Search Results

Search found 45441 results on 1818 pages for 'string to date'.

Page 21/1818 | < Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >

  • problem in getting desired date format in loop

    - by Rishi2686
    Hi there, I have a date format like this : $date1 = "Sun May 09 20:07:50 +0000 2010"; and I have to convert it to: 09-05-2010 I am using date("d-m-Y", $date1)); When I print this individually it gives proper result but I am using it in loop it gives me results like: 31-12-1969 I don't understand why this is so? Can you help, please?

    Read the article

  • SQL: count days in date range?

    - by John Isaacks
    I have a query like this: SELECT COUNT(*) AS amount FROM daily_individual_tracking WHERE sales = 'YES' AND daily_individual_tracking_date BETWEEN '2010-01-01' AND '2010-03-31' I am selected from a date range. Is there a way to also get the total days in the date range?

    Read the article

  • Convert date in text format to datetime format in T-SQL

    - by Rob
    I have a client supplied file that is loaded in to our SQL Server database. This file contains text based date values i.e. (05102010) and I need to read them from a db column and convert them to a normal date time value = '2010-05-10 00:00:00.000' as part of a clean-up process. Any guidance would be greatly appreciated.

    Read the article

  • Set Date in a single line

    - by hibernate
    According to the java API, the constructor Date(year, month, day) is depreciated. I know that I can replace it with the following code: Calendar myCal = Calendar.getInstance(); myCal.set(Calendar.YEAR, theYear); myCal.set(Calendar.MONTH, theMonth); myCal.set(Calendar.DAY_OF_MONTH, theDay); Date theDate = myCal.getTime(); However, I would like something shorter to replace it with (ideally one-two lines). Any suggestions?

    Read the article

  • C# calcuate date ranges from a list of dates.

    - by nakulringshia
    Hi Given a list of dates (which may not be sorted), I want to build a list of date ranges - E.g. Assuming MM/DD format, Input - 5/1, 5/5, 5/6, 5/15, 5/7, 5/8, 5/19,5/20, 5/23 Output - Date Range 1: 5/1 to 5/1 Date Range 2: 5/5 to 5/8 Date Range 3: 5/15 to 5/15 Date Range 4: 5/19 to 5/20 Date Range 5: 5/23 to 5/23 Basically, a range should be continuous. Thanks Nakul Ringshia

    Read the article

  • [PHP] Check Valid date type

    - by yukou
    may be this question had been asked, I've searched but still not confident about my problem.. my problem is checking valid date from string $a='23-June-11'; //valid $b='Normal String';//invalid I want to convert $a and $b using strtotime() before I do that, of course i want to validate whether $a or $b is a valid date format From $a i can get 23, 11 using explode function, but how about 'June'? using function above, 'June' is not numeric

    Read the article

  • Count days within a month from date range

    - by G. Muqtada
    I have three date ranges in mysql table as follow from 2013-09-29 to 2013-10-02 from 2013-10-14 to 2013-10-16 from 2013-10-28 to 2013-11-05 I want to count only days that occur in Month of October, for example from first range (2013-09-29 to 2013-10-02) I should get difference of two days (1st and 2nd October) , and it should ignore days from September month, Finally i want to count total days in a given month from above date ranges. Can it be done from direct mysql query. or any short PHP logic.

    Read the article

  • AdvancedFormatProvider: Making string.format do more

    - by plblum
    When I have an integer that I want to format within the String.Format() and ToString(format) methods, I’m always forgetting the format symbol to use with it. That’s probably because its not very intuitive. Use {0:N0} if you want it with group (thousands) separators. text = String.Format("{0:N0}", 1000); // returns "1,000"   int value1 = 1000; text = value1.ToString("N0"); Use {0:D} or {0:G} if you want it without group separators. text = String.Format("{0:D}", 1000); // returns "1000"   int value2 = 1000; text2 = value2.ToString("D"); The {0:D} is especially confusing because Microsoft gives the token the name “Decimal”. I thought it reasonable to have a new format symbol for String.Format, "I" for integer, and the ability to tell it whether it shows the group separators. Along the same lines, why not expand the format symbols for currency ({0:C}) and percent ({0:P}) to let you omit the currency or percent symbol, omit the group separator, and even to drop the decimal part when the value is equal to the whole number? My solution is an open source project called AdvancedFormatProvider, a group of classes that provide the new format symbols, continue to support the rest of the native symbols and makes it easy to plug in additional format symbols. Please visit https://github.com/plblum/AdvancedFormatProvider to learn about it in detail and explore how its implemented. The rest of this post will explore some of the concepts it takes to expand String.Format() and ToString(format). AdvancedFormatProvider benefits: Supports {0:I} token for integers. It offers the {0:I-,} option to omit the group separator. Supports {0:C} token with several options. {0:C-$} omits the currency symbol. {0:C-,} omits group separators, and {0:C-0} hides the decimal part when the value would show “.00”. For example, 1000.0 becomes “$1000” while 1000.12 becomes “$1000.12”. Supports {0:P} token with several options. {0:P-%} omits the percent symbol. {0:P-,} omits group separators, and {0:P-0} hides the decimal part when the value would show “.00”. For example, 1 becomes “100 %” while 1.1223 becomes “112.23 %”. Provides a plug in framework that lets you create new formatters to handle specific format symbols. You register them globally so you can just pass the AdvancedFormatProvider object into String.Format and ToString(format) without having to figure out which plug ins to add. text = String.Format(AdvancedFormatProvider.Current, "{0:I}", 1000); // returns "1,000" text2 = String.Format(AdvancedFormatProvider.Current, "{0:I-,}", 1000); // returns "1000" text3 = String.Format(AdvancedFormatProvider.Current, "{0:C-$-,}", 1000.0); // returns "1000.00" The IFormatProvider parameter Microsoft has made String.Format() and ToString(format) format expandable. They each take an additional parameter that takes an object that implements System.IFormatProvider. This interface has a single member, the GetFormat() method, which returns an object that knows how to convert the format symbol and value into the desired string. There are already a number of web-based resources to teach you about IFormatProvider and the companion interface ICustomFormatter. I’ll defer to them if you want to dig more into the topic. The only thing I want to point out is what I think are implementation considerations. Why GetFormat() always tests for ICustomFormatter When you see examples of implementing IFormatProviders, the GetFormat() method always tests the parameter against the ICustomFormatter type. Why is that? public object GetFormat(Type formatType) { if (formatType == typeof(ICustomFormatter)) return this; else return null; } The value of formatType is already predetermined by the .net framework. String.Format() uses the StringBuilder.AppendFormat() method to parse the string, extracting the tokens and calling GetFormat() with the ICustomFormatter type. (The .net framework also calls GetFormat() with the types of System.Globalization.NumberFormatInfo and System.Globalization.DateTimeFormatInfo but these are exclusive to how the System.Globalization.CultureInfo class handles its implementation of IFormatProvider.) Your code replaces instead of expands I would have expected the caller to pass in the format string to GetFormat() to allow your code to determine if it handles the request. My vision would be to return null when the format string is not supported. The caller would iterate through IFormatProviders until it finds one that handles the format string. Unfortunatley that is not the case. The reason you write GetFormat() as above is because the caller is expecting an object that handles all formatting cases. You are effectively supposed to write enough code in your formatter to handle your new cases and call .net functions (like String.Format() and ToString(format)) to handle the original cases. Its not hard to support the native functions from within your ICustomFormatter.Format function. Just test the format string to see if it applies to you. If not, call String.Format() with a token using the format passed in. public string Format(string format, object arg, IFormatProvider formatProvider) { if (format.StartsWith("I")) { // handle "I" formatter } else return String.Format(formatProvider, "{0:" + format + "}", arg); } Formatters are only used by explicit request Each time you write a custom formatter (implementer of ICustomFormatter), it is not used unless you explicitly passed an IFormatProvider object that supports your formatter into String.Format() or ToString(). This has several disadvantages: Suppose you have several ICustomFormatters. In order to have all available to String.Format() and ToString(format), you have to merge their code and create an IFormatProvider to return an instance of your new class. You have to remember to utilize the IFormatProvider parameter. Its easy to overlook, especially when you have existing code that calls String.Format() without using it. Some APIs may call String.Format() themselves. If those APIs do not offer an IFormatProvider parameter, your ICustomFormatter will not be available to them. The AdvancedFormatProvider solves the first two of these problems by providing a plug-in architecture.

    Read the article

  • Need to get 3 record for database on current date using sqlite

    - by Umaid
    SELECT rowid, Day, Advice from MainCategory where ((Day = ((cast(strftime('%d',date('now','-1 day')) as Integer)))) and (Month = (strftime('%m',date('now'))))) and ((Day = ((cast(strftime('%d',date('now')) as Integer)))) and (Month = (strftime('%m',date('now'))))) , ((Day = ((cast(strftime('%d',date('now','+1 day')) as Integer)))) and (Month = (strftime('%m',date('now',+1 month))))); What if i make my Month column in Integer data type then it would be. SELECT rowid, Month, Day, Advice from MainCategory where ((Day = ((cast(strftime('%d',date('now','-1 day')) as Integer)))) and (Month = (strftime('%m',date('now'))))) and ((Day = ((cast(strftime('%d',date('now')) as Integer)))) and (Month = (strftime('%m',date('now'))))) , ((Day = ((cast(strftime('%d',date('now','+1 day')) as Integer)))) and (Month = (strftime('%m',date('now',+1 month))))); Please note that I have over this scenerio when I am in middle of month but below query returns 2 records and 1 from begining from all 11 months as (feb is exclusive) then record will be 33 but i need three 3 records from the table and increment it on next button. Please write 3 querys one which return all three record on current date, next all 3 records must be incremented by 1 on every next button click finally all 3 records must be decremented by 1 on every previous button click keep last day and begining date on the month in minds else i have also achieved for middle of month. Running query but returns 33 records instead of 3. SELECT rowid,Month, Day, Advice from MainCategory where Day in ((cast(strftime('%d',date('now','-1 day')) as Integer)),(cast(strftime('%d',date('now')) as Integer)),(cast(strftime('%d',date('now','+1 day')) as Integer)));

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • find the next due date after today within a group in an Excel PivotTable

    - by Dennis George
    I have got a table set up in one sheet with "transactions". Each row contains a name of a vendor, the amount owed or paid depending on transaction type, and the due date/transaction date. Here is some simplified sample data: Vendor Date Invoice Payment Vendor A 6/30 $200 Vendor A 6/30 ($200) Vendor B 7/5 $500 Vendor B 7/5 ($500) Vendor C 10/28 $50 Vendor A 10/30 $100 Vendor C 11/15 $50 I have already built a PivotTable from that table to group these transactions by vendor and sum the remainder owed. What I'm trying to figure out is how to, for each vendor, get the next due date (min date of the group, excluding dates < Today()), or if there is no next due date then I want to see the max date for that group. Here is what my PivotTable looks like, plus the date column I'd like to add (assuming Today() = 10/23): Vendor Date Owed Vendor B 7/5 - Vendor C 10/28 $100 Vendor A 10/30 $100 I know calling it next due date might not be so accurate if I end up with the date of a payment in that column, but I'm ok with that. tl;dr : I want to find the next earliest date within each group, or the last date. How do I do this?

    Read the article

  • Date formatting using data annotations for a dataform in Silverlight

    - by Aim Kai
    This is probably got a simple answer to it, but I am having problems just formatting the date for a dataform field.. <df:DataForm x:Name="Form1" ItemsSource="{Binding Mode=OneWay}" AutoGenerateFields="True" AutoEdit="True" AutoCommit="False" CommitButtonContent="Save" CancelButtonContent="Cancel" CommandButtonsVisibility="Commit" LabelPosition="Top" ScrollViewer.VerticalScrollBarVisibility="Disabled" EditEnded="NoteForm_EditEnded"> <df:DataForm.EditTemplate> <DataTemplate> <StackPanel> <df:DataField> <TextBox Text="{Binding Title, Mode=TwoWay}"/> </df:DataField> <df:DataField> <TextBox Text="{Binding Description, Mode=TwoWay}" AcceptsReturn="True" HorizontalScrollBarVisibility="Auto" VerticalScrollBarVisibility="Auto" Height="" TextWrapping="Wrap" SizeChanged="TextBox_SizeChanged"/> </df:DataField> <df:DataField> <TextBlock Text="{Binding Username}"/> </df:DataField> <df:DataField> <TextBlock Text="{Binding DateCreated}"/> </df:DataField> </StackPanel> </DataTemplate> </df:DataForm.EditTemplate> </df:DataForm> I have bound this to a note class which has the annotation for field DateCreated: /// <summary> /// Gets or sets the date created of the noteannotation /// </summary> [Display(Name="Date Created")] [Editable(false)] [DisplayFormat(DataFormatString = "{0:u}", ApplyFormatInEditMode = true)] public DateTime DateCreated { get; set; } Whatever I set the dataformatstring it comes back as: eg 4/6/2010 10:02:15 AM I want this formatted as yyyy-MM-dd HH:mm:ss I have tried the custom format above {0:yyyy-MM-dd hh:mm:ss} but it remains the same output. The same happens for {0:u} or {0:s}. Any help would be gratefully received. :)

    Read the article

  • Compare only date javascript

    - by moleculezz
    Hi all, I can't seem to figure out what is wrong with my code. Maybe it would be simpler to just compare date and not time. Not sure how to do this either and I searched but couldn't find my exact problem. BTW, when I display the two dates in an alert, they show as exactly the same. My code: window.addEvent('domready', function() { var now = new Date(); var input = $('datum').getValue(); var dateArray = input.split('/'); var userMonth = parseInt(dateArray[1])-1; var userDate = new Date(); userDate.setFullYear(dateArray[2], userMonth, dateArray[0], now.getHours(), now.getMinutes(), now.getSeconds(), now.getMilliseconds()); if(userDate > now) { alert(now+'\n'+userDate); } }); Perhaps there is a simpler way to compare dates and not including the time. Hope someone has an answer... Thanks!

    Read the article

  • Converting FoxPro Date type to SQL Server 2005 DateTime using SSIS

    - by Avrom
    Hi, When using SSIS in SQL Server 2005 to convert a FoxPro database to a SQL Server database, if the given FoxPro database has a date type, SSIS assumes it is an integer type. The only way to convert it to a dateTime type is to manually select this type. However, that is not practical to do for over 100 tables. Thus, I have been using a workaround in which I use DTS on SQL Server 2000 which converts it to a smallDateTime, then make a backup, then a restore into SQL Server 2005. This workaround is starting to be a little annoying. So, my question is: Is there anyway to setup SSIS so that whenever it encounters a date type to automatically assume it should be converted to a dateTime in SQL Server and apply that rule across the board? Update To be specific, if I use the import/export wizard in SSIS, I get the following error: Column information for the source and the destination data could not be retrieved, or the data types of source columns were not mapped correctly to those available on the destination provider. Followed by a list of a given table's date columns. If I manually set each one to a dateTime, it imports fine. But I do not wish to do this for a hundred tables.

    Read the article

  • A "smart" (forgiving) date parser?

    - by jdmuys
    I have to migrate a very large dataset from one system to another. One of the "source" column contains a date but is really a string with no constraint, while the destination system mandates a date in the format yyyy-mm-dd. Many, but not all, of the source dates are formatted as yyyymmdd. So to coerce them to the expected format, I do (in Perl): return "$1-$2-$3" if ($val =~ /(\d{4})[-\/]*(\d{2})[-\/]*(\d{2})/); The problem arises when the source dates moves away from the "generic" yyyymmdd. The goal is to salvage as many dates as possible, before giving up. Example source strings include: 21/3/1998, March 2004, 2001, 3/4/97 I can try to match as many of the examples I can find with a succession of regular expressions such as the one above. But is there something smarter to do? Am I not reinventing the wheel? Is there a library somewhere doing something similar? I couldn't find anything relevant googling "forgiving date parser". (any language is OK).

    Read the article

  • PHP date returning wrong time

    - by gargantaun
    The following script is returning the wrong time after I call date_default_timezone_set("UTC") <?PHP $timestamp = time(); echo "<p>Timestamp: $timestamp</p>"; // This returns the correct time echo "<p>". date("Y-m-d H:i:s", $timestamp) ."</p>"; echo "<p>Now I call 'date_default_timezone_set(\"UTC\")' and echo out the same timestamp.</p>"; echo "Set timezone = " . date_default_timezone_set("UTC"); // This returns a time 5 hours in the past echo "<p>". date("Y-m-d H:i:s", $timestamp) ."</p>"; ?> The timezone on the server is BST. So what should happen is that the second call to 'date' should return a time 1 hour behind the first call. It's actually returning a time 5 hours behind the first one. I should note that the server was originally set up with the EDT timezone (UTC -4). That was changed to BST (UTC +1) and the server was restarted. I can't figure out if this is a PHP problem or a problem with the server.

    Read the article

< Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >