from the database encode the html tags to their entities, but then as the tags will appear to the user, i'd have to use the eval function to actually format the data as it was entered. My thoughts are with the first option, i just wondered on what you guys thought. Thanks M

    Read the article

  • Leave entity intact in XML + XSLT

    - by Kuroki Kaze
    I transform XML to (sort of) HTML with XSL stylesheets (using Apache Xalan). In XML there can be entities like &mdash;, which must be left as is. In beginning of XML file I have a doctype which references these entities. What should I do for entity to be left unchanged? <!DOCTYPE article [ <!ENTITY mdash "&mdash;"><!-- em dash --> ]> gives me SAXParseException: Recursive entity expansion, 'mdash' when encountering &mdash in XML text.

    Read the article

< Previous Page | 16 17 18 19 20 21 22 23 24 25 26 27  | Next Page >