Search Results

Search found 6987 results on 280 pages for 'examples'.

Page 208/280 | < Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >

  • Compute the Length of Largest substring that starts and ends with the same substring

    - by Deepak
    Hi People, Below is the Problem Statement: PS: Given a string and a non-empty substring sub, compute recursively the largest substring which starts and ends with sub and return its length. Examples: strDist("catcowcat", "cat") ? 9 strDist("catcowcat", "cow") ? 3 strDist("cccatcowcatxx", "cat") ? 9 Below is my Code: (Without recursion)//since i found it hard to implement with recursion. public int strDist(String str, String sub){ int idx = 0; int max; if (str.isEmpty()) max = 0; else max=1; while ((idx = str.indexOf(sub, idx)) != -1){ int previous=str.indexOf(sub, idx); max = Math.max(max,previous); idx++; } return max; } Its working for few as shown below but returns FAIL for others. Expected This Run strDist("catcowcat", "cat") ? 9 6 FAIL strDist("catcowcat", "cow") ? 3 3 OK strDist("cccatcowcatxx", "cat") ? 9 8 FAIL strDist("abccatcowcatcatxyz", "cat") ? 12 12 OK strDist("xyx", "x") ? 3 2 FAIL strDist("xyx", "y") ? 1 1 OK strDist("xyx", "z") ? 0 1 FAIL strDist("z", "z") ? 1 1 OK strDist("x", "z") ? 0 1 FAIL strDist("", "z") ? 0 0 OK strDist("hiHellohihihi", "hi") ? 13 11 FAIL strDist("hiHellohihihi", "hih") ? 5 9 FAIL strDist("hiHellohihihi", "o") ? 1 6 FAIL strDist("hiHellohihihi", "ll") ? 2 4 FAIL Could you let me whats wrong with the code and how to return the largest substring that begins and ends with sub with its respective length.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • MPMoviePlayerController - streaming works on 3GS, not on anything pre-3GS

    - by Canada Dev
    I am having some serious issues and annoyances with MPMoviePlayerController. In my app you can watch trailers for some movies in .mov format. I have tested with a friend and had users report that it does not work on their device, which are all 3G. I have tested on my own, a 3GS and playback works fine. I have tried on a 1st gen iPhone and it doesn't work. So I am lead to believe it's a memory issue, and that it's simply stopping the playback and returning to the previous screen. Below is the code I use to launch the player, which is straight out of the MoviePlayer example from Apple. MPMoviePlayerController *mp = [[MPMoviePlayerController alloc] initWithContentURL:[NSURL URLWithString:trailerURL]]; if (mp) { self.moviePlayer = mp; [mp release]; [self.moviePlayer play]; } I have tried to check the NSError from the notifications, but the only thing I get is "An unknown playback error occurred" for both the localizedDescription and localizedRecoverySuggestion, making it impossible to figure out exactly why it's not working. I have seen many examples of people who just have issues with the movie player, but it's starting to annoy me that it sometimes seem to work fine and other times it just doesn't (again, appearing like a memory issue). Thanks for any help/feedback provided

    Read the article

  • Automatically resize jQuery UI dialog to the width of the content loaded by ajax

    - by womp
    I'm having a lot of trouble finding specific information and examples on this. I've got a number of jQuery UI dialogs in my application attached to divs that are loaded with .ajax() calls. They all use the same setup call: $(".mydialog").dialog({ autoOpen: false, resizable: false, modal: true }); I just want to have the dialog resize to the width of the content that gets loaded. Right now, the width just stays at 300px (the default) and I get a horizontal scrollbar. As far as I can tell, "autoResize" is no longer an option for dialogs, and nothing happens when I specify it. I'm trying to not write a separate function for each dialog, so .dialog("option", "width", "500") is not really an option, as each dialog is going to have a different width. Specifying width: 'auto' for the dialog options just makes the dialogs take up 100% of the width of the browser window. What are my options? I'm using jQuery 1.4.1 with jQuery UI 1.8rc1. It seems like this should be something that is really easy. EDIT: I've implemented a kludgy workaround for this, but I'm still looking for a better solution.

    Read the article

  • Python with Wiimote using pywiiuse module

    - by Anon
    After seeing the abilities and hackibility of wiimotes I really want to use it in my 'Intro to programming' final. Everyone must make a python program and present it to the class. I want to make a game with pygame incorporating a wiimote. I found pywiiuse which is a very basic wrapper for the wiiuse library using c types. I can NOT get anything beyond LEDs and vibrating to work. Buttons, IR, motion sensing, nothing. I've tried different versions of wiiuse, pywiiuse, even python. I can't even get the examples that came with it to run. Here's the code I made as a simple test. I copied some of the example C++ code. from pywiiuse import * from time import sleep #Init wiimotes = wiiuse_init() #Find and start the wiimote found = wiiuse_find(wiimotes,1,5) #Make the variable wiimote to the first wiimote init() found wiimote = wiimotes.contents #Set Leds wiiuse_set_leds(wiimote,WIIMOTE_LED_1) #Rumble for 1 second wiiuse_rumble(wiimote,1) sleep(1) wiiuse_rumble(wiimote,0) #Turn motion sensing on(supposedly) wiiuse_motion_sensing(wiimote,1) while 1: #Poll the wiimotes to get the status like pitch or roll if(wiiuse_poll(wiimote,1)): print 'EVENT' And here's the output when I run it. wiiuse version 0.9 wiiuse api version 8 [INFO] Found wiimote [assigned wiimote id 1]. EVENT EVENT Traceback (most recent call last): File "C:\Documents and Settings\Nick\Desktop\wiimotetext.py", line 26, in <mod ule> if(wiiuse_poll(wiimote,1)): WindowsError: exception: access violation reading 0x00000004 It seems each time I run it, it prints out EVENT 2-5 times until the trace back. I have no clue what to do at this point, I've been trying for the past two days to get it working. Thanks!

    Read the article

  • When and how should independent hierarchies be used in clojure?

    - by Rob Lachlan
    Clojure's system for creating an ad hoc hierarchy of keywords is familiar to most people who have spent a bit of time with the language. For example, most demos and presentations of the language include examples such as (derive ::child ::parent) and they go on to show how this can be used for multi-method dispatch. In all of the slides and presentations that I've seen, they use the global hierarchy. But it is possible to put keyword relationships in independent hierarchies, by using (derive h ::child ::parent), where h is created by (make-hierarchy). Some questions, therefore: Are there any guidelines on when this is useful or necessary? Are there any functions for manipulating hierarchies? Merging is particularly useful, so I do this: (defn merge-h [& hierarchies] (apply merge-with (cons #(merge-with clojure.set/union %1 %2) hierarchies)) But I was wondering if such functions already exist somewhere. EDIT: Changed "custom" hierarchy to "independent" hierarchy, since that term better describes this animal. Also, I've done some research and included my own answer below. Further comments are welcome.

    Read the article

  • @OneToMany and composite primary keys?

    - by Kris Pruden
    Hi, I'm using Hibernate with annotations (in spring), and I have an object which has an ordered, many-to-one relationship which a child object which has a composite primary key, one component of which is a foreign key back to the id of the parent object. The structure looks something like this: +=============+ +================+ | ParentObj | | ObjectChild | +-------------+ 1 0..* +----------------+ | id (pk) |-----------------| parentId | | ... | | name | +=============+ | pos | | ... | +================+ I've tried a variety of combinations of annotations, none of which seem to work. This is the closest I've been able to come up with: @Entity public class ParentObject { @Column(nullable=false, updatable=false) private String id; @OneToMany(mappedBy="object", fetch=FetchType.EAGER) @IndexColumn(name = "pos", base=0) private List<ObjectChild> attrs; ... } @Entity public class ChildObject { @Embeddable public static class Pk implements Serializable { @Column(nullable=false, updatable=false) private String objectId; @Column(nullable=false, updatable=false) private String name; @Column(nullable=false, updatable=false) private int pos; ... } @EmbeddedId private Pk pk; @ManyToOne @JoinColumn(name="parentId") private ParentObject parent; ... } I arrived at this after a long bout of experimentation in which most of my other attempts yielded entities which hibernate couldn't even load for various reasons. The error I get when I try to read one of these objects (they seem to save OK), I get an error of this form: org.hibernate.exception.SQLGrammarException: could not initialize a collection: ... And the root cause is this: com.mysql.jdbc.exceptions.jdbc4.MySQLSyntaxErrorException: Unknown column 'attrs0_.id' in 'field list' I'm sure I'm missing something simple, but the documentation is not clear on this matter, and I haven't been able to find any examples of this anywhere else. Thanks!

    Read the article

  • Add Zend_Navigation to the View with old legacy bootstrap

    - by Grant Collins
    Hi, I've been struggling with Zend_Navigation all weekend, and now I have another problem, which I believe has been the cause of a lot of my issues. I am trying to add Zend_Navigation to a legacy 1.7.6 Zend Framework application, i've updated the Zend Library to 1.9.0 and updated the bootstrap to allow this library update. The problem is that I don't know how, and the examples show the new bootstrap method of how to add the Navigation object to the view, I've tried this: //initialise the application layouts with the MVC helpers $layout = Zend_Layout::startMvc(array('layoutPath' => '../application/layouts')); $view = $layout->getView(); $configNav = new Zend_Config_Xml('../application/config/navigation.xml', 'navigation'); $navigation = new Zend_Navigation($configNav); $view->navigation($navigation); $viewRenderer = new Zend_Controller_Action_Helper_ViewRenderer(); $viewRenderer->setView($view); This seems to run through fine, but when I go to use the breadcrumb view helper in my layout, it errors with: Strict Standards: Creating default object from empty value in C:\www\moobia\development\website\application\modules\employers\controllers\IndexController.php on line 27 This is caused by the following code in the init() function of my controller. $uri = $this->_request->getPathInfo(); $activeNav = $this->view->navigation()->findByUri($uri); <- this is null when called $activeNav->active = true; I believe it's because the Zend_Navigation object is not in the view. I would look at migrating the bootstrap to the current method, but at present I am running out of time for a release. Thanks, Grant

    Read the article

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • Linq to find pair of points with longest length?

    - by Chris
    I have the following code: foreach (Tuple<Point, Point> pair in pointsCollection) { var points = new List<Point>() { pair.Value1, pair.Value2 }; } Within this foreach, I would like to be able to determine which pair of points has the most significant length between the coordinates for each point within the pair. So, let's say that points are made up of the following pairs: (1) var points = new List<Point>() { new Point(0,100), new Point(100,100) }; (2) var points = new List<Point>() { new Point(150,100), new Point(200,100) }; So I have two sets of pairs, mentioned above. They both will plot a horizontal line. I am interested in knowing what the best approach would be to find the pair of points that have the greatest distance between, them, whether it is vertically or horizontally. In the two examples above, the first pair of points has a difference of 100 between the X coordinate, so that would be the point with the most significant difference. But if I have a collection of pairs of points, where some points will plot a vertical line, some points will plot a horizontal line, what would be the best approach for retrieving the pair from the set of points whose difference, again vertically or horizontally, is the greatest among all of the points in the collection? Thanks! Chris

    Read the article

  • Manipulate score/rank on query results from NHibernate.Search

    - by Fernando Figueiredo
    I've been working with NHibernate, NHibernate.Search and Lucene.Net to improve the search engine used on the website I develop. Basically, I use it to search contents of corporations specification documents. This is not to be confused with Lucene's notion of documents: in my case, a specification document (which I'll hereafter call a "specdoc") can contain many pages, and the content of these pages are the ones that are actually indexed (thus, the pages themselves are the ones that fall into Lucene's concept of documents). So, the pages belong to a specdoc, that in turn belong to a corporation (so, a corporation can have many specdocs). I'm using NHibernate.Search "IndexEmbedded" and "ContainedIn" attributes to associate the pages with their specdoc and the specdocs to their corporations, so I can query for terms in specdoc pages and have Lucene/NH.Search return either the pages themselves, the specdocs, or the corporations that match the query on the pages. I can query this way and get ranked results, thus presenting results (that is, corporations, specdocs or pages) by relevance, which is great. But now I need something more. Specifically in the case where I query terms and have NH.Search return the corporations that match, I need to manually/artificially tune the score of some of the results, because there are corporations that I want to show up on the top of the result set - think of "sponsored results". I'm thinking of doing it on my application, maybe creating an entity/database table that contain an association to the corporation entity, and a score boost value. But I don't know how to feed this to Lucene and have it boost the results accordingly at search time. Initially I thought about deriving a Similarity class to do this, but it doesn't look like Similarity can be used to modify result sets at search time. As per this page, it looks like what I need is to mess around with weight or scoring. But the docs are a little superficial in that there are no examples on how to implement a custom scoring, let alone integrate it with NH.Search. So, does anyone know how to do this, or point me to some documentation or working example on how to do something similar? Thanks!

    Read the article

  • MD5 Hashing Given a Key in C#

    - by Jared
    I've been looking for a way to hash a given string in C# that uses a predetermined key. On my adventures through the internet trying to find an example i have seen lots of MD5CryptoServiceProvider examples which seem to use a default key for the machine, but none of them that apply a specific key. I need to have a specific key to encode data as to synchronize it to someone else's server. I hand them a hashed string and an ID number and they use that analyze the data and return a similar set to me. So is there anyway to get md5 to hash via a specific key that would be consistent to both. I would prefer this to be done in C#, but if its not possible with the libraries can you do so with some web languages like php or asp? Edit: Misunderstood the scenario I was thrown into and after a little sitting and thinking about why they would have me use a key it appears they want a key appended to the end of the string and hashed. That way the server can appended the key it has along with the data passed to ensure its a valid accessing computer. Anyways... thanks all ^_^ Edit2: As my comment below says, it was the term 'salting' I was oblivious to. Oh the joys of getting thrown into something new with no directions.

    Read the article

  • Yacc and Lex inclusion confusion

    - by thejohnmeister
    I am wondering how to correctly compile a program with a Makefile that has calls to yyparse in it? This is what I do: I have a Makefile that compiles all my regular files and they have no connections to y.tab.c or lex.yy.c (Am I supposed to have them?) I do this on top of my code: #include "y.tab.c" #include "lex.yy.c" #include "y.tab.h" This is what happens when I try to make the program: When I just type in "make", it gives me many warnings. Some of the examples are shown below. In function yywrap': /src/parser.y:12: multiple definition ofyywrap' server.o :/src/parser.y:12: first defined here utils.o: In function yyparse': /src/y.tab.c:1175: multiple definition ofyyparse' server.o:/src/y.tab.c:1175: first defined here utils.o I get many different errors referring to different yy_* files. I have compiled successfully with multiple calls to yyparse in the past, but this time seems to be different. It seems an awful lot like an inclusion problem somewhere but I can't tell what it is. All my header files have ifndef conditions, as well. Thanks for your help!

    Read the article

  • Neo4j Reading data / performing shortest path calculations on stored data

    - by paddydub
    I'm using the Batch_Insert example to insert Data into the database How can i read this data back from the database. I can't find any examples of how i do this. public static void CreateData() { // create the batch inserter BatchInserter inserter = new BatchInserterImpl( "var/graphdb", BatchInserterImpl.loadProperties( "var/neo4j.props" ) ); Map<String,Object> properties = new HashMap<String,Object>(); properties.put( "name", "Mr. Andersson" ); properties.put( "age", 29 ); long node1 = inserter.createNode( properties ); properties.put( "name", "Trinity" ); properties.remove( "age" ); long node2 = inserter.createNode( properties ); inserter.createRelationship( node1, node2, DynamicRelationshipType.withName( "KNOWS" ), null ); inserter.shutdown(); } I would like to store graph data in the database, graph.makeEdge( "s", "c", "cost", (double) 7 ); graph.makeEdge( "c", "e", "cost", (double) 7 ); graph.makeEdge( "s", "a", "cost", (double) 2 ); graph.makeEdge( "a", "b", "cost", (double) 7 ); graph.makeEdge( "b", "e", "cost", (double) 2 ); Dijkstra<Double> dijkstra = getDijkstra( graph, 0.0, "s", "e" ); What is the best method to store this kind data with 10000's of edges. Then run the Dijskra algorighm to find shortest path calculations using the stored graph data.

    Read the article

  • In Seam what's the difference between injected EntityManager and getEntityManager from EntityHome

    - by Navi
    I am testing a Seam application using the needle test API. In my code I am using the getEntityManager() method from EntityHome. When I run the unit tests against an in memory database I get the following exception: java.lang.IllegalStateException: No application context active at org.jboss.seam.Component.forName(Component.java:1945) at org.jboss.seam.Component.getInstance(Component.java:2005) at org.jboss.seam.Component.getInstance(Component.java:1983) at org.jboss.seam.Component.getInstance(Component.java:1977) at org.jboss.seam.Component.getInstance(Component.java:1972) at org.jboss.seam.framework.Controller.getComponentInstance(Controller.java:272) at org.jboss.seam.framework.PersistenceController.getPersistenceContext(PersistenceController.java:20) at org.jboss.seam.framework.EntityHome.getEntityManager(EntityHome.java:177) etc .. I can resolve some of these errors by injecting the EntityManager with @In EntityManager entityManager; Unfortunately the persist method of EntityHome also calls the getEntityManager. This means a lot of mocks or rewriting the code somehow. Is there any workaround and why is this exception thrown anyway? I am using Seam 2.2.0 GA by the way. There is nothing special about the components. They are generated by seam-gen. The test is performed with in memory database - I followed the examples in http://jbosscc-needle.sourceforge.net/jbosscc-needle/1.0/db-util.html.

    Read the article

  • Audio stream mangement in Linux

    - by User1
    I have a very complicated audio setup for a project. Here's what we have: 3 applications playing sound 2 applications recording sound 2 sound cards I really don't really have the code to any of these applications. All I want to do is monitor and control the audio streams. Here are a few examples of operations I'd like to do while the applications are running: Mute one of the incoming audio streams. Have one of the incoming audio streams do a "solo" (be the only stream that can "talk"). Get a graph (about 30 seconds worth) of the audio that each stream produced. Send one of the audio streams to soundcard #1, but all three audio streams to soundcard #2. I would likely switch audio streams every 2 minutes or so with one of the operations listed above. A GUI would be preferred. I started looking at the sound systems in Linux and it gets extremely complex and I feel like there have been many new advances in the past few years. I see jack, pulseaudio, artsd, and several other packages. They all have some promise but where should I start? Is there something someone already built that can help?

    Read the article

  • Read a buffer of unknown size (Console input)

    - by Sanarothe
    Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

    Read the article

  • How you would you describe the Observer pattern in beginner language?

    - by Sheldon
    Currently, my level of understanding is below all the coding examples on the web about the Observer Pattern. I understand it simply as being almost a subscription that updates all other events when a change is made that the delegate registers. However, I'm very unstable in my true comprehension of the benefits and uses. I've done some googling, but most are above my level of understanding. I'm trying to implement this pattern with my current homework assignment, and to truly make sense on my project need a better understanding of the pattern itself and perhaps an example to see what its use. I don't want to force this pattern into something just to submit, I need to understand the purpose and develop my methods accordingly so that it actually serves a good purpose. My text doesn't really go into it, just mentions it in one sentence. MSDN was hard for me to understand, as I'm a beginner on this, and it seems more of an advanced topic. How would you describe this Observer pattern and its uses in C# to a beginner? For an example, please keep code very simple so I can understand the purpose more than complex code snippets. I'm trying to use it effectively with some simple textbox string manipulations and using delegates for my assignment, so a pointer would help!

    Read the article

  • One object in jTemplate?

    - by Dejan.S
    Hi I'm using jTemplate for the first time. I been reading and it's not that hard to use it BUT what I can not figure out and find any thing on is how to work with one object, all the examples I find are a list of objects. My situation is I need to work with one object only. How can I do that? I mean How to work with the data in the jTemplate like this example but one only. <script type="text/html" id="TemplateResultsTable"> {#template MAIN} <table cellpadding="10" cellspacing="0"> <tr> <th>Artist</th> <th>Company</th> <th>Title</th> <th>Price</th> </tr> {#foreach $T.d as CD} {#include ROW root=$T.CD} {#/for} </table> {#/template MAIN} {#template ROW} <tr class="{#cycle values=['','evenRow']}"> <td>{$T.Artist}</td> <td>{$T.Company}</td> <td>{$T.Title}</td> <td>{$T.Price}</td> </tr> {#/template ROW} </script>

    Read the article

  • Using singleton instead of a global static instance

    - by Farstucker
    I ran into a problem today and a friend recommended I use a global static instance or more elegantly a singleton pattern. I spent a few hours reading about singletons but a few things still escape me. Background: What Im trying to accomplish is creating an instance of an API and use this one instance in all my classes (as opposed to making a new connection, etc). There seems to be about 100 ways of creating a singleton but with some help from yoda I found some thread safe examples. ..so given the following code: public sealed class Singleton { public static Singleton Instance { get; private set; } private Singleton() { APIClass api = new APIClass(); //Can this be done? } static Singleton() { Instance = new Singleton(); } } How/Where would you instantiate the this new class and how should it be called from a separate class? EDIT: I realize the Singleton class can be called with something like Singleton obj1 = Singleton.Instance(); but would I be able to access the methods within the APIs Class (ie. obj1.Start)? (not that I need to, just asking) EDIT #2: I might have been a bit premature in checking the answer but I do have one small thing that is still causing me problems. The API is launching just fine, unfortunately Im able to launch two instances? New Code public sealed class SingletonAPI { public static SingletonAPI Instance { get; private set; } private SingletonAPI() {} static SingletonAPI() { Instance = new SingletonAPI(); } // API method: public void Start() { API myAPI = new API();} } but if I try to do something like this... SingletonAPI api = SingletonAPI.Instance; api.Start(); SingletonAPI api2 = SingletonAPI.Instance; // This was just for testing. api2.Start(); I get an error saying that I cannot start more than one instance.

    Read the article

  • Code Golf: Easter Spiral

    - by friol
    What's more appropriate than a Spiral for Easter Code Golf sessions? Well, I guess almost anything. The Challenge The shortest code by character count to display a nice ASCII Spiral made of asterisks ('*'). Input is a single number, R, that will be the x-size of the Spiral. The other dimension (y) is always R-2. The program can assume R to be always odd and = 5. Some examples: Input 7 Output ******* * * * *** * * * * ***** * Input 9 Output ********* * * * ***** * * * * * * *** * * * * * ******* * Input 11 Output *********** * * * ******* * * * * * * * *** * * * * * * * * ***** * * * * * ********* * Code count includes input/output (i.e., full program). Any language is permitted. My easily beatable 303 chars long Python example: import sys; d=int(sys.argv[1]); a=[d*[' '] for i in range(d-2)]; r=[0,-1,0,1]; x=d-1;y=x-2;z=0;pz=d-2;v=2; while d>2: while v>0: while pz>0: a[y][x]='*'; pz-=1; if pz>0: x+=r[z]; y+=r[(z+1)%4]; z=(z+1)%4; pz=d; v-=1; v=2;d-=2;pz=d; for w in a: print ''.join(w); Now, enter the Spiral...

    Read the article

  • Posting source code in blogger- fails with C# containers

    - by Lirik
    I tried the solutions that are posted in this related SO question and for the most part the code snippets are working, but there are some cases that are still getting garbled by Blogger when it publishes the blog. In particular, declaring generic containers seems to be most troublesome. Please see the code examples on my blog and in particular the section where I define the dictionary (http://mlai-lirik.blogspot.com/). I want to display this: static Dictionary<int, List<Delegate>> _delegate = new Dictionary<int,List<Delegate>>(); But blogger publishes this: static Dictionary<int, list=""><delegate>> _delegate = new Dictionary<int, list=""><delegate>>(); And it caps the end of my code section with this: </delegate></delegate></int,></delegate></int,> Apparently blogger thinks that the <int and <delegate> portion of the dictionary are some sort of HTML tags and it automatically attempts to close them at the end of the code snippet. Does anybody know how to get around this problem?

    Read the article

  • UIScrollView notifications

    - by ryyst
    Hi, I'm coding an app that works much like Apple's Weather.app: There's a UIPageControl at the bottom and a UIScrollView in the middle of the screen. In my code, I implemented the - (void)scrollViewDidEndDecelerating:(UIScrollView *)scrollView method to figure out when the user did move to a new page. If they move to a new page, I load the adjacent pages' data, as to make further page-switching faster. (In one of Apple's examples, the - (void)scrollViewDidScroll:(UIScrollView *)sender is used, but that causes my app to shortly hang when loading a new page, so it's not suitable.) That code works very well. I'm using scrollRectToVisible:: to programmatically scroll inside the scrollview when the user clicks the UIPageControl. The problem is that the scrollRectToVisible: doesn't post a notification to the UIScrollViewDelegate when it's done scrolling - so the code responsible for loading adjacent pages never get's called when using the UIPageControl. Is there any way to make the UIScrollView notify its delegate when it gets called by the scrollRectToVisible: method? Or will I have to use threads in order to prevent my app from freezing? Thanks! -- Ry

    Read the article

  • SeriesInterpolate - removing data at start of array

    - by Allan Jardine
    Hello all, I've been experimenting with Flex Charts (in Flash Builder 4) recently, but have run into one area which didn't quite work as I was expecting. Specifically, when adding and removing a data point from an array, with SeriesInterpolate set. I've put up three examples, as I expect these will make a lot more sense than me trying to explain it with words only!: http://sprymedia.co.uk/media/misc/flex/linechart/LineChart-Add.swf - Clicking the button in the top right adds a new data point to the end of the data array, and the chart is smoothly updated (almost smoothly there is a 1px shift when animating which is odd...) http://sprymedia.co.uk/media/misc/flex/linechart/LineChart-Delete.swf - Clicking the button (which is now labelled incorrectly) will remove the item at the start of the data array - but the chart draws this as if it were removing the end element. http://sprymedia.co.uk/media/misc/flex/linechart/LineChart-AddDelete.swf - This is sort of what I'm eventually aiming for - a smooth side scroll chart, where new data is added at the end and the old data is sifted off the front. However the delete behaviour makes this look a bit odd. Does anyone know if there is a way to get the smooth transition I'm looking with SeriesInterpolate? Or is it possible to implement a custom transition? Many thanks, Allan

    Read the article

  • Visual C++ Assembly link library troubles

    - by Sanarothe
    Hi. I'm having a problem having my projects built in VC++ Express 2008... I'm using a library, irvine32.inc/lib. INCLUDE Irvine32.inc works for me at school (On already configured VS environments) by default, but at home (Windows 7 x64) I'm having a boatload of issues. My original post here was that a file that irvine32.inc referenced, in the same folder, 'could not be opened.' Added irvine folder to the include path for specific project, progress. Then I was getting an error with mt.exe, but a suggestion on the MSDN suggested turn off antivirus, and now project does build but when I run a program that does NOT reference anything in irvine32, it tells me repeatedly that my project has triggered a breakpoint, and allows me to continue or break. Continue just pops the same window, break loads another popup telling me that "No symbols are loaded for any call stack frame. Source code cannot be displayed." This popup lets me view the disassembly. I tested it with and without working statements, it just throws the same breakpoint on the first line of code. Now, if I run the program when it DOES require something from the include file, in this case, DumpRegs: INCLUDE Irvine32.inc .data .code main PROC mov ebx,1000h mov eax,1000h add eax,ebx call DumpRegs main ENDP END main This gives me 1main.obj : error LNK2019: unresolved external symbol _DumpRegs@0 referenced in function _main@0 1C:\Users\Cameron\csis165\Lab8_CCarroll\Debug\Lab8_CCarroll.exe : fatal error LNK1120: 1 unresolved externals This does NOT happen when I build a project from the book author's examples, which has the same include statement. I'm baffled. :(

    Read the article

< Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >