Search Results

Search found 21317 results on 853 pages for 'key mapping'.

Page 213/853 | < Previous Page | 209 210 211 212 213 214 215 216 217 218 219 220  | Next Page >

  • What container type provides better (average) performance than std::map?

    - by Truncheon
    In the following example a std::map structure is filled with 26 values from A - Z (for key) and 0 - 26 for value. The time taken (on my system) to lookup the last entry (10000000 times) is roughly 250 ms for the vector, and 125 ms for the map. (I compiled using release mode, with O3 option turned on for g++ 4.4) But if for some odd reason I wanted better performance than the std::map, what data structures and functions would I need to consider using? I apologize if the answer seems obvious to you, but I haven't had much experience in the performance critical aspects of C++ programming. UPDATE: This example is rather trivial and hides the true complexity of what I'm trying to achieve. My real world project is a simple scripting language that uses a parser, data tree, and interpreter (instead of a VM stack system). I need to use some kind of data structure (perhaps map) to store the variables names created by script programmers. These are likely to be pretty randomly named, so I need a lookup method that can quickly find a particular key within a (probably) fairly large list of names. #include <ctime> #include <map> #include <vector> #include <iostream> struct mystruct { char key; int value; mystruct(char k = 0, int v = 0) : key(k), value(v) { } }; int find(const std::vector<mystruct>& ref, char key) { for (std::vector<mystruct>::const_iterator i = ref.begin(); i != ref.end(); ++i) if (i->key == key) return i->value; return -1; } int main() { std::map<char, int> mymap; std::vector<mystruct> myvec; for (int i = 'a'; i < 'a' + 26; ++i) { mymap[i] = i - 'a'; myvec.push_back(mystruct(i, i - 'a')); } int pre = clock(); for (int i = 0; i < 10000000; ++i) { find(myvec, 'z'); } std::cout << "linear scan: milli " << clock() - pre << "\n"; pre = clock(); for (int i = 0; i < 10000000; ++i) { mymap['z']; } std::cout << "map scan: milli " << clock() - pre << "\n"; return 0; }

    Read the article

  • lua table C api

    - by anon
    I know of: http://lua-users.org/wiki/SimpleLuaApiExample It shows me how to build up a table (key, value) pair entry by entry. Suppose instead, I want to build a gigantic table (say something a 1000 entry table, where both key & value are strings), is there a fast way to do this in lua (rather than 4 func calls per entry: push key value rawset Thanks!

    Read the article

  • Whats wrong with this function? .each related

    - by Ritz
    When I uncomment the alert the data is there... like: { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', } But instead of populating the key and the value it takes the whole var and start to create a key and value pair for each character. You can see this in action here: http://www.zorgzuster-zeeland.nl/site/static/calendar_test.php create a task in the calendar and then try to edit the task by clicking on it. It should populate the dropdown field properly. When i create a static var with the same values the dropdown works. static variable var zvmlist = { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', }; This is my function, anybody has a clue? $.get('get_zorgvormen.php', function(zvmlist) { //alert("Data Loaded: " + zvmlist); $.each(zvmlist, function(key, value) { var selected=''; if(key==eventdata.title){var selected='selected' } $('<option value="'+key+'" '+selected+'>'+value+'</option>').appendTo($('#calendar_edit_entry_form_title')); }); });

    Read the article

  • Windows-1251 file inside UTF-8 site?

    - by Spoonk
    Hello everyone Masters Of Web Delevopment :) I have a piece of PHP script that fetches last 10 played songs from my winamp. This script is inside file (lets call it "lastplayed.php") which is included in my site with php include function inside a "div". My site is on UTF-8 encoding. The problem is that some songs titles are in Windows-1251 encoding. And in my site they displays like "??????"... Is there any known way to tell to this div with included "lastplayed.php" in it, to be with windows-1251 encoding? Or any other suggestions? P.S: The file with fetching script a.k.a. "lastplayed.php", is converted to UTF-8. But if it is ANCII it's the same result. I try to put and meta tag with windows-1251 between head tag but nothing happens again. P.P.S: Script that fetches the Winamp's data (lastplayed.php): <?php /****** * You may use and/or modify this script as long as you: * 1. Keep my name & webpage mentioned * 2. Don't use it for commercial purposes * * If you want to use this script without complying to the rules above, please contact me first at: [email protected] * * Author: Martijn Korse * Website: http://devshed.excudo.net * * Date: 08-05-2006 ***/ /** * version 2.0 */ class Radio { var $fields = array(); var $fieldsDefaults = array("Server Status", "Stream Status", "Listener Peak", "Average Listen Time", "Stream Title", "Content Type", "Stream Genre", "Stream URL", "Current Song"); var $very_first_str; var $domain, $port, $path; var $errno, $errstr; var $trackLists = array(); var $isShoutcast; var $nonShoutcastData = array( "Server Status" => "n/a", "Stream Status" => "n/a", "Listener Peak" => "n/a", "Average Listen Time" => "n/a", "Stream Title" => "n/a", "Content Type" => "n/a", "Stream Genre" => "n/a", "Stream URL" => "n/a", "Stream AIM" => "n/a", "Stream IRC" => "n/a", "Current Song" => "n/a" ); var $altServer = False; function Radio($url) { $parsed_url = parse_url($url); $this->domain = isset($parsed_url['host']) ? $parsed_url['host'] : ""; $this->port = !isset($parsed_url['port']) || empty($parsed_url['port']) ? "80" : $parsed_url['port']; $this->path = empty($parsed_url['path']) ? "/" : $parsed_url['path']; if (empty($this->domain)) { $this->domain = $this->path; $this->path = ""; } $this->setOffset("Current Stream Information"); $this->setFields(); // setting default fields $this->setTableStart("<table border=0 cellpadding=2 cellspacing=2>"); $this->setTableEnd("</table>"); } function setFields($array=False) { if (!$array) $this->fields = $this->fieldsDefaults; else $this->fields = $array; } function setOffset($string) { $this->very_first_str = $string; } function setTableStart($string) { $this->tableStart = $string; } function setTableEnd($string) { $this->tableEnd = $string; } function getHTML($page=False) { if (!$page) $page = $this->path; $contents = ""; $domain = (substr($this->domain, 0, 7) == "http://") ? substr($this->domain, 7) : $this->domain; if (@$fp = fsockopen($domain, $this->port, $this->errno, $this->errstr, 2)) { fputs($fp, "GET ".$page." HTTP/1.1\r\n". "User-Agent: Mozilla/4.0 (compatible; MSIE 5.5; Windows 98)\r\n". "Accept: */*\r\n". "Host: ".$domain."\r\n\r\n"); $c = 0; while (!feof($fp) && $c <= 20) { $contents .= fgets($fp, 4096); $c++; } fclose ($fp); preg_match("/(Content-Type:)(.*)/i", $contents, $matches); if (count($matches) > 0) { $contentType = trim($matches[2]); if ($contentType == "text/html") { $this->isShoutcast = True; return $contents; } else { $this->isShoutcast = False; $htmlContent = substr($contents, 0, strpos($contents, "\r\n\r\n")); $dataStr = str_replace("\r", "\n", str_replace("\r\n", "\n", $contents)); $lines = explode("\n", $dataStr); foreach ($lines AS $line) { if ($dp = strpos($line, ":")) { $key = substr($line, 0, $dp); $value = trim(substr($line, ($dp+1))); if (preg_match("/genre/i", $key)) $this->nonShoutcastData['Stream Genre'] = $value; if (preg_match("/name/i", $key)) $this->nonShoutcastData['Stream Title'] = $value; if (preg_match("/url/i", $key)) $this->nonShoutcastData['Stream URL'] = $value; if (preg_match("/content-type/i", $key)) $this->nonShoutcastData['Content Type'] = $value; if (preg_match("/icy-br/i", $key)) $this->nonShoutcastData['Stream Status'] = "Stream is up at ".$value."kbps"; if (preg_match("/icy-notice2/i", $key)) { $this->nonShoutcastData['Server Status'] = "This is <span style=\"color: red;\">not</span> a Shoutcast server!"; if (preg_match("/ultravox/i", $value)) $this->nonShoutcastData['Server Status'] .= " But an <a href=\"http://ultravox.aol.com/\" target=\"_blank\">Ultravox</a> Server"; $this->altServer = $value; } } } return nl2br($htmlContent); } } else return $contents; } else { return False; } } function getServerInfo($display_array=null, $very_first_str=null) { if (!isset($display_array)) $display_array = $this->fields; if (!isset($very_first_str)) $very_first_str = $this->very_first_str; if ($html = $this->getHTML()) { // parsing the contents $data = array(); foreach ($display_array AS $key => $item) { if ($this->isShoutcast) { $very_first_pos = stripos($html, $very_first_str); $first_pos = stripos($html, $item, $very_first_pos); $line_start = strpos($html, "<td>", $first_pos); $line_end = strpos($html, "</td>", $line_start) + 4; $difference = $line_end - $line_start; $line = substr($html, $line_start, $difference); $data[$key] = strip_tags($line); } else { $data[$key] = $this->nonShoutcastData[$item]; } } return $data; } else { return $this->errstr." (".$this->errno.")"; } } function createHistoryArray($page) { if (!in_array($page, $this->trackLists)) { $this->trackLists[] = $page; if ($html = $this->getHTML($page)) { $fromPos = stripos($html, $this->tableStart); $toPos = stripos($html, $this->tableEnd, $fromPos); $tableData = substr($html, $fromPos, ($toPos-$fromPos)); $lines = explode("</tr><tr>", $tableData); $tracks = array(); $c = 0; foreach ($lines AS $line) { $info = explode ("</td><td>", $line); $time = trim(strip_tags($info[0])); if (substr($time, 0, 9) != "Copyright" && !preg_match("/Tag Loomis, Tom Pepper and Justin Frankel/i", $info[1])) { $this->tracks[$c]['time'] = $time; $this->tracks[$c++]['track'] = trim(strip_tags($info[1])); } } if (count($this->tracks) > 0) { unset($this->tracks[0]); if (isset($this->tracks[1])) $this->tracks[1]['track'] = str_replace("Current Song", "", $this->tracks[1]['track']); } } else { $this->tracks[0] = array("time"=>$this->errno, "track"=>$this->errstr); } } } function getHistoryArray($page="/played.html") { if (!in_array($page, $this->trackLists)) $this->createHistoryArray($page); return $this->tracks; } function getHistoryTable($page="/played.html", $trackColText=False, $class=False) { $title_utf8 = mb_convert_encoding($trackArr ,"utf-8" ,"auto"); if (!in_array($page, $this->trackLists)) $this->createHistoryArray($page); if ($trackColText) $output .= " <div class='lastplayed_top'></div> <div".($class ? " class=\"".$class."\"" : "").">"; foreach ($this->tracks AS $title_utf8) $output .= "<div style='padding:2px 0;'>".$title_utf8['track']."</div>"; $output .= "</div><div class='lastplayed_bottom'></div> <div class='lastplayed_title'>".$trackColText."</div> \n"; return $output; } } // this is needed for those with a php version < 5 // the function is copied from the user comments @ php.net (http://nl3.php.net/stripos) if (!function_exists("stripos")) { function stripos($haystack, $needle, $offset=0) { return strpos(strtoupper($haystack), strtoupper($needle), $offset); } } ?> And the calling script outside the lastplayed.php: include "lastplayed.php"; $radio = new Radio($ip.":".$port); echo $radio->getHistoryTable("/played.html", "<b>Last played:</b>", "lastplayed_content");

    Read the article

  • PHP Mcrypt - Encrypting / Decrypting file

    - by whitman6732
    Trying to write a couple of functions that will encrypt or decrypt a file and am using the class found here to try and accomplish this: http://www.itnewb.com/v/PHP-Encryption-Decryption-Using-the-MCrypt-Library-libmcrypt The encryption function below seems to work, in that it appears to encrypt the file and place it in the intended directory. I'm trying to decrypt the file now, and it just dies with the message "Failed to complete decryption" (which is coded in there...) There's nothing in the php error logs, so I'm not sure why it's failing, but as mcrypt is entirely new to me, I'm more than inclined to believe I'm doing something wrong here... Here are the functions: //ENCRYPT FILE function encryptFile() { global $cryptastic; $pass = PGPPASS; $salt = PGPSALT; $key = $cryptastic->pbkdf2($pass, $salt, 1000, 32) or die("Failed to generate secret key."); if ($handle = opendir(PATH.'/ftpd')) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != "..") { $newfile = PATH.'/encrypted/'.$file.'.txt'; $msg = file_get_contents(PATH.'/ftpd/'.$file); $encrypted = $cryptastic->encrypt($msg, $key) or die("Failed to complete encryption."); $nfile = fopen($newfile, 'w'); fwrite($nfile, $encrypted); fclose($nfile); unlink(PATH.'/ftpd/'.$file); } } closedir($handle); } //DECRYPT FILE function inFTP() { global $cryptastic; $pass = PGPPASS; $salt = PGPSALT; $key = $cryptastic->pbkdf2($pass, $salt, 1000, 32) or die("Failed to generate secret key."); if ($handle = opendir(PATH.'/encrypted')) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != "..") { $newfile = PATH.'/decrypted/'.$file; $msg = PATH.'/encrypted/'.$file; $decrypted = $cryptastic->decrypt($msg, $key) or die("Failed to complete decryption."); $nfile = fopen($newfile, 'w'); fwrite($nfile, $decrypted); fclose($nfile); //unlink(PATH.'/encrypted/'.$file); } } closedir($handle); } //$crypt->decrypt($file); }

    Read the article

  • Why is win32com so much slower than xlrd?

    - by Josh
    I have the same code, written using win32com and xlrd. xlrd preforms the algorithm in less than a second, while win32com takes minutes. Here is the win32com: def makeDict(ws): """makes dict with key as header name, value as tuple of column begin and column end (inclusive)""" wsHeaders = {} # key is header name, value is column begin and end inclusive for cnum in xrange(9, find_last_col(ws)): if ws.Cells(7, cnum).Value: wsHeaders[str(ws.Cells(7, cnum).Value)] = (cnum, find_last_col(ws)) for cend in xrange(cnum + 1, find_last_col(ws)): #finds end column if ws.Cells(7, cend).Value: wsHeaders[str(ws.Cells(7, cnum).Value)] = (cnum, cend - 1) break return wsHeaders And the xlrd def makeDict(ws): """makes dict with key as header name, value as tuple of column begin and column end (inclusive)""" wsHeaders = {} # key is header name, value is column begin and end inclusive for cnum in xrange(8, ws.ncols): if ws.cell_value(6, cnum): wsHeaders[str(ws.cell_value(6, cnum))] = (cnum, ws.ncols) for cend in xrange(cnum + 1, ws.ncols):#finds end column if ws.cell_value(6, cend): wsHeaders[str(ws.cell_value(6, cnum))] = (cnum, cend - 1) break return wsHeaders

    Read the article

  • HttpURLConnection does not read the whole respnse

    - by Peter Szanto
    I use HttpURLConnection to do HTTP POST but I dont always get back the full response. I wanted to debug the problem, but when I step through each line it worked. I thought it must be a timing issue so I added Thread.sleep and it really made my code work, but this is only a temporary workaround. I wonder why is this happening and how to solve. Here is my code: URL u = new URL(url); URLConnection c = u.openConnection(); InputStream in = null; String mediaType = null; if (c instanceof HttpURLConnection) { //c.setConnectTimeout(1000000); //c.setReadTimeout(1000000); HttpURLConnection h = (HttpURLConnection)c; h.setRequestMethod("POST"); //h.setChunkedStreamingMode(-1); setAccept(h, expectedMimeType); h.setRequestProperty("Content-Type", inputMimeType); for(String key: httpHeaders.keySet()) { h.setRequestProperty(key, httpHeaders.get(key)); if (logger.isDebugEnabled()) { logger.debug("Request property key : " + key + " / value : " + httpHeaders.get(key)); } } h.setDoOutput(true); h.connect(); OutputStream out = h.getOutputStream(); out.write(input.getBytes()); out.close(); mediaType = h.getContentType(); logger.debug(" ------------------ sleep ------------------ START"); try { Thread.sleep(2000); } catch (InterruptedException e) { e.printStackTrace(); } logger.debug(" ------------------ sleep ------------------ END"); if (h.getResponseCode() < 400) { in = h.getInputStream(); } else { in = h.getErrorStream(); } It genearates the following HTTP headers POST /emailauthentication/ HTTP/1.1 Accept: application/xml Content-Type: application/xml Authorization: OAuth oauth_consumer_key="b465472b-d872-42b9-030e-4e74b9b60e39",oauth_nonce="YnDb5eepuLm%2Fbs",oauth_signature="dbN%2FWeWs2G00mk%2BX6uIi3thJxlM%3D", oauth_signature_method="HMAC-SHA1", oauth_timestamp="1276524919", oauth_token="", oauth_version="1.0" User-Agent: Java/1.6.0_20 Host: test:6580 Connection: keep-alive Content-Length: 1107 In other posts it was suggested to turn off keep-alive by using the http.keepAlive=false system property, I tried that and the headers changed to POST /emailauthentication/ HTTP/1.1 Accept: application/xml Content-Type: application/xml Authorization: OAuth oauth_consumer_key="b465472b-d872-42b9-030e-4e74b9b60e39", oauth_nonce="Eaiezrj6X4Ttt0", oauth_signature="ND9fAdZMqbYPR2j%2FXUCZmI90rSI%3D", oauth_signature_method="HMAC-SHA1", oauth_timestamp="1276526608", oauth_token="", oauth_version="1.0" User-Agent: Java/1.6.0_20 Host: test:6580 Connection: close Content-Length: 1107 the Connection header is "close" but I still cannot read the whole response. Any idea what do I do wrong?

    Read the article

  • Entity Framework doesn't like 0..1 to * relationships.

    - by Orion Adrian
    I have a database framework where I have two tables. The first table has a single column that is an identity and primary key. The second table contains two columns. One is a nvarchar primary key and the other is a nullable foreign key to the first table. On the default import of the database I get the following error: Condition cannot be specified for Column member 'ForeignKeyId' because it is marked with a 'Computed' or 'Identity' StoreGeneratedPattern. where ForeignKeyId is the second foreign key reference in the second table. Is this just something the entity model doesn't do? Or am I missing something?

    Read the article

  • mysql composite unique on FK's

    - by m2o
    I want to implement the following constraints in mysql: create table TypeMapping( ... constraint unique(server_id,type_id), constraint foreign key(server_id) references Server(id), constraint foreign key(type_id) references Type(id) ); This throws a 'ERROR 1062 (23000): Duplicate entry '3-4' for key 'server_id'' when I issue an insert/update that would break the constraint. Is this type of constraint even possible? If so how? Thank you.

    Read the article

  • dual map structure implementation?

    - by Danra
    Hey, I'm looking for a standard dual-map structure - is there one implemented in std/boost/another standard C++ library? When I say "dual-map" I mean a map which can be indexed efficiently both by the key and the "value" (it actually has two key types instead of one key type and one value type). for example: dualmap<int,string> m; m[1] = "foo"; m["bar"] = 2 int a = m["bar"]; // a = 2 Thanks, Dan

    Read the article

  • Is there a way to move two squares in OpenGL simultaneously?

    - by thyrgle
    Hi, so I have a function that handles key presses in a game I'm working on in OpenGL. But, the thing is that even though I have made two squares and they both move when the correct key is pressed only one square is moved. Is there a way I can make the two squares move. This is the glutKeyboardFunc function I implimented: void handleKeypress(unsigned char key, int x, int y) { switch (key) { case 27: exit(0); break; case 'w': glutTimerFunc(0.001, moveSquareUp, 0); break; case 'd': glutTimerFunc(0.001, moveSquareRight, 0); break; case 's': glutTimerFunc(0.001, moveSquareDown, 0); break; case 'a': glutTimerFunc(0.001, moveSquareLeft, 0); break; } } If you need any more code just ask.

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in SQL Server 2008

    - by bodziec
    I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • Magic Methods in Python

    - by dArignac
    Howdy, I'm kind of new to Python and I wonder if there is a way to create something like the magic methods in PHP (http://www.php.net/manual/en/language.oop5.overloading.php#language.oop5.overloading.methods) My aim is to ease the access of child classes in my model. I basically have a parent class that has n child classes. These classes have three values, a language key, a translation key and a translation value. The are describing a kind of generic translation handling. The parent class can have translations for different translation key each in different languages. E.g. the key "title" can be translated into german and english and the key "description" too (and so far and so on) I don't want to get the child classes and filter by the set values (at least I want but not explicitly, the concrete implementation behind the magic method would do this). I want to call parent_class.title['de'] # or also possible maybe parent_class.title('de') for getting the translation of title in german (de). So there has to be a magic method that takes the name of the called method and their params (as in PHP). As far as I dug into Python this is only possible with simple attributes (_getattr_, _setattr_) or with setting/getting directly within the class (_getitem_, _setitem_) which both do not fit my needs. Maybe there is a solution for this? Please help! Thanks in advance!

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • What's wrong with my code? (pdcurses/getmaxyx)

    - by flarn2006
    It gives me an access violation on the getmaxyx line (second line in the main function) and also gives me these two warnings: LINK : warning LNK4049: locally defined symbol "_stdscr" imported LINK : warning LNK4049: locally defined symbol "_SP" imported Yes, it's the same code as in another question I asked, it's just that I'm making it more clear. And yes, I have written programs with pdcurses before with no problems. #include <time.h> #include <curses.h> #include "Ball.h" #include "Paddle.h" #include "config.h" int main(int argc, char *argv[]) { int maxY, maxX; getmaxyx(stdscr, maxY, maxX); Paddle *paddleLeft = new Paddle(0, KEY_L_UP, KEY_L_DOWN); Paddle *paddleRight = new Paddle(maxX, KEY_R_UP, KEY_R_DOWN); Ball *ball = new Ball(paddleLeft, paddleRight); int key = 0; initscr(); cbreak(); noecho(); curs_set(0); while (key != KEY_QUIT) { key = getch(); paddleLeft->OnKeyPress(key); paddleRight->OnKeyPress(key); } endwin(); return 0; }

    Read the article

  • Generating short license keys with OpenSSL

    - by Marc Charbonneau
    I'm working on a new licensing scheme for my software, based on OpenSSL public / private key encryption. My past approach, based on this article, was to use a large private key size and encrypt an SHA1 hashed string, which I sent to the customer as a license file (the base64 encoded hash is about a paragraph in length). I know someone could still easily crack my application, but it prevented someone from making a key generator, which I think would hurt more in the long run. For various reasons I want to move away from license files and simply email a 16 character base32 string the customer can type into the application. Even using small private keys (which I understand are trivial to crack), it's hard to get the encrypted hash this small. Would there be any benefit to using the same strategy to generated an encrypted hash, but simply using the first 16 characters as a license key? If not, is there a better alternative that will create keys in the format I want?

    Read the article

  • Design for tagging system in GAE-J

    - by tempy
    I need a simple tagging system in GAE-J. As I see it, the entity that is being tagged should have a collection of keys referring to the tags with which it's associated. A tag entity should simply contain the tag string itself, and a collection of keys pointing to the entities associated with the tag. When an entity's list of tags is altered, the system will create a new tag if the tag is unknown, and then append the entity's key to that tag's key collection. If the tag already exists, then the entity's key is simply appended to the tag's key collection. This seems relatively straight-forward and uncontroversial to me, but I would like some feedback on this design, just to be sure.

    Read the article

  • Clean way to perform commands in the Emacs minibuffer

    - by Christopher Monsanto
    Consider the following example: I want to read a file using ido from the minibuffer, but merge in all of the directories I use often. I can't just execute (ido-find-file) (ido-merge-work-directories) Because the second sexp will only execute after the user is finished selecting the file. The question then is: what is the best/cleanest way to execute commands in the minibuffer's command loop? The only way I know to do this is to bind my desired command to a key sequence, and add that sequence to unread-command-events so the key runs once we enter the minibuffer command loop: (setq unread-command-events (append (listify-key-sequence (kbd "M-s")) unread-command-events)) ; std key-binding for ido-merge-work-directories (ido-find-file) But that is very hacky, and I would like to know if there is a better solution. Thanks!

    Read the article

  • What benefits are there to storing Javascript in external files vs in the <head>?

    - by RenderIn
    I have an Ajax-enabled CRUD application. If I display a record from my database it shows that record's values for each column, including its primary key. For the Ajax actions tied to buttons on the page I am able to set up their calls by printing the ID directly into their onclick functions when rendering the HTML server-side. For example, to save changes to the record I may have a button as follows, with '123' being the primary key of the record. <button type="button" onclick="saveRecord('123')">Save</button> Sometimes I have pages with Javascript generating HTML and Javascript. In some of these cases the primary key is not naturally available at that place in the code. In these cases I took a shortcut and generate buttons like so, taking the primary key from a place it happens to be displayed on screen for visual consumption: ... <td>Primary Key: </td> <td><span id="PRIM_KEY">123</span></td> ... <button type="button" onclick="saveRecord(jQuery('#PRIM_KEY').text())">DoSomething</button> This definitely works, but it seems wrong to drive database queries based on the value of text whose purpose was user consumption rather than method consumption. I could solve this by adding a series of additional parameters to various methods to usher the primary key along until it is eventually needed, but that also seems clunky. The most natural way for me to solve this problem would be to simply situate all the Javascript which currently lives in external files, in the <head> of the page. In that way I could generate custom Javascript methods without having to pass around as many parameters. Other than readability, I'm struggling to see what benefit there is to storing Javascript externally. It seems like it makes the already weak marriage between HTML/DOM and Javascript all the more distant. I've seen some people suggest that I leave the Javascript external, but do set various "custom" variables on the page itself, for example, in PHP: <script type="text/javascript"> var primaryKey = <?php print $primaryKey; ?>; </script> <script type="text/javascript" src="my-external-js-file-depending-on-primaryKey-being-set.js"></script> How is this any better than just putting all the Javascript on the page in the first place? There HTML and Javascript are still strongly dependent on each other.

    Read the article

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • MSI Installer start auto-repair when service starts

    - by Josh Clark
    I have a WiX based MSI that installs a service and some shortcuts (and lots of other files that don't). The shortcut is created as described in the WiX docs with a registry key under HKCU as the key file. This is an all users install, but to get past ICE38, this registry key has to be under the current user. When the service starts (it runs under the SYSTEM account) it notices that that registry key isn't valid (at least of that user) and runs the install again to "repair". In the Event Log I get MsiInstaller Events 1001 and 1004 showing that "The resource 'HKEY_CURRENT_USER\SOFTWARE\MyInstaller\Foo' does not exist." This isn't surprising since the SYSTEM user wouldn't have this key. I turned on system wide MSI logging and the auto-repair created its log file in the C:\Windows\Temp folder rather than a specific user's TEMP folder which seems to imply the current user was SYSTEM (plus the log file shows the "Calling process" to be my service). Is there something I can do to disable the auto-repair functionality? Am I doing something wrong or breaking some MSI rule? Any hints on where to look next?

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

< Previous Page | 209 210 211 212 213 214 215 216 217 218 219 220  | Next Page >