Search Results

Search found 3525 results on 141 pages for 'infinite sequence'.

Page 20/141 | < Previous Page | 16 17 18 19 20 21 22 23 24 25 26 27  | Next Page >

  • Execution sequence inside a jquery event handler

    - by user576358
    I have a big issue with the execution squence inside this jquery handler : Was wondering if anyone has come accross this before: I have a simple form: <form action='foo.cgi' id='myForm' > <input type=text name='name' /> <input type=submit value='Find it!'/> </form> when user clicks on Find it! would like to change the cursor to 'progress' before the data is returned through an ajax call: $(document).ready(function(){ $("#myForm ").submit(function(){ $("body").css("cursor", "progress") ; htmlobj=$.ajax({url:server_url,..........); } } However: The cursor [line 2 above ] does not change until data is returned through ajax - Seems like line 3. gets executed before 2. Any help is greatly appreciated

    Read the article

  • find if list 1 is a sequence of list 2 in haskell

    - by Isaak Wahb
    im trying to check if a given list is a subsequence of another list: here are example of lists which gives true: subseq "" "w" subseq "w" "w" subseq "ab" "cab" subseq "cb" "cab" subseq "aa" "xaxa" not (subseq "aa" "xax") not (subseq "ab" "ba") i just come to this but in some cases it gives a wrong result subseq :: Eq a => [a] -> [a] -> Bool subseq [] [] = True subseq [] ys = True subseq xs [] = False subseq (x:xs) (y:ys) = x == y || subseq xs ( 1 `drop` ys )

    Read the article

  • Selecting a sequence of elements from the IList

    - by KhanS
    I have a IList. where the object PersonDetails consists of the persons name, address and phone number. The list consists of more than 1000 person details. I would like to display 50 PersonDetails per page. Is there a way to select only 50 elements from the list, and return them. For example. myList.select(1,50) myList.select(51, 100) I am able to select only first 50 by using. myList.Take(50); The entire list is at the wcf service, and i would like to get only fifty elements at a time.

    Read the article

  • Object initialization sequence in Objective-C

    - by Alex
    Hello everyone. The Cocoa framework has a convention to always call self = [super init] in the init method of an inherited class, because [super init] may return a new instance. What will happen if I do this? @interface MyClass : NSObject /* or any other class */ { int ivar_; } @end @implementation MyClass - (id)init { ivar_ = 12345; if ((self = [super init])) { NSLog(@"ivar_'s value is %d", ivar_); } return self; } @end In the case when [super init] returns a new instance, what will I see in the console? ivar_'s value is 0? I can't think of a way to check this myself, because I don't know which class may return a new instance from its init method. Also, can't seem to find explicit clarification for this scenario in the docs. Could anyone help me out? Thanks!

    Read the article

  • Can i execute the events in sequence in jquery

    - by Mirage
    I am using accordians. I want that if someone click on hyperlink inside the accordion , then that accordion should slide up slowly and only after that the nect accordion falls down or open $(".accord").live('click', function(){ $('#rr1').next().slideUp('slow'); $('#rr3').next().slideDown('slow'); But i have seen that the other accordion starts opening up at the same time when the other is closing. It it something related to asynchronous thing. I don't know });

    Read the article

  • Translate sequence in macro parameters to separate macros

    - by Alex Tiger
    How to acces each element in macro if the definition is like MACRO(name, seq) and the code is like: MACRO("TheName", (Elem1) (Elem2) (Elem3) ) I want to generate the next code: MACRO("TheName", ELEMMACRO(Elem1) ELEMMACRO(Elem2) ELEMMACRO(Elem3) ) Or something like that. In other words, I want to process every parameter separately (I don't care of definition, even if it will be something like MACRO("TheName", Elem1, Elem2, Elem3 ) There could be more elements, there could be less. I have tried V_ARGS (I need it only for gcc), but I can only copy all the elements by that, not to process them separately. What can I do? P.S. Because of some reasons, I can't use Boost.

    Read the article

  • jQuery sequence

    - by Happy
    $(".item").each(function(){ var item_link = $(this).find("a").attr("href"); $(this).prepend('<div class="img_url"></div>'); var img_url = $('div.img_url', this); $.get(item_link, function(data) { var src = $('.poster img', data).attr('src'); img_url.html(src); }); }); Each .get should be started after the previous is finished. Now all the .get start in one time. Any idea?

    Read the article

  • Python: Determine whether list of lists contains a defined sequence

    - by duhaime
    I have a list of sublists, and I want to see if any of the integer values from the first sublist plus one are contained in the second sublist. For all such values, I want to see if that value plus one is contained in the third sublist, and so on, proceeding in this fashion across all sublists. If there is a way of proceeding in this fashion from the first sublist to the last sublist, I wish to return True; otherwise I wish to return False. In other words, for each value in sublist one, for each "step" in a "walk" across all sublists read left to right, if that value + n (where n = number of steps taken) is contained in the current sublist, the function should return True; otherwise it should return False. (Sorry for the clumsy phrasing--I'm not sure how to clean up my language without using many more words.) Here's what I wrote. a = [ [1,3],[2,4],[3,5],[6],[7] ] def find_list_traversing_walk(l): for i in l[0]: index_position = 0 first_pass = 1 walking_current_path = 1 while walking_current_path == 1: if first_pass == 1: first_pass = 0 walking_value = i if walking_value+1 in l[index_position + 1]: index_position += 1 walking_value += 1 if index_position+1 == len(l): print "There is a walk across the sublists for initial value ", walking_value - index_position return True else: walking_current_path = 0 return False print find_list_traversing_walk(a) My question is: Have I overlooked something simple here, or will this function return True for all true positives and False for all true negatives? Are there easier ways to accomplish the intended task? I would be grateful for any feedback others can offer!

    Read the article

  • Unescape _xHHHH_ XML escape sequences using Python

    - by John Machin
    I'm using Python 2.x [not negotiable] to read XML documents [created by others] that allow the content of many elements to contain characters that are not valid XML characters by escaping them using the _xHHHH_ convention e.g. ASCII BEL aka U+0007 is represented by the 7-character sequence u"_x0007_". Neither the functionality that allows representation of any old character in the document nor the manner of escaping is negotiable. I'm parsing the documents using cElementTree or lxml [semi-negotiable]. Here is my best attempt at unescapeing the parser output as efficiently as possible: import re def unescape(s, subber=re.compile(r'_x[0-9A-Fa-f]{4,4}_').sub, repl=lambda mobj: unichr(int(mobj.group(0)[2:6], 16)), ): if "_" in s: return subber(repl, s) return s The above is biassed by observing a very low frequency of "_" in typical text and a better-than-doubling of speed by avoiding the regex apparatus where possible. The question: Any better ideas out there?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Replacing unversioned files in WiX major upgrade.

    - by Joshua
    I am still having this problem. This is the closest I have come to a solution that works, and yet it doesn't quite work. Here is (most of) the code: <Product Id='$(var.ProductCode)' UpgradeCode='$(var.UpgradeCode)' Name="Pathways" Version='$(var.ProductVersion)' Manufacturer='$(var.Manufacturer)' Language='1033'> Maximum="$(var.ProductVersion)" IncludeMaximum="no" Language="1033" Property="OLDAPPFOUND" / -- -- -- There is a later version of this program installed. The problem I am having is that I need the two files in the Database component to replace the previous copies. Since these files are unversioned, I have attempted to use the CompanionFile tag set to the PathwaysExe since that is the main executable of the application, and it IS being updated, even if the log says it isn't! The strangest thing about this is that the PathwaysLdf file IS BEING UPDATED CORRECTLY, and the PathwaysMdf file IS NOT. The log seems to indicate that the "Existing file is of an equal version (Checked using version of companion)". This is very strange because that file is being replaced just fine. The only idea I have left is that this problem has to do with the install sequence, and I'm not sure how to proceed! I have the InstallExecuteSequence set like I do because of the SettingsXml file, and my need to NOT overwrite that file, which is actually working now, so whatever solution works for the database files can't break the working settings file! ;) The full log is located at: http://pastebin.com/HFiGKuKN PLEASE AND THANK YOU!

    Read the article

  • rake test not copying development postgres db with sequences

    - by Robert Crida
    I am trying to develop a rails application on postgresql using a sequence to increment a field instead of a default ruby approach based on validates_uniqueness_of. This has proved challenging for a number of reasons: 1. This is a migration of an existing table, not a new table or column 2. Using parameter :default = "nextval('seq')" didn't work because it tries to set it in parenthesis 3. Eventually got migration working in 2 steps: change_column :work_commencement_orders, :wco_number_suffix, :integer, :null => false#, :options => "set default nextval('wco_number_suffix_seq')" execute %{ ALTER TABLE work_commencement_orders ALTER COLUMN wco_number_suffix SET DEFAULT nextval('wco_number_suffix_seq'); } Now this would appear to have done the correct thing in the development database and the schema looks like: wco_number_suffix | integer | not null default nextval('wco_number_suffix_seq'::regclass) However, the tests are failing with PGError: ERROR: null value in column "wco_number_suffix" violates not-null constraint : INSERT INTO "work_commencement_orders" ("expense_account_id", "created_at", "process_id", "vo2_issued_on", "wco_template", "updated_at", "notes", "process_type", "vo_number", "vo_issued_on", "vo2_number", "wco_type_id", "created_by", "contractor_id", "old_wco_type", "master_wco_number", "deadline", "updated_by", "detail", "elective_id", "authorization_batch_id", "delivery_lat", "delivery_long", "operational", "state", "issued_on", "delivery_detail") VALUES(226, '2010-05-31 07:02:16.764215', 728, NULL, E'Default', '2010-05-31 07:02:16.764215', NULL, E'Procurement::Process', NULL, NULL, NULL, 226, NULL, 276, NULL, E'MWCO-213', '2010-06-14 07:02:16.756952', NULL, E'Name 4597', 220, NULL, NULL, NULL, 'f', E'pending', NULL, E'728 Test Road; Test Town; 1234; Test Land') RETURNING "id" The explanation can be found when you inspect the schema of the test database: wco_number_suffix | integer | not null So what happened to the default? I tried adding task: template: smmt_ops_development to the database.yml file which has the effect of issuing create database smmt_ops_test template = "smmt_ops_development" encoding = 'utf8' I have verified that if I issue this then it does in fact copy the default nextval. So clearly rails is doing something after that to suppress it again. Any suggestions as to how to fix this? Thanks Robert

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • Redirect with htaccess for images onto another server without redirect looping

    - by Jeff
    Hey guys, I currently have a host where my main site is hosted on. I have set up nginx on another server to mirror/cache files being requested if it doesn't have it already, in particular images and flv videos. For example: www.domain.com is my main site. www.domain.com/video/video.flv www.domain.com/images/1.png I would like to ask apache to redirect it to imgserv.domain.com (imgserv.domain.com points to another server IP) imgserv.domain.com/video/video.flv imgserv.domain.com/images/1.png Basically redirect everything with certain filetypes and preserving the structure of the URL, like flv etc. I tried something but I am getting a redirect looping error. Could someone help me out? Thank you!

    Read the article

  • Are endless loops in bad form?

    - by rlbond
    So I have some C++ code for back-tracking nodes in a BFS algorithm. It looks a little like this: typedef std::map<int> MapType; bool IsValuePresent(const MapType& myMap, int beginVal, int searchVal) { int current_val = beginVal; while (true) { if (current_val == searchVal) return true; MapType::iterator it = myMap.find(current_val); assert(current_val != myMap.end()); if (current_val == it->second) // end of the line return false; current_val = it->second; } } However, the while (true) seems... suspicious to me. I know this code works, and logically I know it should work. However, I can't shake the feeling that there should be some condition in the while, but really the only possible one is to use a bool variable just to say if it's done. Should I stop worrying? Or is this really bad form. EDIT: Thanks to all for noticing that there is a way to get around this. However, I would still like to know if there are other valid cases.

    Read the article

  • Get stacktrace from stuck python process

    - by piquadrat
    I have to run a legacy Zope2 website and have some grievance with it. The biggest issue is that, occasionally, it just locks up, running at 100% CPU load and not answering to requests anymore. While the problem isn't reproducible on a regular basis, one page containing 3 dynamic graphs triggers it sometimes, so I suspect some kind of race condition that leads to an endless loop or a stuck busywait. The problem is, I have not yet found a way to debug this thing. There's nothing in the Zope logs and nothing in the system logs. I tried the suggestions from this question to get a stacktrace, but the only signal that has any effect is SIGKILL. Is there another possibility to find out where exactly the process is when it gets stuck?

    Read the article

  • Debugging Key-Value-Observing overflow.

    - by Paperflyer
    I wrote an audio player. Recently I started refactored some of the communication flow to make it fully MVC-compliant. Now it crashes, which in itself is not surprising. However, it crashes after a few seconds inside the Cocoa key-value-observing routines with a HUGE stack trace of recursive calls to NSKeyValueNotifyObserver. Obviously, it is recursively observing a value and thus overflowing the NSArray that holds pending notifications. According to the stack trace, the program loops from observeValueForKeyPath to setMyValue and back. Here is the according code: - (void)observeValueForKeyPath:(NSString *)keyPath ofObject:(id)object change:(NSDictionary *)change context:(void *)context { if ([keyPath isEqual:@"myValue"] && object == myModel && [self myValue] != [myModel myValue]) { [self setMyValue:[myModel myValue]; } } and - (void)setMyValue:(float)value { myValue = value; [myModel setMyValue:value]; } myModel changes myValue every 0.05 seconds and if I log the calls to these two functions, they get called only every 0.05 seconds just as they should be, so this is working properly. The stack trace looks like this: -[MyDocument observeValueForKeyPath:ofObject:change:context:] NSKeyValueNotifyObserver NSKeyValueDidChange -[NSObject(NSKeyValueObserverNotification) didChangeValueForKey:] -[MyDocument setMyValue:] _NSSetFloatValueAndNotify …repeated some ~8k times until crash Do you have any idea why I could still be spamming the KVO queue?

    Read the article

  • Beginner python - stuck in a loop

    - by Jeremy
    I have two begininer programs, both using the 'while' function, one works correctly, and the other gets me stuck in a loop. The first program is this; num=54 bob = True print('The guess a number Game!') while bob == True: guess = int(input('What is your guess? ')) if guess==num: print('wow! You\'re awesome!') print('but don\'t worry, you still suck') bob = False elif guess>num: print('try a lower number') else: print('close, but too low') print('game over')`` and it gives the predictable output of; The guess a number Game! What is your guess? 12 close, but too low What is your guess? 56 try a lower number What is your guess? 54 wow! You're awesome! but don't worry, you still suck game over However, I also have this program, which doesn't work; #define vars a = int(input('Please insert a number: ')) b = int(input('Please insert a second number: ')) #try a function def func_tim(a,b): bob = True while bob == True: if a == b: print('nice and equal') bob = False elif b > a: print('b is picking on a!') else: print('a is picking on b!') #call a function func_tim(a,b) Which outputs; Please insert a number: 12 Please insert a second number: 14 b is picking on a! b is picking on a! b is picking on a! ...(repeat in a loop).... Can someone please let me know why these programs are different? Thank you!

    Read the article

  • iPhone: Infinitely looping content inside UIScrollView

    - by Cuzog
    In my app, I'm designing a custom picker that allows the user to choose an item by scrolling horizontally and touching it. I need the buttons inside that view to loop around infinitely as the user scrolls in a certain direction. What would be the best way to tackle this feature while maintaining the inertial scrolling of UIScrollView when the content loops around out of the view? From my research of others trying to attempt this, they have trouble maintaining the deceleration animation if the scroll position is programatically shifted mid-scroll after the user lifts their finger. How can I work around this limitation? An example of an app that currently has this feature is Apple's MobileMe Gallery app. In the interface, after choosing a gallery, at the top, there is a horizontally scrollable photo picker that loops infinitely as it is dragged one direction. Any advice is greatly appreciated.

    Read the article

  • Help! I got a runaway PHP script. My server is down.

    - by gAMBOOKa
    I got a PHP script that is looping and will continue to do so for about another hour. How do I stop it. The script explicitly overrides the time out and the memory buffer. It's on a shared hosting server with cPanel installed. The entire website is down until the script completes. I had added a usleep(100000) statement, but it doesn't appear to work.

    Read the article

  • How can I test potentially browser crashing javascript

    - by yaya3
    I've been having a crack at some of the problems over at http://projecteuler.net/ with JavaScript. I've been using a simple html page and running my code in script tags so I can log my results in the browsers' console. When experimenting with loops I sometimes cause the browser to crash. Is there a better environment for me to do this kind of development?

    Read the article

< Previous Page | 16 17 18 19 20 21 22 23 24 25 26 27  | Next Page >