Search Results

Search found 5842 results on 234 pages for 'break'.

Page 212/234 | < Previous Page | 208 209 210 211 212 213 214 215 216 217 218 219  | Next Page >

  • Asp.net MVC jquery-ajax dont render html

    - by Troublesum
    Hi, Im trying to use jqeury ajax with MVC i can get it to post back to the action i want and it returns the ViewData objects with updated Data but never renders the HTML. I have i View which contains some MVC User Controls and i want them to update on a timer. Here is my View Markup <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/PageWithSummaryViewAndTabs.Master" Inherits="System.Web.Mvc.ViewPage" %> <asp:Content ID="FullCaseTitle" ContentPlaceHolderID="TitleContent" runat="server"> </asp:Content> <asp:Content ID="FullCaseContent" ContentPlaceHolderID="MainContent" runat="server"> <script type="text/javascript"> window.setInterval(test, 5000); function test() { jQuery.get("/PatientCase/RefreshEPRF", function(response) { }); } </script> <div id="loadingDiv" style="display:none">Updating</div> <input id="refreshPatientCaseIndexButton" type="submit" visible="true" title="refresh" value="Refresh" /> <h2>Full Case</h2> <div id="EPRFContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> </div> <div id="ImageContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionImagery.ascx"); % On postback i call a Action Called RefreshEPRF which loads just the required user controls again <%@ Page Language="C#" Inherits="System.Web.Mvc.ViewPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> And finaly the marpup in the control <table id="detailstable"> <tr><td id="detailslablecolumn">Patient Name : </td><td> <% foreach (var item in (List<STS_Lite.Models.PatinetCase.EPRFItem>)ViewData["EPRF"]) { if (item.datumItemId == 46) { if (item.Stroke) { %> <img src="/PatientCaseIndex/InkImageData/GetInkImage/<%=ViewData["PatientCaseId"]%>/<%=ViewData["TemplateInstanceId"]%>/<%=item.TemplateItemId %>" /> <% } else {%> <%=item.Value.ToString()%> <%} break; } } %></td></tr><table> When i step through this code the ViewData in the user control has the new updated values but the page comes back with no new values. I have tried the jquery.get and ajax but with no luck. Any help would be great thanks

    Read the article

  • Implementing events to communicate between two processes - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Create thread: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'm trying to find out how I would integrate an event with the threaded code to signify to the other process that something has happened, I've seen an MSDN article on using events but it's just confused me if anything, I'm coming up on empty whilst searching on the internet too. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

    Read the article

  • Why is my program freezing when I use a method? (Java)

    - by user2915567
    When I use a boolean method in the Main body, my program freezes and stops working. I've tried putting the method at different places but the exact same thing happens - it freezes. The method is really simple and well-written, I'm not sure what's causing the problem. P.S. The method is on the bottom of the code. Thanks for your help! Edit: That was a dumb question now that I look at it. Thanks again everyone! public static void main(String[] args) { Scanner keyboard = new Scanner(System.in); int stringNumber = 0; String[] stringArray = new String[10]; for (int i = 0; i <= stringArray.length; i++) { boolean itemExists = false; boolean AddItem = AddItem(); if (AddItem == true) { out.println("\nEnter a string"); String input = keyboard.next(); if (i > 0) { for (int j = 0; j < stringArray.length; j++) { if (input.equalsIgnoreCase(stringArray[j])) { itemExists = true; out.println("Item \"" + input + "\" already exists."); break; } } } if (itemExists == false) { stringArray[stringNumber] = input; out.println("\"" + stringArray[stringNumber] + "\"" + " has been stored.\n"); } else { out.println("Try again."); i--; } PrintArray(stringArray); stringNumber++; } } } // This is the method I was talking about // public static boolean AddItem() { Scanner keyboard = new Scanner(System.in); int input = keyboard.nextInt(); out.println("If you want to add an item, Press 1"); if (input == 1) { return true; } else { out.println("Invalid input."); return false; } }

    Read the article

  • JNI cached jclass global reference variables being garbage collected?

    - by bubbadoughball
    I'm working in the JNI Invocation API, calling into Java from C. I have some upfront initialization to cache 30+ Java classes into global references. The results of FindClass are passed into NewGlobalRef to acquire a global reference to the class. I'm caching these class variables to reuse them later. I have 30+ global references to classes (and 30+ global methodIDs for the class constructors). In the following sample, I've removed exception handling as well as JNI invocation for the purpose of shortening the code snippet. My working code has exception checks after every JNI call and I'm running with -Xcheck:jni. Here's the snippet: jclass aClass; jclass bClass; jmethodID aCtor; jmethodID bCtor; void getGlobalRef(const char* clazz, jclass* globalClass) { jclass local = (*jenv)->FindClass(jenv,clazz); if (local) { *globalClass = (jclass) (*jenv)->NewGlobalRef(jenv,local); (*jenv)->DeleteLocalRef(jenv,local); } } methodID getMethodID(jclass clazz, const char* method, const char* sig) { return (*jenv)->GetMethodID(jenv,clazz,method,sig); } void initializeJNI() { getGlobalRef("MyProj/Testclass1", &aclass); getGlobalRef("MyProj/Testclass2", &bclass); . . aCtor = getMethodID(aclass,"<init>","()V"); bCtor = getMethodID(bclass,"<init>","(I)V"); } The initializeJNI() function sets the global references for jclasses and method IDs for constructors as well as some jfieldID's and some initialization of C data structures. After initialization, when I call into a JNI function using some of the cached jclasses and ctor jmethodIDs, I get a bad global or local reference calling reported from the -Xcheck:jni. In gdb, I break at the last line of initializeJNI(), and print all jclasses and jmethodIDs and the ones causing problems look to have been turned into garbage or garbage-collected (i.e. 0x00 or 0x06). Is it possible for global references to be gc'ed? Any suggestions?

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • assistance required, hangman game.

    - by Phillip Gibson
    I am making a hangman game and am having trouble with part of it. I have selected a random word from a file, but I want to display the word as a series of undersocres __ and then match the letter chosen to a position in the undersocres. Can anyone help me? cout <<"1. Select to play the game\n"; cout <<"2. Ask for help\n"; cout <<"3. Select to quit the game\n"; cout << "Enter a selection: "; int number; cin >> number; while(number < 1 || number > 3 || cin.fail()) { if(cin.fail()) { cin.sync(); cin.clear(); cout << "You have not entered a number, please enter a menu selection between 1 and 3\n"; cin >> number; } else { cout << "Your selection must be between 1 and 3!\n"; cin >> number; } } switch (number) { case 1: { string word; string name; cout << " Whats your name? "; cin >> name; Player player(); ifstream FileReader; FileReader.open("words.txt"); if(!FileReader.is_open()) cout << "Error"; //this is for the random selection of words srand(time(0)); int randnum = rand()%10+1; for(int counter = 0; counter < randnum; counter++) { getline(FileReader, word, '\n'); } cout << "my word: " << word << "\n"; // get length of word int length; //create for loop for(int i = 0; i < length; i++) cout << "_"; //_ _ _ _ _ SetCursorPos(2,10); FileReader.close(); break;

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • Correct usage of socket_select().

    - by Mark Tomlin
    What is the correct way to use socket_select within PHP to send and receive data? I have a connection to the server that allows for both TCP & UDP packet connections, I am utilizing both. Within these connections I'm both sending and receiving packets on the same port, but the TCP packet will be sent on one port (29999) and UDP will be sent on another port (30000). The transmission type will be that of AF_INET. The IP address will be loopback 127.0.0.1. I have many questions on how to create a socket connection within this scenario. For example, is it better to use socket_create_pair to make the connection, or use just socket_create followed by socket_connect, and then implement socket_select? There is a chance that no data will be sent from the server to the client, and it is up to the client to maintain the connection. This will be done by utilizing the time out function within the socket_select call. Should no data be sent within the time limit, the socket_select function will break and a keep alive packet can then be sent. The following script is of the client. // Create $TCP = socket_create(AF_INET, SOCK_STREAM, SOL_TCP); $UDP = socket_create(AF_INET, SOCK_DGRAM, SOL_UDP); // Misc $isAlive = TRUE; $UDPPort = 30000; define('ISP_ISI', 1); // Connect socket_connect($TCP, '127.0.0.1', 29999); socket_connect($UDP, '127.0.0.1', $UDPPort); // Construct Parameters $recv = array($TCP, $UDP); $null = NULL; // Make The Packet to Send. $packet = pack('CCCxSSxCSa16a16', 44, ISP_ISI, 1, $UDPPort, 0, '!', 0, 'AdminPass', 'SocketSelect'); // Send ISI (InSim Init) Packet socket_write($TCP, $packet); /* Main Program Loop */ while ($isAlive == TRUE) { // Socket Select $sock = socket_select($recv, $null, $null, 5); // Check Status if ($sock === FALSE) $isAlive = FALSE; # Error else if ($sock > 0) # How does one check to find what socket changed? else # Something else happed, don't know what as it's not in the documentation, Could this be our timeout getting tripped? }

    Read the article

  • Using events in threads between processes - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Create thread: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'm trying to find out how I would integrate an event with the threaded code to signify to the other process that something has happened, I've seen an MSDN article on using events but it's just confused me if anything, I'm coming up on empty whilst searching on the internet too. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

    Read the article

  • How to return a property name when comparing two properties at class-level

    - by CodeMonkey
    Hi I have implemented an 'EqualTo' Validation Attribute, that compares two Properties of an object, during ModelBinding in ASP.NET MVC 2. The problem I have is not with it not working, because it does work. The problem is, when I do my request - which is an ajax request - I get back errors to my front-end, where it sets a class on the input fields to indicate invalid input. What it does is iterate through a list of Errors (in a JsonResult), and set a class. This is all dandy. But the ValidationAtrribute I am having trouble with is set at a Class-level, i.e., it's not like other ValidationAttributes where you set something like "[Required]" or something like that. [AttributeUsage(AttributeTargets.Class, AllowMultiple=true, Inherited=false)] public class EqualToAttribute : ValidationAttribute { public String SourceProperty { get; set; } public String MatchProperty { get; set; } public EqualToAttribute(string source, string match) { SourceProperty = source; MatchProperty = match; } public override Boolean IsValid(Object value) { Type objectType = value.GetType(); PropertyInfo[] properties = objectType.GetProperties(); object sourceValue = new object(); object matchValue = new object(); Type sourceType = null; Type matchType = null; int counter = 0; foreach (PropertyInfo propertyInfo in properties) { if (propertyInfo.Name == SourceProperty || propertyInfo.Name == MatchProperty) { if (counter == 0) { sourceValue = propertyInfo.GetValue(value, null); sourceType = propertyInfo.GetValue(value, null).GetType(); } if (counter == 1) { matchValue = propertyInfo.GetValue(value, null); matchType = propertyInfo.GetValue(value, null).GetType(); } counter++; if (counter == 2) { break; } } } if (sourceType != null && matchType != null) { return sourceValue.ToString().Equals(matchValue.ToString()); //return Convert.ChangeType(sourceValue, sourceType) == Convert.ChangeType(matchValue, matchType); } return false; } private object _typeId = new object(); public override object TypeId { get { return this._typeId; } } } Now this code works, except for the fact that the validation process does not return which Property failed. And I simply can't figure out how to make it return one of the two. In reality I don't care which one it returns.. because both are failing.. Do you have an idea how to make it return the/or both Property/Properties that is/are failing.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Efficient algorithm to distribute work?

    - by Zwei Steinen
    It's a bit complicated to explain but here we go. We have problems like this (code is pseudo-code, and is only for illustrating the problem. Sorry it's in java. If you don't understand, I'd be glad to explain.). class Problem { final Set<Integer> allSectionIds = { 1,2,4,6,7,8,10 }; final Data data = //Some data } And a subproblem is: class SubProblem { final Set<Integer> targetedSectionIds; final Data data; SubProblem(Set<Integer> targetedSectionsIds, Data data){ this.targetedSectionIds = targetedSectionIds; this.data = data; } } Work will look like this, then. class Work implements Runnable { final Set<Section> subSections; final Data data; final Result result; Work(Set<Section> subSections, Data data) { this.sections = SubSections; this.data = data; } @Override public void run(){ for(Section section : subSections){ result.addUp(compute(data, section)); } } } Now we have instances of 'Worker', that have their own state sections I have. class Worker implements ExecutorService { final Map<Integer,Section> sectionsIHave; { sectionsIHave = {1:section1, 5:section5, 8:section8 }; } final ExecutorService executor = //some executor. @Override public void execute(SubProblem problem){ Set<Section> sectionsNeeded = fetchSections(problem.targetedSectionIds); super.execute(new Work(sectionsNeeded, problem.data); } } phew. So, we have a lot of Problems and Workers are constantly asking for more SubProblems. My task is to break up Problems into SubProblem and give it to them. The difficulty is however, that I have to later collect all the results for the SubProblems and merge (reduce) them into a Result for the whole Problem. This is however, costly, so I want to give the workers "chunks" that are as big as possible (has as many targetedSections as possible). It doesn't have to be perfect (mathematically as efficient as possible or something). I mean, I guess that it is impossible to have a perfect solution, because you can't predict how long each computation will take, etc.. But is there a good heuristic solution for this? Or maybe some resources I can read up before I go into designing? Any advice is highly appreciated!

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • remove data layer and put into it's own domain

    - by user334768
    I have a SL4 application that uses EF4 & RIA Services. DB is SQL 2008. All is working well. Now I want to put the Database and web services on one domain (A.com) with the web service exposing the same methods available in my working project. (one listed at top of message) Then put a Silverlight application (same one as above) on domain(B.com) and call the web services on A.com. I thought I had a fair understanding of RIA Services. Enough to get the above application working. Now when I say "working" I do mean on my local dev machine. I have yet to deployed as SL4 & .NET 4 application to my hosting site. But I don't think I understand it well enough. I normally create a new business app, add EF then create the RIA DomainService. Add any [Includes] I need, modify my linq queries and run application. And it works. Now I need to break off my data layer and put it on another hosting site (A.com) And put my UI and business logic on another hosting site (B.com) I think I need to do the following : On the Database & web service site: domain(A.com) create application, create EF4, create RIA Services and deploy. At this time, are the methods exposed available as a "WEB SERVICE" to other applications calling by http:// a.com/serviceName.svc address? I think I need to do the following : On the application site : domain(B.com) create a business application (later will need authentication and navigation). How can I create an EF when I don't have access to the database? (I know I do have access but I want know what happens here when I do not have access to the database, but only data provided by a web service) If I can not create an EF how do I create my RIA Service? I hope any one who takes time to help me understands what I'm asking. Sorry so long.

    Read the article

  • Endianness conversion and g++ warnings

    - by SuperBloup
    I've got the following C++ code : template <int isBigEndian, typename val> struct EndiannessConv { inline static val fromLittleEndianToHost( val v ) { union { val outVal __attribute__ ((used)); uint8_t bytes[ sizeof( val ) ] __attribute__ ((used)); } ; outVal = v; std::reverse( &bytes[0], &bytes[ sizeof(val) ] ); return outVal; } inline static void convertArray( val v[], uint32_t size ) { // TODO : find a way to map the array for (uint32_t i = 0; i < size; i++) for (uint32_t i = 0; i < size; i++) v[i] = fromLittleEndianToHost( v[i] ); } }; Which work and has been tested (without the used attributes). When compiling I obtain the following errors from g++ (version 4.4.1) || g++ -Wall -Wextra -O3 -o t t.cc || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val)': t.cc|98| warning: 'used' attribute ignored t.cc|99| warning: 'used' attribute ignored || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val) [with int isBigEndian = 1, val = double]': t.cc|148| instantiated from here t.cc|100| warning: unused variable 'outVal' t.cc|100| warning: unused variable 'bytes' I've tried to use the following code : template <int size, typename valType> struct EndianInverser { /* should not compile */ }; template <typename valType> struct EndianInverser<4, valType> { static inline valType reverseEndianness( const valType &val ) { uint32_t castedVal = *reinterpret_cast<const uint32_t*>( &val ); castedVal = (castedVal & 0x000000FF << (3 * 8)) | (castedVal & 0x0000FF00 << (1 * 8)) | (castedVal & 0x00FF0000 >> (1 * 8)) | (castedVal & 0xFF000000 >> (3 * 8)); return *reinterpret_cast<valType*>( &castedVal ); } }; but it break when enabling optimizations due to the type punning. So, why does my used attribute got ignored? Is there a workaround to convert endianness (I rely on the enum to avoid type punning) in templates?

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • check if directory exists c#

    - by Ant
    I am trying to see if a directory exists based on an input field from the user. When the user types in the path, I want to check if the path actually exists. I have some c# code already. It returns 1 for any local path, but always returns 0 when I am checking a network path. static string checkValidPath(string path) { //Insert your code that runs under the security context of the authenticating user here. using (ImpersonateUser user = new ImpersonateUser(user, "", password)) { //DirectoryInfo d = new DirectoryInfo(quotelessPath); bool doesExist = Directory.Exists(path); //if (d.Exists) if(doesExist) { user.Dispose(); return "1"; } else { user.Dispose(); return "0"; } } } public class ImpersonateUser : IDisposable { [DllImport("advapi32.dll", SetLastError = true)] private static extern bool LogonUser(string lpszUsername, string lpszDomain, string lpszPassword, int dwLogonType, int dwLogonProvider, out IntPtr phToken); [DllImport("kernel32", SetLastError = true)] private static extern bool CloseHandle(IntPtr hObject); private IntPtr userHandle = IntPtr.Zero; private WindowsImpersonationContext impersonationContext; public ImpersonateUser(string user, string domain, string password) { if (!string.IsNullOrEmpty(user)) { // Call LogonUser to get a token for the user bool loggedOn = LogonUser(user, domain, password, 9 /*(int)LogonType.LOGON32_LOGON_NEW_CREDENTIALS*/, 3 /*(int)LogonProvider.LOGON32_PROVIDER_WINNT50*/, out userHandle); if (!loggedOn) throw new Win32Exception(Marshal.GetLastWin32Error()); // Begin impersonating the user impersonationContext = WindowsIdentity.Impersonate(userHandle); } } public void Dispose() { if (userHandle != IntPtr.Zero) CloseHandle(userHandle); if (impersonationContext != null) impersonationContext.Undo(); } } Any help is appreciated. Thanks! EDIT 3: updated code to use BrokenGlass's impersonation functions. However, I need to initialize "password" to something... EDIT 2: I updated the code to try and use impersonation as suggested below. It still fails everytime. I assume I am using impersonation improperly... EDIT: As requested by ChrisF, here is the function that calls the checkValidPath function. Frontend aspx file... $.get('processor.ashx', { a: '7', path: x }, function(o) { alert(o); if (o=="0") { $("#outputPathDivValid").dialog({ title: 'Output Path is not valid! Please enter a path that exists!', width: 500, modal: true, resizable: false, buttons: { 'Close': function() { $(this).dialog('close'); } } }); } }); Backend ashx file... public void ProcessRequest (HttpContext context) { context.Response.Cache.SetExpires(DateTime.Now); string sSid = context.Request["sid"]; switch (context.Request["a"]) {//a bunch of case statements here... case "7": context.Response.Write(checkValidPath(context.Request["path"].ToString())); break;

    Read the article

  • How to combine a list of choices to determine which select statement

    - by Larry
    I have a mysql db and am using php 5.2 What I am trying to do is offer a list of options for a person to select (only 1). The chosen option will cause a select, update, or delete statement to be ran. The results of the statement do not need to be shown, although, showing the old and then the new would be nice (no problems with that part tho'.). Pseudo-Code: Assign $choice = 0 Check the value of $choice // This way, if it = 100, we do a break Select a Choice:<br> 1. Adjust Status Value (+60) // $choice = 1<br> 2. Show all Ships <br> // $choice = 2 3. Show Ships in Port <br> // $choice = 3 ... 0. $choice="100" // if the value =100, quit this part Use either case (switch) or if/else statements to run the users choice1 If the choice is 1, then run the "Select" statement with the variable of $sql1 -- "SELECT .... If the choice is 2, then run the "Select" statement with the variable of $sql2 --- SELECT * FROM Ships If the choice is 3, then run the "Select" statement with the variable of $sql3 <br> .... If the choice is 0, then we are done. I figured the (3) statements would be assigned in php as: $sql1="...". $sql2="SELECT * FROM Ships" $sql3="SELECT * FROM Ships WHERE nPort="1" My idea was to use the switch statement, but got lost on it. :( I would like the options to be available over and over again, until a variable ($choice) is selected. In which case, this particular page is done and goes back to the "Main Menu"? The coding and display, if I use it, I can do. Just not sure how to write the way to select which one I want. It is possible that I would run all of the queries, and other times, only one, so that is why I would like the choice. An area I get confused in is the proper forms to use such as -- ' ' " " and ...?? Not sure the # of options I will end up with, but it will be more than 5 but less than 20 / page. So if I get the system down for 2-3 choices, I can replicate it for as many as I may need. And, as always, if a better way exists, I am willing to try it. Thanks again... Larry

    Read the article

  • AFNetworking PostPath php Parameters are null

    - by Alejandro Escobar
    I am trying to send a username and password from an iOS app using AFNetworking framework to a php script. The iOS app continues to receive status code 401 which I defined to be "not enough parameters". I have tried returning the "username" from the php script to the iOS app and receive . Based on what I've been investigating so far, it seems as though: 1) The php script is not decoding the POST parameters properly 2) The iOS app is not sending the POST parameters properly The following is the iOS function - (IBAction)startLoginProcess:(id)sender { NSString *usernameField = usernameTextField.text; NSString *passwordField = passwordTextField.text; NSDictionary *parameters = [NSDictionary dictionaryWithObjectsAndKeys:usernameField, @"username", passwordField, @"password", nil]; NSURL *url = [NSURL URLWithString:@"http://localhost/~alejandroe1790/edella_admin/"]; AFHTTPClient *httpClient = [[AFHTTPClient alloc] initWithBaseURL:url]; [httpClient defaultValueForHeader:@"Accept"]; [httpClient setParameterEncoding:AFJSONParameterEncoding]; [httpClient postPath:@"login.php" parameters:parameters success:^(AFHTTPRequestOperation *operation, id response) { NSLog(@"operation hasAcceptableStatusCode: %d", [operation.response statusCode]); } failure:^(AFHTTPRequestOperation *operation, NSError *error) { NSLog(@"Error with request"); NSLog(@"%@",[error localizedDescription]); }]; } The following is the php script function checkLogin() { // Check for required parameters if (isset($_POST["username"]) && isset($_POST["password"])) { //Put parameters into local variables $username = $_POST["username"]; $password = $_POST["password"]; $stmt = $this->db->prepare("SELECT Password FROM Admin WHERE Username=?"); $stmt->bind_param('s', $username); $stmt->execute(); $stmt->bind_result($resultpassword); while ($stmt->fetch()) { break; } $stmt->close(); // Username or password invalid if ($password == $resultpassword) { sendResponse(100, 'Login successful'); return true; } else { sendResponse(400, 'Invalid Username or Password'); return false; } } sendResponse(401, 'Not enough parameters'); return false; } I feel like I may be missing something. Any assistance would be great.

    Read the article

  • Help with IF THEN breaking when comparing results from MYSQL query.

    - by roydukkey
    I'm have a problem with an invite system. The if statement seems to break. It shows the message "Fail" but the UPDATE statement still executes. Why do both the THEN and the ELSE excute? $dbConn = new dbConn(); // Check if POST user_username and user_hash are matching and valid; both are hidden for fields $sql = "SELECT user_username " . "FROM table_users " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"])." " . "AND user_hash='".mysql_real_escape_string($_POST["user_hash"])."' " . "AND user_enabled=0;"; $objUser = $dbConn->query($sql); // If result contains 1 or more rows if( mysql_num_rows($objUser) != NULL ){ $objUser = mysql_fetch_assoc($objUser); $ssnUser->login( $objUser["user_username"] ); $sql = "UPDATE table_users SET " . "user_enabled=1, " . "user_first_name='".mysql_real_escape_string($_POST["user_first_name"])."', " . "user_last_name='".mysql_real_escape_string($_POST["user_last_name"])."', " . "user_password='".mysql_real_escape_string( md5($_POST["user_password"]) )."' " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"]).";"; $dbConn->query($sql); echo "Success"; header( "Refresh: 5; url=/account/?action=domains" ); } else { echo "Fail"; } This dbConn Class is as follows: class dbConn{ var $username = "xxxx_admin"; var $password = "xxxxxxxx"; var $server = "localhost"; var $database = "xxxx"; var $objConn; function __construct(){ $conn = mysql_connect( $this->server, $this->username, $this->password, true ); if( !$conn ){ die("Could not connect: ".mysql_error() ); } else { $this->objConn = $conn; } unset($conn); } function __destruct(){ mysql_close( $this->objConn ); unset( $this ); } function query( $query, $db = false ){ mysql_select_db( $db != false ? $db : $this->database, $this->objConn ); $result = mysql_query( $query ); unset($query,$db); return $result; } }

    Read the article

  • Ideas on implementing threads and cross process communication. - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

    Read the article

< Previous Page | 208 209 210 211 212 213 214 215 216 217 218 219  | Next Page >